How ID sheds light on the classic free will dilemma
| July 11, 2011 | Posted by Eric Holloway under Design inference, Ethics, Intelligent Design, Philosophy, Psychology |
The standard argument against free will is that it is incoherent. It claims that a free agent must either be determined or non-determined. If the free agent is determined, then it cannot be responsible for its choices. On the other hand, if it is non-determined, then its choices are random and uncontrolled. Neither case preserves the notion of responsibility that proponents of free will wish to maintain. Thus, since there is no sensible way to define free will, it is incoherent. [1]
Note that this is not really an argument against free will, but merely an argument that we cannot talk about free will. So, if someone were to produce another way of talking about free will the argument is satisfied.
Does ID help us in this case? It appears so. If we relabel “determinism” and “non-determinism” as “necessity” and “chance”, ID shows us that there is a third way we might talk about free will.
In the universe of ID there are more causal agents than the duo of necessity and chance. There is also intelligent causality. Dr. Dembski demonstrates this through his notion of the explanatory filter. While the tractability of the explanatory filter may be up for debate, it is clear that the filter is a coherent concept. The very fact that there is debate over whether it can be applied in a tractable manner means the filter is well defined enough to be debated.
The explanatory filter consists of a three stage process to detect design in an event. First, necessity must be eliminated as a causal explanation. This means the event cannot have been the precisely determined outcome of a prior state. Second, chance must be eliminated. As such, the event must be very unlikely to have occurred, such that it isn’t possible to have queried half or more of the event space with the number of queries available.
At this point, it may appear we’ve arrived at our needed third way, and quite easily at that. We merely must deny that an event is caused by chance or necessity. However, things are not so simple. The problem is that these criteria do not specify an event. If an event does meet these criteria, then the unfortunate implication is so does every other event in the event space. In the end the criteria become a distinction without a difference, and we are thrust right back into the original dilemma. Removing chance and necessity merely gives us improbability (P < 0.5), also called “complexity” in ID parlance.
What we need is a third criteria, called specificity. This criteria can be thought of as a sort of compression, it describes the event in simpler terms. One example is a STOP sign. The basic material of the sign is a set of particles in a configuration. To describe the sign in terms of the configuration is a very arduous and lengthy task, essentially a list of each particle’s type and position. However, we can describe the sign in a much simpler manner by providing a computer, which knows how to compose particles into a sign according to a pattern language, with the instructions to write the word STOP on a sign.
According to a concept called Kolmogrov Complexity [2], such machines and instructions form a compression of the event, and thus specify a subset of the event space in an objective manner. This solves the previous problem where no events were specified. Now, only a small set of events are specified. While KC is not a necessary component of Dr. Dembski’s explanatory filter, it can be considered a sufficient criteria for specificity.
With this third criteria of specificity, we now have a distinction that makes a difference. Namely, it shows we still have something even after removing chance and necessity: we have complex specified information (CSI). CSI has two properties that make it useful for the free will debate. First, it is a definition of an event that is neither caused by necessity or chance. As such, it is not susceptible to the original dilemma. Furthermore, it provides a subtle and helpful distinction for the argument. CSI does not avoid the distinction between determinism and non-determinism. It still falls within the non-determinism branch. However, CSI shows that randomness is not an exhaustive description of non-determinism. Instead, the non-determinism branch further splits into a randomness branch and a CSI branch.
The second advantage of CSI is that it is a coherent concept defined with mathematical precision. And, with a coherently definition, the original argument vanishes. As pointed out in the beginning of the article, the classic argument against free will is not an argument against something. It is merely an argument that we cannot talk about something because we do not possess sufficient language. Properly understood, the classical argument is more of a question, asking what is the correct terminology. But, with the advent of CSI we now have at least one answer to the classical question about free will.
So, how can we coherently talk about a responsible free will if we can only say it is either determined and necessary, or non-determined and potentially random? One precise answer is that CSI describes an entity that is both non-determined while at the same time non-random.
——————-
[1] A rundown of many different forms of this argument is located here:http://www.informationphilosopher.com/freedom/standard_argument.html
[2] http://en.wikipedia.org/wiki/Kolmogorov_complexity
274 Responses to How ID sheds light on the classic free will dilemma
Leave a Reply
You must be logged in to post a comment.
The whole point of free will, it seems to me, is who is doing the determining? I haven’t really thought about it that much, but I think I’m ok with saying that all choices are “determined” since this just seems another way to describe causality. Nothing happens in a finite universe without a cause and no choice gets made (in this finite universe, at least) without a cause, either.
The real issue is who chooses? The laws of physics (where all explanation for the naturalist hangs out) or an embodied, yet separate, soul or mind? Well, the laws of physics can’t explain much except the interactions of particles in energy fields and only about 4 or 5% of that if dark matter and dark energy are considered. And it’s obvious that physics can’t explain free will. (That’s why they deny it.) The point being that physics can only explain material or physical phenomena. Physics has nothing to say about morality, teleology, mathematics, reason, language, information, free will, choice, purpose, you know, all the things that we do and think about that kinda sorta make us human. In other words, all of the concepts that are tied up in the Greek word logos.
Since these things are obvious to almost anyone, the only out left for the naturalist is to say, well, then, if we can’t explain it, we’ll just have to deny it. So poof, no purpose, no morality, no teleology, no free will, blah blah blah.
I’d like to genuinely ask anyone that manages to read this post and subscribes to some robust form of naturalism/materialism/physicalism (NMP) a couple of questions.
First, does NMP not entail, as an ontological position, that all that exists, all that is real, is material (matter and/or energy) or natural (throw in math if we have to) or physical (mind = brain)? Isn’t this what NMP means? I believe it does and every word I’ve read about it says so too.
Second, if this is true, and we can assume it is true for the moment, wouldn’t it also be true that if all that exists is material/physical then it must be described (or will be described as “science” progresses) by the laws of physics? I am sure this is so and I believe “you” call it the causal closure of nature. That is, nothing outside of nature (which the laws of physics are, BTW, but that’s another hook which I am not baiting today) has any causal power in nature. Nothing like God, gods, souls, minds, angels, whatever can cause anything in this universe. I’m pretty sure I have this much right. Nature is all that there is and physics explains and describes all of it and everything that happens in it.
Third, now I’d like to pose some questions about information generated by humans. Not the biological information that anti-ID types blather on about endlessly – “you can’t define or measure it so it’s not science.” I am avoiding that entire swamp right now and restricting this discussion to information (like this post, for instance) created and encoded, sent, and decoded and understood by human beings. That should be uncontroversial enough that the actual issues can be addressed.
Q-1 concerning information. Doesn’t the existence of information require the existence of a language? It would seem so. I can’t imagine, and neither can anyone else imagine, thinking or expressing a coherent thought apart from a language.
Q-2. What does a language consist of? It consists of a set of symbols (in this case the English alphabet), a set of words, called a vocabulary, and a set of rules called grammar and syntax for arranging those words into phrases, sentences, and paragraphs. Thus, I can arrange letters in my mind, pick them out on a keyboard, strike them, and string together hundreds of symbols that mean something to the readers who understand English. So if I say “it’s raining” the English speaker would understand that droplets of water are falling from the sky. If I said “es regnet” the English speaker would say ‘huh’ and would not have a clue about what I was saying. On the other hand, a German speaker would understand that I just said droplets of water are falling from the sky. In any case, no language, no message that it is raining.
Q-3. What other things might the creation of information require? I’ve thought about this for a minute or three and I have a short list of other prerequisites for the creation of human information. The laws of reason are first. Just as thought is impossible without language, so is language impossible without the laws of identity, non-contradiction, and excluded middle. All language, or so I say, has at its core, the immutable, eternal, immanent, transcendent, sovereign (over truth) laws of logic. Sometimes called First Principles or the Rules of Right Reason or the Laws of Rational Thought. (Or God but that’s another story, too.)
There is still an unaccounted for first principle and that is causality. In terms of information we can call it purpose or intent. So I can say with certainty, (modus tollens coming) “If I did not intend to say anything I would not be saying anything. But I am saying something. Therefore, I INTENDED or PURPOSED to say something.” Therefore, purpose, has as much ontological status as a quark or lepton. It exists in this universe else there would never be any information created by human beings. It is impossible for an infinite regress in a chain of causes for the creation of information to exist, either, and the ultimate first cause of my typing this post is my free will. I’m doing it because I want to.
The final piece of the information puzzle is free will. That should also be pretty evident by now. There is no algorithm or physical law that can explain the rational, purposeful creation of information. Indeed, free will is NECESSARY for the creation of information. Were I constrained by physical law (classical realm) my typing might look like “aaaaaaaaa” or “ababababab” or some such other nonsense. Were I constrained by physical law (quantum realm) my typing might look like “84ifj84ejug830” or some such other nonsense. In either case, if I happened to, by accident, create a string of English letters that meant something they would still be meaningless without the symbols, vocabulary, and rules of English, none of which are amenable to explanation by physics of any kind. I must be free to pick and choose among the various letters presented to me by my keyboard. This cannot be explained by reference to physical laws. Not now, not ever.
To recap my prerequisites for language. I say that first of all, Reason is required. Second is language (symbols and rules). Third is purpose. Fourth is free will. Without all of these things being present, the creation of information is impossible. Oddly enough, none of these things can be explained by reference to physical laws. Another modus tollens argument is suggested.
If NMP were true, then physics could explain human information (reason, language, purpose, free will). But physics cannot explain information (reason, language, purpose, free will). Therefore, naturalism is false.
Someone may say, modus tollens isn’t a valid form of argument. May I address that ahead of time. Modus tollens is a valid form of argument IFF there is a necessary connection between the antecedent and the consequent. In this case, since the consequent is part of the definition of the antecedent (law of identity), this necessary connection exists, and the argument is valid.
Not only is naturalism false, it is not even possible for it to be true. So we have the spectacle, the SPECTACLE, of allegedly smart (“brights”), educated, serious, thoughtful people, communicating that none of the things that enable them to communicate exist in nature.
So, Mr/Mrs/Ms naturalist, materialist, physicalist, I would like to hear from you. How do you attack this argument? How do you deny the existence of an immaterial substance, information, when you have to use information to assert the denial? This seems so, so fundamental and rational that I cannot understand why anyone would possibly deny the truth of this. But some do and inquiring minds want to know why. And so do I.
A very interesting OP!
I think you hit the nail on the head! Unfortunately, I think it’s the wrong nail!
But it’s bang next door to the right one.
The key part to me is where you mention compressibility.
But I think that’s where both ID and your own argument go wrong (but so close!)
Compressibility, you explain thus: “To describe the sign in terms of the configuration is a very arduous and lengthy task, essentially a list of each particle’s type and position. However, we can describe the sign in a much simpler manner by providing a computer, which knows how to compose particles into a sign according to a pattern language, with the instructions to write the word STOP on a sign.”
Right. And I think that is exactly why materialism is not (or need not be) reductionist – free will is perfectly coherent as long as we consider it in “compressed” form – as the action of an agent acting on good information with an intended goal. As you imply.
But that does not mean that processes that go into this will-ing agent are not our old friends “Chance and Necessity” – it just means that free will cannot be understood at that level- it only makes sense at at the compressed level, just as a message in binary form cannot be understood until it is translated into ascii characters which we then further compress into English words and sentences.
Well, that’s poorly expressed, but I was excited by your post!
Off to bed, and will think further.
Cheers
Lizzie
tgpeeler:
We crossposted. But you ask:
No, I don’t think it does. I think some proponents think it does mean that, and some opponents too, but I think both are wrong, for reasons I tried badly to express above.
I think you ask absolutely the right question when you say: “The whole point of free will, it seems to me, is who is doing the determining?”
Or as the wag had it when asked about free will: “who is Will? and why should he be free?”
The point being that it is not will that we want to be free, but ourselves. So the issue of free will really boils down to the question who am I? Or, to be more semiotic about it: what is the referent for the word “I” when I say “I am free”?
And that’s why I thought the connection with the idea of “compressiblity” was pretty cool, in the OP. When I refer to myself, as an intentional agent, I am compressing all the things that go into my decision making into something I take ownership of and define as myself. As Daniel Dennett says: the act of accepting moral responsibility for our actions is a self-forming act. We become free by taking ownership of our actions. By compressing them into a thing we refer to as “I”.
OK, really time for bed now
Interesting thread.
As Daniel Dennett says: the act of accepting moral responsibility for our actions is a self-forming act. We become free by taking ownership of our actions. By compressing them into a thing we refer to as “I”.
Dan Dennett on “I” and “intentionality”: Suppose you have composed a shopping list, on a piece of paper, to guide your shopping behavior. The marks on the piece of paper have derived intentionality, of course, but if you forgo the shopping list and just remember the wanted items in your head, whatever it is that “stores” or “represents” the items to be purchased in your brain has exactly the same status as the trails of ink on the paper. There is no more real, or intrinsic, or original intentionality than that.
and
Presumably Fodor et al. would be content to let me say this, since, after all, the two-bitser is just an artifact. It has no intrinsic, original intentionality, so there is no “deeper” fact of the matter we might try to uncover. This is just a pragmatic matter of how best to talk, when talking metaphorically and anthropomorphically about the states of the device.
But we part company when I claim to apply precisely the same morals, the same pragmatic rules of interpretation, to the human case. In the case of human beings (at least), Fodor and company are sure that such deeper facts do exist–even if we cannot always find them. That is, they suppose that, independently of the power of any observer or interpreter to discover it, there is always a fact of the matter about what a person (or a person’s mental state) really means. Now we might call their shared belief a belief in intrinsic intentionality, or perhaps even objective or real intentionality. There are differences among them about how to characterize, and name, this property of human minds, which I will continue to call original intentionality, but they all agree that minds are unlike the two-bitser in this regard.
I part company with these others, because although they might agree with me (and Millikan) about what one should say in the case of the transported two-bitser, they say that we human beings are not just fancier, more sophisticated two-bitsers. When we say that we go into the state of believing that we are perceiving a U.S. quarter (or some genuine water as opposed to XYZ, or a genuine twinge of arthritis) this is no metaphor, no mere manner of speaking.
So, for Dennett, there is no ‘fact of the matter’ what a person thinks or intends. There’s not even a fact of the matter that persons or selves exist. All that exists is metaphor and convenient ways of speaking. The only “selves” that exist are what are treated as selves by convention. And there’s no convention other than what’s treated as convention by another convention.
Tgpeeler, in other words, was dead on accurate. And Liddle, as usual, is engaged in an incoherent argument (Basically saying ‘we define ourselves into existence!’ – But that starts with the ‘we’ we need to explain. Well, we defined that too! And if this seems incoherent, mumble a little about emergence and recursion. Whatever makes those warm fuzzies warm.)
So when talk about agents intending this or that is mentioned, or if goals are mentioned, just remember: For the consistent materialist, these things are just metaphors, useful fictions, and conventions. If they weren’t – if there was intentionality, aboutness, and meaning in the world that wasn’t just a metaphor or a convention, materialism would be false, and some other metaphysics would be true (and more than ‘substance dualism’ is in the running here.)
In other words, materialism – particularly the kind advanced by Dennett – is just a typical exercise in trying to polish a philosophical turd. It’s incoherent, it’s farcical, but it gives some people the warm fuzzies for one reason or another – so a lot of energy is expended trying to dress it up to sound reasonable (oh goodness no – materialism isn’t about denying the obvious!
) when just a plain reading reveals that, yep, it’s actually pretty darn crazy (okay, it denies the obvious, but what’s obvious has to be an illusion because materialism is true, and besides if we deny the obvious the problem becomes tractable for materialism, even though materialism is just a metaphor
).
tgp
“I haven’t really thought about it that much, but I think I’m ok with saying that all choices are “determined” since this just seems another way to describe causality. Nothing happens in a finite universe without a cause and no choice gets made (in this finite universe, at least) without a cause, either.
The real issue is who chooses?”
I have always preferred to use the term free choice which is what I think most people mean when they refer to free will.
Free choice is any choice that is self determined. The freedom to choose whatever we most want at the time the choice is made given the options available to us at that moment.
Vivid
null re 4
Love it.
Vivid
Hi, thanks for the comments all. This post is the first in a series where I investigate how ID provides new insights into areas other than biology. Stay tuned!
vidid, I’m good with free choice.
Eric,
I find that this confuses the issues rather than providing a new way of discussing them. Many versions of incompatibilist free will philosophies posit mind (which you call “intelligent cause”) as being causal and distinct from (or transcendent to) physical cause. But chance is not a “causal agent” in anyone’s philosophy. Chance is a lack of discernable correlation, not some sort of agency that makes things happen.
I think this is also confused. “Randomness” is an attribute of a set of states or events, while “non-determinism” refers to a philosophical position, namely that not all events are inevitably determined by their antecedent causes. So “randomness” is not any sort of description of “non-determinism”, exhaustive or otherwise.
Rather, I think you mean to say that not everything that is undetermined is uncaused, or that not everything that is not caused by lawlike physical necessity is not caused by something else. Again you just seem to be arguing for contra-causal free will, but muddling up the vocabulary.
You’re saying that the “determined branch” holds those things caused by physical necessity, and in the undetermined branch things are either uncaused (which you call “randomness”) or caused by mind/intelligence. The fact that you haven’t said what you mean by “randomness” is making it hard to keep this clear. It’s quite a difficult concept, but it doesn’t simply mean “uncaused” (certain types of events we call “random” can be fully determined by antecedent physical cause).
I agree that there is a vital connection between ID and the free will debate, but it is hardly the one you suggest. Rather than helping to clarify or answer the problem of free will, ID implicitly assumes one particular solution – libertarianism. It may well be true that mental cause is distinct from physical cause, but ID provides no evidence that this is the case, and does nothing to resolve this ancient debate.
EL – um, then what would a robust NMP ontology look like? Anything in there besides sub-atomic particles in energy fields? Besides that, I don’t see that you addressed my argument at all. I guess I’ve forgotten how much fun it is to be argued with and ignored at the same time.
This is the way it’s supposed to work. Since we are allegedly people of reason, one of us makes an argument (premises and conclusion) and defends it. (Shows that it is sound. The form is valid and the premises are true. This means the conclusion is necessarily true.)
I did this with a modus tollens argument about naturalism and information. The argument is valid. That is, the conclusion necessarily follows from the conclusion. I explained this. The argument is sound. That means my premises are true. I explained this. That means my conclusion (naturalism is necessarily false) is necessarily true.
If I read you correctly, you disagree with me about the definition of NMP but then provide no offering of your own while completely ignoring my argument. Let’s try to focus. If you disagree that naturalism means what I say it means then we can play dueling references. You will lose that battle. NMP means exactly what I said it does. So do you hold to that or not? If not, what do you hold to?
null @ 4 “In other words, materialism – particularly the kind advanced by Dennett – is just a typical exercise in trying to polish a philosophical turd. It’s incoherent, it’s farcical,…”
Exactly. Who in their right mind can even entertain garbage like this for a minute? It’s a reflection of how intellectually degenerate the “West” has become that we even have to acknowledge tripe like this much less spend precious time refuting it over AND over AND over again… It just astonishes me. I guess when someone gets to the point where they believe their own BS it’s pretty much all over but the shouting. Can you imagine betting your eternal future or the possibility of one on the intellectual sewage that Dennett spews? Ah well, to each his own, eh?
null – options other than substance dualism? Do tell. Unless it’s just rehashed Aristotle. I hate that guy.
vivid:
Personally, I would like to see the term “free” taken out altogether. But I would settle for it as long as there was a clear distinction made between “the will”, and “choice”. I think I know where you are coming from, though. Most people don’t see the distinction between the will – and choice, which is subsequent to and wholly dependant on the will (information points to a choice having been made, but the choice points to a will). All most people see is the choice aspect, and they know that they make choices “freely” as opposed to under compulsion.
So when I read posts regarding “free will”, I can’t help but think that the author is putting the cart before the horse (no offense, Mr. Holloway). I really do wish that people would just call it “the will” instead of “free will”, and then speak of “choice” as that which flows from the will. The term “free will” muddies the water by lumping the two together, which makes it impossible to discuss what is really going on in the hearts of men.
I really think that if the distinction is made clear, it becomes apparent that the will is in complete bondage, and only then can people really examine themselves, and only then do people start to see the necessity of a rebirth.
re 12 “I think I know where you are coming from, though.”
Reading your last paragraph I think you are right.
“The term “free will” muddies the water by lumping the two together, which makes it impossible to discuss what is really going on in the hearts of men.”
I dont think free will exist its a bad term any way you cut it. I consider it an oxymoron.
Non Posse Non Pecarre (I cannot not sin)
Vivid
“The standard argument against free will is that it is incoherent. It claims that a free agent must either be determined or non-determined. If the free agent is determined, then it cannot be responsible for its choices. On the other hand, if it is non-determined, then its choices are random and uncontrolled. Neither case preserves the notion of responsibility that proponents of free will wish to maintain. Thus, since there is no sensible way to define free will, it is incoherent. [1]”
Hmmm … so, because some persons engage in straw-manning, there is a dilemma about free-will?
“Undetermined” does not equal “randon” … though, materialist like to believe it does.
“If the free agent is determined, then it cannot be responsible for its choices.”
That’s not quite right … if a “free agent” is determined, then, definitially, it is not a free agent.
“… Whatever makes those warm fuzzies warm.”
Exactly.
‘Atheism’ is the enemy of logical reasoning … and of truth-speaking.
Well, of course, the term “free will” contains a redundancy – for, a “will” who is not, in some regard, free, is not a will.
And, of course, people, especially materialists, confuse “free will” with “the ability to make an uncoerced choice”; see, for instance, Vivid’s post #5.
However, given the pervasive materialism in our culture, one ought to understamd that the phrase “free will” is pretty much necessary.
tgpeeler (#1)
No. A baby is able to use information about the world, before acquiring language.
Language existed in spoken form, before there was any alphabet. New words are being coined, so there is no fixed set of words. The “rules” seem to change over time, so maybe there aren’t really rules.
In a usenet post from 2000, linguist Jaques Guy wrote: “The ultimate secret of language is this: language is absurd, illogical. If it were not, it would not work.” I’m inclined to think he was right. (The usenet message ID was [email protected], if you have access to an archive of old usenet posts).
It is very likely that dogs, cat, ants are all using information. Yet we normally don’t credit them with having free will.
Neil Rickert:
How is it that a baby changes what he believes to be the case without doing so based upon a language?
Nullasalus:
You quote Dennett, and write:
No,that isn’t what Dennett is saying, I don’t think. Could you give me the source of the quotation? I think I recognise it, but I’m not sure what it’s from.
tgpeeler:
Checking in
Yes, I “entertain garbage like this”. For considerably longer than a minute even.
But I would deny the charge of intellectual degeneracy. I’d also submit that nullasalus’ paraphrase is not a good paraphrase of Dennett’s view (it certainly isn’t of mine, and I’m pretty sure mine is close to Dennett’s).
Let me quote Dennett on Free Will (Freedom Evolves, pp 305-306 in my edition):
“Our brains have been designed by natural selection, and all the products of our brains have likewise been designed, on a much swifter timescale, by physical processes in which no exemption from causality can be discerned. How, then, can our inventions, our decisions, our sins and triumphs, be any different from the beautiful but amoral webs of the spiders? How can an apple pie, lovingly created as a gift of reconciliation, be any different, morally, from an apple, “cleverly” designed by evolution to attract a frugivore to the bargain of spreading its seeds in return for some fructose? If these are treated as rhetorical questions only, implying that only a miracle could distinguish our creations from the blind, purposeless creations of material mechanisms, we will continue to spiral around the traditional problems of free will and determinism, in a vortex of uncomprehending mystery. Human acts – love and genius, as well as crimes and sins, are just too far away from the happenings in atoms, swerving randomly or not, for us to be able to see at a glance how to put them into a single coherent framework [cf the OP point about compressiblity]. Philosophers for thousands of years have tried to bridge the gap with a bold stroke or two, either putting science in its place or putting human pride in its place – or declaring (correctly, but unconvincingly) that the incompatibility is only apparent without going into the details. By trying to answer the questions, by sketching out the non-miraculous paths that can take us all the way from senseless atoms to freely chosen actions, we open up handholds for the imagination. The compatibility of free will and science (deterministic of indeterministic – it makes no difference) is not as inconceivable as it once seemed.”
I agree with this
It’s not an argument. It’s a sermon.
It is indeed a sermon. The argument is in the rest of the book
But I thought it was worth reproducing the sermon, to indicate the nature of Dennett’s moral stance, which is not as is often painted – a reductionist amoral one in which human intention is no more than a shopping list.
Dennett is not a reductionist, quite the reverse. And his book is about morality, not amorality. It astonishes me how often he is characterised as an amoral reductionist. He isn’t and I am not. Yet we are both materialists.
Being a materialist does not stop you “compressing” what happens at the random amoral subatomic level into large scale meaningful units at the human level, any more than the fact that Shakespeare can be “reduced” to binary code means that it has no more meaning than binary code. The meaning emerges from the compression process.
Plato, on his way back:
The Laws, bk x:
___________
>> Ath. Nearly all of [the avant-garde], my friends, seem to be ignorant of the nature and power of the soul [[ = psuche, in effect the self-moved intelligent mind], especially in what relates to her origin: they do not know that she is among the first of things, and before all bodies, and is the chief author of their changes and transpositions. And if this is true, and if the soul is older than the body, must not the things which are of the soul’s kindred be of necessity prior to those which appertain to the body?
Cle[nias]. Certainly.
Ath. Then thought and attention and mind and art and law will be prior to that which is hard and soft and heavy and light; and the great and primitive works and actions will be works of art; they will be the first, and after them will come nature and works of nature, which however is a wrong term for men to apply to them; these will follow, and will be under the government of art and mind.
Cle. But why is the word “nature” wrong?
Ath. Because those who use the term mean to say that nature is the first creative power; but if the soul turn out to be the primeval element, and not fire or air, then in the truest sense and beyond other things the soul may be said to exist by nature; and this would be true if you proved that the soul is older than the body, but not otherwise.
[[ . . . .]
Ath. . . . when one thing changes another, and that another, of such will there be any primary changing element? How can a thing which is moved by another ever be the beginning of change? Impossible. [--> how does one traverse the infinite in succession? Just to start . . . ] But when the self-moved changes other, and that again other, and thus thousands upon tens of thousands of bodies are set in motion, must not the beginning of all this motion be the change of the self-moving principle? [--> notice, the shift to the volitional] . . . . self-motion being the origin of all motions, and the first which arises among things at rest as well as among things in motion, is the eldest and mightiest principle of change, and that which is changed by another and yet moves other is second.
[[ . . . .]
Ath. If we were to see this power existing in any earthy, watery, or fiery substance, simple or compound-how should we describe it?
Cle. You mean to ask whether we should call such a self-moving power life? [--> notice now, embodiment of self-moving power]
Ath. I do.
Cle. Certainly we should.
Ath. And when we see soul in anything, must we not do the same-must we not admit that this is life?
[[ . . . . ]
Cle. You mean to say that the essence which is defined as the self-moved is the same with that which has the name soul? [--> self-moving power is here seen as a reliable sign of soul, and in light of our self-experience of the power of choice, of being the beginning of action. Implicit, is that the alternatives, chance and/or necessity cannot credibly account for what the intelligent, choosing self can; starting with reason and meaningful language]
Ath. Yes; and if this is true, do we still maintain that there is anything wanting in the proof that the soul is the first origin and moving power of all that is, or has become, or will be, and their contraries, when she has been clearly shown to be the source of change and motion in all things?
Cle. Certainly not; the soul as being the source of motion, has been most satisfactorily shown to be the oldest of all things.
Ath. And is not that motion which is produced in another, by reason of another, but never has any self-moving power at all, being in truth the change of an inanimate body, to be reckoned second, or by any lower number which you may prefer?
Cle. Exactly.
Ath. Then we are right, and speak the most perfect and absolute truth, when we say that the soul is prior to the body, and that the body is second and comes afterwards, and is born to obey the soul, which is the ruler?
[[ . . . . ]
Ath. If, my friend, we say that the whole path and movement of heaven, and of all that is therein, is by nature akin to the movement and revolution and calculation of mind, and proceeds by kindred laws, then, as is plain, we must say that the best soul takes care of the world and guides it along the good path. [[Plato here explicitly sets up an inference to design (by a good soul) from the intelligible order of the cosmos.] >>
_____________
And so our choice is plain, reject choice as foundational, to founder in self-referential incoherence. Accept choice, and face the implication that the self-moved chooser is the ultimate root of reality.
It is a measure of the determination of many in our time that they will not have such a Chooser and Initiator to rule over them, that they will for preference CHOOSE instead — oh, the irony — that which faces blatant reductio ad absurdum on the credibility of thought.
Let me snip from the just linked:
The choice, dear friends, is ours.
GEM of TKI
PS: I think “self-moved” needs now to be added to the terms we use on this. Complete, with its implication of a looping; for the whole looping ensemble has to start, with things like us that plainly have a beginning and are thus manifestly contingent. By contrast the ultimate self-moved, has no external causal necessary dependence.
M. Holcumbrink:
Just wait till people force you to use the term libertarian free will.
I agree with you, but the facts are these:
Those who believe that the will exists and is free are and have always been the vast majority of human beings.
Those who do not believe this are constantly in the position of having to explain why people believe in something that doesn’t exist. So they make up various BS to explain what the will is under their system. Then people fight back and use the term “free will” to define exactly what they mean. Then over time the same enlightened few find explanations for why the “free will” exists but isn’t really free, so the people come back with the term “libertarian free will.” There’s no telling where we will go from here. Perhaps “autonomous libertarian free will” is the next step?
Elizabeth Liddle:
Dennett’s sermonizing is irrelevant if it is indeed the case that his argument is as nullasalus says.
Basically, nullasalus has presented an argument which you disagree with.
In response, you post a Dennett sermon and say you agree with Dennett’s sermon.
All well and good. What does that have to do with the original issue raised by nullasalus?
He’s waiting for an argument.
Well, I’m waiting for a context for that quotation.
I’ve read a lot of Dennett’s writings, and his argument doesn’t seem to me to amount to anything much like Nullasalus’s paraphrase:
What is true-ish is that Dennett does talk about “convenient ways of speaking”. Sure he does. But that’s true of anything anyone says – the way we communicate is through language, and that language includes the capacity to denote abstractions like “love” and “justice” and “intention”. These things exist – despite the fact that they cannot be weighed, or reflect light, and the fact that we have words to denote them does not mean they are nothing more than words. Words have referents – we talk about selves, and that word has a referent. The referent is as real as love.
Love is real, right?
I posted Dennett’s “sermon” so that it would be clear that he does not regard these things as mere delusions or conventions, but real things, of real value.
Which seems to me to render Nullasalus’s rendering of his position unlikely to be correct!
Yes, we’re quite familiar with the way biologists find it “convenient” to speak in teleological terms while denying teleology. That’s not news.
You may be familiar with it, Mung, but you don’t seem to understand it!
Obviously when it comes to talking about intentional agents, teleological terms are entirely apposite.
Tragic Mishap @ 24.
Exactly, explained much better than I’d tried (that was my point @ 17).
Hey all, I’ve a brief time to reply, so here are a couple assorted thoughts off the top of my head.
@tgpeeler: I would agree that the attributes you list as necessary to create information are antithetical to naturalism. However, I would go further and say they are antithetical to determinism in general. This is because determinism exactly specifies the next state in a sequence, and there is no new information created. So, whenever information is created there is a break with the past states, whether they subsist in a physical or spiritual medium.
@EL: I agree compression is an important part of making choices. However, the reason this can’t be covered under chance and necessity is that generalized compression is a halting problem. See the last paragraph here:
http://en.wikipedia.org/wiki/M.....imitations
@TG: One point in Aristotle’s favor is that his account of reality is teleological. Free will and teleology go very well together, whereas in a non-teleological world we run into the classical dilemma and have trouble differentiating free will from chance and necessity.
I’ve read a lot of Dennett’s writings, and his argument doesn’t seem to me to amount to anything much like Nullasalus’s paraphrase:
You know, Dennett could not have made himself more clear. I quoted the man expressly from his Intentionality article. He makes it crystal clear that he does not believe in ‘original intentionality’, only ‘derived intentionality’.
Dennett saying outright that artifacts don’t have ‘real meanings’, that the intentionality of a “two-bitser” “in short–is “just metaphor”. And he says further that what separates him from his critics is that we part company when I claim to apply precisely the same morals, the same pragmatic rules of interpretation, to the human case.
Dennett explicitly denies original intentionality. For him, all intentionality is derived, by his own words.
What is true-ish is that Dennett does talk about “convenient ways of speaking”. Sure he does. But that’s true of anything anyone says
No, it’s not. Hence the term “useful fiction”, accent on the ‘fiction’. I gave the context Dennett spoke of explicitly – trying to play that off ‘oh, Dennett just means he’s speaking loosely’ doesn’t fly. He’s staking out his position.
I posted Dennett’s “sermon” so that it would be clear that he does not regard these things as mere delusions or conventions, but real things, of real value.
“Real value”, as defined by Dennett. “Real things”, metaphorically. The fact that you’re trying to counter express quotes from Dennett defining his position with some poetic fluff – a ‘sermon’ – speaks volumes.
You seem to think that if Dennett expressly denies ‘real meaning’ here, but talks all cutesy and endearing there, that clearly the cutesy and endearing part wins. The idea that Dennett is being inconsistent, that he’s obfuscating? Why, that just gets ruled out from the start.
Love is real, right?
Love is real the way a bunch of rocks arranged in a heart shape ‘really is’ love, by Dennett’s reckoning. And you know, Bigfoot is real, so long as we’ve defined Bigfoot as “a delusion experienced by some people”, I suppose. (Wait, but delusions are derived, not intrinsic, so…)
I’m waiting for the part where you suggest this cannot be true, because if Dennett were really denying original intentionality and saying all that exists is derived intentionality, his position would be incoherent or ridiculous. And, of course, Dennett being either of those things is not an option, so that’s ruled out – at least so far as you can quote something vaguely inspiring.
Here’s another one: Jim Jones can’t have been crazy, or even vile. He said nice thing sometimes. And if you quote an inspiring sermon, clearly that means the person in question has to be A-OK.
Nullasalus:
Thanks for the link. What makes you think that Dennett is saying that artifacts don’t have “real meanings”? That a “derived meaning” is not real? In his last paragraph, the one you originally quoted, he says: “There is no more real, or intrinsic, or original intentionality than that.” Dennett is not saying that there is no such thing as a “real” meaning, but that all meaning is “derived”. Which seems to me perfectly true. Meanings are assigned by meaning-makers. They are not intrinsic. And so, if we want to understand meaning (intentionality, aboutness),we need to examine the processes by which we assign meaning.
Again, I’d like a citation for where Dennett talks about a “useful fiction”. I’d like to see the context. I’m sure he’s not speaking loosely – he doesn’t. Philosophers tend not to!
Well, I hope it “speaks volumes” – that’s why I chose what I thought was an important passage – but I would strongly disagree that it is “poetic fluff”. I don’t think Dennett is speaking any more “loosely” here than he does elsewhere! What, it seems to me, Dennett’s core message is (it’s certainly my own position) is that there’s nothing unreal about the values we assign to things – that being able to account for phenomena at a physical level in terms of quarks and leptons does not mean that the phenomena themselves are “reduced” to quarks and leptons. I find it frustrating – and I’m sure Dennett does – that despite the fact that his entire argument is pointing out that big valuable things like morality, goodness, generosity, selves, intentions, intentionality, love are no less real and valuable just because we can account for them at a physical level. We may well be able to account for them, but we cannot comprehend them or evaluate them except at the high level – the level at which they have their reality – people insist on interpreting him as saying that nothing is real except quarks and leptons!
Because he is being entirely consistent. He’s not denying “real meaning”. The essay you cite does no such thing. You are simply extrapolating from his case that all meaning is derived that no meaning is real. He isn’t. He’s saying that derived meaning is real meaning. In other words, like most Dennett opponents you are inverting his entire argument! Which is to miss it entirely.
No. And this is precisely why I know that you have Dennett completely wrong.
Well, I was naively assuming that you would assume that you must have misread him, rather than he was being inconsistent. However, now that I know that you regard him as inconsistent, and only saying what he really means when he says that there is no such thing as real meaning(even though he doesn’t say that!), I’ll try a different approach!
No. I’ve got to go to work now, but I’ll try to explain to you what I think Dennett is saying when I get back.
I do recommend reading Freedom Evolves, though. I think it’s his best book, and I think it makes his position absolutely clear. And it isn’t what you think it is
NR @ 18 “No. A baby is able to use information about the world, before acquiring language.”
A baby is able to use sense experience “information” about the world before acquiring language but I don’t see how this contradicts anything I said.
“Language existed in spoken form, before there was any alphabet. New words are being coined, so there is no fixed set of words. The “rules” seem to change over time, so maybe there aren’t really rules.”
I agree that all “alphabets” weren’t written down in a purely oral language but I don’t see this as a problem. Who said the symbols had to be written down? I just used English as an example because I thought the readers here would be familiar with it, including nuances. Plus, it’s the only language I can really think in. As far as the rules changing over time. You’ve made my point. Thank you very much. The rules are ARBITRARY and in NO WAY are explained by reference to physical law. Thanks for pointing that out. I may also point out that saying that rules change is hardly the same thing as saying that there aren’t any.
“In a usenet post from 2000, linguist Jaques Guy wrote: “The ultimate secret of language is this: language is absurd, illogical. If it were not, it would not work.” I’m inclined to think he was right.”
How could he possibly be right? This guy is a linguist? And he doesn’t recognize that all languages are made possible by the laws of identity and non-contradiction? This is self-refuting. It is nonsense of the highest order. My words to you are absurd and illogical but pay attention to them anyway. Yeah, right. The bar must be pretty low for linguist school…
“It is very likely that dogs, cat, ants are all using information. Yet we normally don’t credit them with having free will.”
A point of agreement. Admittedly irrelevant agreement but agreement none the less. Some animals certainly communicate. Some do it with chemical “scents” and some do it with “clicks” or “dance steps.” In all cases, the dance steps, for instance, performed by the orinating honey bee represent something else which the receiver honey bee understands so he knows to fly to where the food is. I explicitly ignored animal communication for this very reason. Nevertheless, my argument still stands. The existence (and prerequisites) of information show that naturalism is false.
p.s. Thanks for dealing with something I actually said. I appreciate that. Even if I don’t think you made a dent in the argument at least you addressed part of it.
tgpeeler:
Could you summarise that argument? I’m not seeing it.
If naturalism were true, then everything and every phenomena in the existing, that is, natural world, could ultimately be explained by the laws of physics. (This is true by definition. This is what naturalism means.)
But the laws of physics cannot explain information or its prerequisites. (The laws of physics, and whatever they might look like in the future (TOE, for example) ‘control’ or ‘manipulate’, as it were, sub-atomic particles in energy fields. They have nothing to say about the manipulation, or arrangement of symbols, according to arbitrary rules, to encode and decode information.)
Therefore, naturalism is false.
This is the modus tollens form of argument and in this case (since the antecedent and consequent are necessarily linked) is a valid form. This means that in order for you, or anyone else, to defeat it (please give it your best effort) you must attack one of the premises.
Your tasks are two. 1. Argue that ontological naturalism (ON) possesses other explanatory resources apart from the laws of physics. It seems to me that this will be difficult to do since this is one of the fundamental intellectual commitments of ON. Nothing violates the causal closure of nature. Or 2. Argue that physics can indeed account for the existence of information by explaining the laws of reason, the local rules of language, free will (or choice), and purposefulness or intentionality.
Since it is logically impossible for laws that govern the behavior of sub-atomic particles in energy fields to govern the behavior of immaterial symbols, physics cannot possibly be the answer for what it is that accounts for this ability to purposefully and freely manipulate symbols in accordance with the general rules of logic and the specific rules of language to generate information.
The “funny” thing to me is that ON denies the existence of an immaterial mind (the entity that I will argue is what freely and purposefully manipulates symbols). Essentially, when someone asserts ON, they deny the existence of their mind. Hmmmm. I’ll pass on the cheap shot just this once.
I eagerly await your response.
tgpeeler: thanks for this!
Probably. I think I’d substitute “explainable” for explained, but that’s OK I think
No, I don’t think so. Lack of an explanation does not mean that no explanation is possible. It just means that we don’t have one. Absence of evidence is not evidence of absence, and absence of known explanation is not evidence of absence of unknown explanation!
Indeed, the Second Law of Thermodynamics, tells us that information is constantly decreasing (entropy increasing). Things become “historically inert” – we cannot explain everything because there is an “inverse problem” – while only one scenario produced our data, more than one scenario could have produced it. We cannot run causality backwards – one way of defining time is as the direction of causality.
I dispute your second premise for the reasons given
To summarise: inability to explain everything is not evidence that anything could not have been explained in the past or will not be explained in the future. Therefore we cannot conclude that anything is unexplainable, only that it is unexplained.
Therefore naturalism may be true.
(But, equally, may be false
)
Your serve
EL “No, I don’t think so. Lack of an explanation does not mean that no explanation is possible. It just means that we don’t have one. Absence of evidence is not evidence of absence, and absence of known explanation is not evidence of absence of unknown explanation!”
I’m sorry but this is true. It’s not a matter of absence of evidence it’s the denial of the consequent, or the modus tollens form of argument. It goes like this: IF P is true, then Q is true. But Q is not true. Therefore P is not true.
Let me take a simpler argument to ilustrate.
If Felix is a cat then Felix is a mammal. (IF P, then Q.) Being a cat, part of “catness” is being a mammal. Law of identity.
But Felix is not a mammal (in this case). Therefore, Felix is not a cat. It’s not possible for Felix to be a cat if he’s not also a mammal.
In the same way, it’s not possible for naturalism to be true if it can’t explain everything and it can’t explain information and its prerequisites in my argument. This is really the only place you have to attack but you are faced with a logically impossible task.
Do you see this?
I don’t really know what else to say. Modus tollens is valid just like a categorical syllogism can be valid.
If men are mortal.
And Socrates is a man.
Then Socrates is mortal.
You can’t attack that argument by going around it or ignoring it. You waved in the direction of thermodynamics as if somehow that explains (???) how information could arise by physical law.
You do agree that the laws of physics govern the behavior of sub-atomic particles in energy fields?
You do see that the creation of information requires the manipulation of symbols which are non-physical things (although they have physical expression, letters and such), don’t you? So how can the laws of physics describe the manipulation of symbols (immaterial things) in accordance with two sets of rules to generate information?
I’m at a loss to proceed here unless you get more specific in your attack of my defense of my consequent.
tgpeeler, you might like this video on Modus tollens;
Modus Tollens – It Is Impossible For Evolution To Be True – T.G. Peeler – video
http://www.metacafe.com/w/5047482/
=================
As to ‘honesty’, one day every ‘careless word’ shall be taken account of for every single one of us;
Trust in Jesus – Third Day – music
http://www.youtube.com/watch?v=6koz1p2Q6Bw
All the evidence is not yet in.
All men may not be mortal.
And I’ve heard that there may perhaps be a possibility that we will one day have evidence that Socrates was in fact a woman.
So I cannot accept either premise.
Elizabeth Liddle:
Elizabeth, elsewhere you claimed that a maximally random configuration contains the most information.
Why are you now contradicting yourself? Or have you changed your mind?
“So I cannot accept either premise.”
Well, sure. But, to reject the particular premises of an argument is not the same as to reject (or falsify) the form of the argument.
No, Mung. I didn’t claim that a “maximally random configuration contains the most information” anyway – I just said that that was true of Shannon information – white noise is pretty well incompressible, and uncertainty is maximised.
So Shannon Entropy is a measure of information content.
However, in thermodynamic terms,the opposite is true
http://en.wikipedia.org/wiki/E.....ion_theory
“In essence, the most general interpretation of entropy is as a measure of our uncertainty about a system. The equilibrium state of a system maximizes the entropy because we have lost all information about the initial conditions except for the conserved variables; maximizing the entropy maximizes our ignorance about the details of the system”
It’s not as contradictory as it sounds, of course, and the second sense is closer to the sense in which we normally think of “information” (telling us something we want to know). Shannon Entropy just tells us how much we don’t know!
Ilion:
Well, I don’t reject the form of the argument.
tgpeeler:
Yes, I understand the form of your argument, that is fine. What I dispute is your premises.
Your first is:
I don’t accept that this is “what naturalism means”. For a start, “could ultimately be explained” is unclear – by whom? When? Clearly the world is full of things that cannot be explained because the trail is cold – the traces are degraded. That does not falsify naturalism. It just means that at any given time we do not, and cannot, possess enough data to explain every phenomenon.
In other words, your definition does not define naturalism – or, if that is your definition of naturalism then it is self-evidently false.
I agree.
But where are we? We have agreed that a definition of naturalism that no naturalist every claims to be his/her position is false. It’s a straw man.
Then your second premise is:
They may not. But clearly we cannot rule it out in the future – or, if you assume we can, you are assuming your consequent!
I just don’t think the argument works, tgpeeler.
If you really want an argument against naturalism, I think you are better of with the old chestnut: “why is there something rather than nothing”? Some cosmologists think there is an answer to that – because nothing is an intrinsically unstable state, or something, but it seems to me that only pushes the question back one stage further: why is nothing an intrinsically unstable state?
So given that naturalists can’t give a very good answer to that question, then you could legitimately, I suggest, infer that naturalism is false.
The problem with it, as I see it, though, is that if we assign some entity denoted by theta (I usually use theta because it starts with a th, and is sort of cool
) – where do we go from there? We could take Aquinas’s route and start to make lists of what theta cannot be.
But the problem it seems to me is that even if we get a fairly impressive list of leftovers, we can’t eliminate “amoral”. So why should we think that theta is coterminous with a Good God?
I believe in something I call God, who is good. Goodness, in fact. For which I have evidence (I can give you lots of examples of goodness). But I have no reason to believe that that Goodness is theta.
Do you see this?
What makes you think that Dennett is saying that artifacts don’t have “real meanings”? That a “derived meaning” is not real?
This is on the level of asking me how I can suggest that person X is denying the existence of Bigfoot, because said person considers Bigfoot to be a delusion, but they affirm that delusions exist, therefore the person is not a Bigfoot skeptic. They think Bigfoot really exists! Just follow the redefinition!
Sorry, but it doesn’t work. And it can’t work, because ‘derived meaning’ is itself derived as well for Dennett. You aren’t “really” deriving meaning – that’s just yet more metaphor, yet another derivation, a convenient way of talking.
It’s incoherent.
Which seems to me perfectly true. Meanings are assigned by meaning-makers.
There are no ‘meaning makers’ other than what we metaphorically call ‘meaning makers’. And we don’t metaphorically call anything ‘meaning makers’ except by another ‘meaning maker’. Delicious, vicious circularity.
Again, I’d like a citation for where Dennett talks about a “useful fiction”. I’d like to see the context. I’m sure he’s not speaking loosely – he doesn’t. Philosophers tend not to!
How about reading the article linked, wherein Dennett talks about there being no intrinsic intentionality, labels our assignments of meaning as metaphor, etc? But that would require you owing up to what Dennett is saying, rather than squirming and trying to obfuscate.
Well, I hope it “speaks volumes” – that’s why I chose what I thought was an important passage – but I would strongly disagree that it is “poetic fluff”.
Of course you would. Because calling it poetic fluff doesn’t give you the warm fuzzies.
Yes, I know that Dennett spun a cute little sermon that you find inspiring. But you have to understand what Dennett is saying – really, the only thing he could be saying – by looking at his writings on philosophy of mind. He does not ‘account for love physically’. He eliminates it. It is a metaphor, it is a derivation, an assignment, a mere way of speaking. But we only make metaphors, we only derive, we only assign by means of yet other metaphors, derivations, and assignments.
Love is nothing more than a convention under Dennett’s views, Liz. Let it go. Or don’t. Why be consistent or coherent? It’s not possible under Dennett’s view. And it doesn’t give those warm fuzzies.
You are simply extrapolating from his case that all meaning is derived that no meaning is real. He isn’t. He’s saying that derived meaning is real meaning. In other words, like most Dennett opponents you are inverting his entire argument! Which is to miss it entirely.
And like most Dennett defenders, you’re obfuscating or just being inane. The fact that Dennett calls derived meaning ‘real meaning’ does not disarm the logical result of his position: If all meaning is derived, then there is no fact of the matter whether this word, or this thought, or this brain process, ‘really means’ one thing or another. “What does it really mean?” is a question with no answer, and one Dennett essentially owes up to. There’s not even a fact of the matter about whether or not you’re deriving any meaning.
Say it with me now, Liz: “All meaning is derived, and there’s no fact of the matter what anything truly means. And there’s no fact of the matter that anyone is deriving, or what meaning they are deriving.” Best of all: This also applies to Dennett’s arguments. There’s no fact of the matter what his article is about – Dennett’s article only ‘means’ what we derive from it, and there’s no ‘actual meaning’ for us to check it against.
No. And this is precisely why I know that you have Dennett completely wrong.
Dennett’s position collapses into elimination, and into incoherency. You’re dead wrong on this, and are too wound up trying to squeak out platitudes about love to notice what ‘real meaning’ means for Dennett. if that’s at all possible, because again, for Dennett there is no ‘real meaning’.
You’re fumbling badly on reasoning here – no surprise. But don’t feel bad – Dennett’s a full-blown philosophy professor and he’s still advancing an idiotic and incoherent philosophy of mind.
However, now that I know that you regard him as inconsistent, and only saying what he really means when he says that there is no such thing as real meaning(even though he doesn’t say that!),
Yes, he does. Dennett’s argument is incoherent, and he obfuscates when called on it. There is no fact of the matter what anyone ‘really means’ on Dennett’s scheme, including Dennett himself.
I do recommend reading Freedom Evolves, though. I think it’s his best book, and I think it makes his position absolutely clear.
I’ve read Dennett’s writings. His ideas are a joke. You’re incapable of seriously engaging with them – it’s clear that you either don’t understand what he wrote in the article I linked, much less the book, or you do understand and are trying to save it or miss his point by word games.
In fact, answer me these two questions while being consistent with Dennett’s claims:
1) There is a piece of paper with the words “Eggs, milk, cheese” written on it. Person X thinks the list is a shopping list. Person Y thinks the list is ingredients in a recipe. Person Z thinks it’s just a crappy poem.
Is there a fact of the matter that determines what this list is, irrespective of what anyone labels it? Is it a fact of that matter that there’s even a list on the paper?
2) EL’s brain undergoes brain process 1. Person X thinks this brain process is about love. Person Y thinks this brain process is about hate. Person Z thinks this brain process isn’t about anything.
Is there a fact of the matter that determines what the brain process is about irrespective of what anyone labels it? Is there “a fact of the matter about what a person (or a person’s mental state) really means”?
tragic mishap,
Panpsychism. Idealism. Neutral monism. And others besides. You’re not going to understand any of them though, so I can’t suggest reading up on any of them. If I find a pop-up book that discusses any of them, though, I’ll let you know.
I believe in something I call God, who is good. Goodness, in fact. For which I have evidence (I can give you lots of examples of goodness).
And of course, here’s the point of order: There is no fact of the matter that you believe in anything on your metaphysics. And the only ‘good’ and ‘goodness’ you could believe in given your metaphysics is derived – aka, “that which you personally call good and goodness”. Which, amusingly enough, would also be your evidence. (See, I call this good. Goodness is what I derive it to be. What I derive to be goodness is evidence for goodness. I derive my derivations of goodness to be God. I have evidence for God, because my derivations of my derivations of goodness are evidence now.)
This is a stellar example of the poetic little platitude that sounds nice and endearing – gosh, don’t you just want to put this on a poster with a sleeping kitten? – that really breaks into pieces and turns into something else once you actually examine it.
EL @ 34: “Could you summarise that argument? I’m not seeing it.”
TGPeeler @ 35: “If naturalism were true, then everything and every phenomena in the existing [world must, in principle,] ultimately be explain[able] by the laws of physics. (This is true by definition. This is what naturalism means.) … But the laws of physics cannot explain information or its prerequisites. …Therefore, naturalism is false. …”
EL @ 36 frantically waving her hands: “No, I don’t think so. Lack of an explanation does not mean that no explanation is possible. It just means that we don’t have one. Absence of evidence is not evidence of absence, and absence of known explanation is not evidence of absence of unknown explanation!”
This is how these people “think” and “reason” … they don’t!
Mr Peeler has presented an irrefutable argument which shows that naturalism is false. Naturalism *just is* the (cough!) philosophy that *everything* is, in principle, wholly explicable, without remainder, in terms of physics. Mr Peeler has show that there is at least one thing which naturalism not only has not explained, but cannot explain … and that, therefore, naturalism is false and seen to be false.
And EL “refutes” the argument by waving her dainty little hands and declaring “Nuh-uh!”
‘Atheism’ seems to be a mental disturbance or disability which renders those afflicted by it incapable of consistently engaging in sound reasoning.
No more than your God does, I suggest, nullasalus
There is no objective way of deciding who the True God is. At least mine is derived from logic (what is most likely to benefit everyone), and so has some measure of objectivity (many people can agree it makes sense). That’s probably whey the Golden Rule crops up in various versions in so many cultures.
Yes, I make no bones about defining it as “good”. I’ll call it “bleh” if you prefer. Rather that, though, than try to figure out which set of “scriptures” and which precepts in which “scriptures” are the authoritative ones – and does the stuff about shrimp really matter?
Goodness is easy to recognise. Jesus himself thought it was so obvious he didn’t have to spell it out – if a donkey is in the well, just get it out! Doesn’t matter if it’s the Sabbath! By your fruits you shall know them! Would a father give his son a snake when he asked for fish?
I agree with Jesus. Goodness is obvious. Give people what they need – love your neighbour as you love yourself – if you want to love me, then visit the prisoners and heal the sick, because whatever you do for my brothers you do for me.
See, I’m quite a good Christian really!
I just don’t require that my God demonstrate that s/he created the universe! I don’t care if s/he didn’t. What I care about is that s/he is Good.
EL: “Well, I don’t reject the form of the argument.”
Certainly you do; we;ve just seen you do so.
Do you really think I am so stupid that you can get away with the howler? Or, do you think I’m so “nice” that I’ll let it pass? I an, in fact, neither.
Ilion:
First, my hands aren’t dainty.
Second, tgpeeler’s syllogism is only as good as his premises.
Third, if we define naturalism as per his premise, sure, it is false.
But it bears no relation to anything anyone who claims to be a naturalist calls naturalism. So what is its point? Sure, we can’t explain everything.
Does that make me a non-naturalist? Does it not, rather, simply make me a naturalist with only partial knowledge of what causes what?
Nullasalus: I haven’t had time to make good my promise to try to explain what I think Dennett is saying, so we will have to leave it I think.
The essay you linked to, though, I think is relevant to the qualia question – the “aboutness” of things that people cite as evidence that consciousness is a Hard Problem.
I agree with Dennett that it is not. I think what he is saying in that essay is that “intentionality” or “aboutness” is always derived – that there is no “raw feel” as some people describe qualia. And therefore no mysterious threshold between the crudeness of the two bitser and the complexity of a human brain, although there may be a vast evolutionary distance.
That’s my position, so maybe later we can drop Dennett and you can challenge me directly! But I do recommend “Freedom Evolves”, not to persuade you, but as the book that I think best summarises his argument about mind and brain – and moral responsibility.
Ilion:
No, I don’t think you are terribly nice, Ilion! In fact you seem rather nasty in some ways
But that’s OK. I don’t mind.
Nor do I think you are stupid. But I do think your assumption that people who disagree with you are either dishonest or stupid blinds you to the possibility that they may have a valid point.
I have no problem with modus tollens form of argument. But no matter what the form of the argument, if your premise is false, or trivial, you will end up with a false, or trivial, conclusion.
I think tgpeeler’s premise is trivial – it defines naturalism in a way that does not represent anything anyone would actually try to defend.
Alternatively, it is a false definition of naturalism (depending on how you want to look at it).
So: either it’s a straw man, or it’s wrong. Naturalism is usually taken to be the view that things within the universe have causes within the universe. That can be true whether or not we are able to find out what those causes are. And clearly we cannot find out the cause of every event in the universe – we run up against the inverse problem, as I said: there is a many-to-one mapping between data and causes.
The essay you linked to, though, I think is relevant to the qualia question – the “aboutness” of things that people cite as evidence that consciousness is a Hard Problem.
Holy crap.
No, it’s not. He doesn’t mention qualia once in the document. He makes no reference to the hard problem. He doesn’t even use the word consciousness. He’s talking about ‘aboutness’, ‘intentionality’. Holy hell, the article is titled “intentionality”. Do you think that’s just another word for qualia for Dennett?
Thanks for verifying that you don’t even grasp what Dennett is arguing in a relatively simple and straightforward article.
Nullsalus:
(just thought I’d respond to this)
<blockquote
I’ve read Dennett’s writings. His ideas are a joke. You’re incapable of seriously engaging with them – it’s clear that you either don’t understand what he wrote in the article I linked, much less the book, or you do understand and are trying to save it or miss his point by word games.
Well, if all that is “clear” to you, I suggest you aren’t seeing straight. I’ll say to you what I said to Ilion – don’t assume that those who disagree with you are either stupid or dishonest. I am neither. It’s possible of course that I have either misunderstood Dennett, or failed to see the flaw in his position. But I don’t believe either is the case.
Yes, and yes (although I’m not sure what a “fact of the matter” is – but yes it is a fact that the list is something (it has a history, and that history, if we can find it out, will tell us what it is “really about”). And yes it is a fact that the paper exists (obviously within the fiction you have described!)
I find this question odd. People can independently observe a shopping list; they cannot independently observe “a brain state”. Even the owner of the brain cannot observe her own brain state. She can, however, control her own thought. No-one else can. We have privileged access to our own thoughts. However, if EL says that she is thinking about love, unless she is a known liar (which she is not) then we can say that it is a fact that EL is thinking about love. If Nullasalus offers the opinion that EL is not thinking about love, then, tough. He doesn’t, and can’t, know, because he doesn’t have access to EL’s thought.
However, in both your shopping list, and your brain example, I’d agree with what I think Dennett is saying, which is that the paper list is “really about” what the writer of the list thought it was about – in other words the use to which the writer put it, and that the thought in EL’s head was “really about” what EL thought it was about, which is the use to which she put her brain. In other words, both the list and the brain state derive their intentionality from the use to which they are put by the author of the action – wielder of pen or wielder of neurons.
EL @ 45 “But where are we? We have agreed that a definition of naturalism that no naturalist every claims to be his/her position is false. It’s a straw man.”
OK. I had hoped to avoid this. But here we go.
“The view, sometimes considered scientific (but an assumption rather than an argued theory) that all that there is, is spatiotemporal (a part of “nature”) and is only knowable through the methods of the sciences, is itself a metaphysics, namely metaphysical naturalism (not to be confused with natural philosophy).”
Cambridge Dictionary of Philosophy, Second Edition, page 563.
Do I need to break this down or can you grasp the implications of the definition?
“the twofold view that (1) everything is composed of natural entities – those studied in the sciences (on some versions, the natural sciences) – whose properties determine all the properties of things, persons included (abstracta like possibilia and mathematical objects, if they exist, being constructed of such abstract entities as the sciences allow); and (2) acceptable methods of justification and explanation are contiguous, in some sense, with those in science.”
The Cambridge Dictionary of Philosophy, Second Edition, page 596.
“An atheist in this sense of philosophical naturalist is somebody who believes there is nothing beyond the natural, physical world, no supernatural creative intelligence lurking behind the observable universe, no soul that outlasts the body and miracles – except in the sense of natural phenomena that we don’t yet understand.” The God Delusion, page 14.
I quote Dawkins, not for the definition of naturalism, but so you can see how it translates into popular fiction.
Materialism is the naturalistic metaphysics that regards nature as consisting of matter in motion. Whatever is apparently not matter in motion is to be regarded as “mere appearances” of what is matter in motion. All explanation, therefore, in philosophy as well as in science, is to be phrased in terms of the laws now known or yet to be discovered concerning the relationships among the different kinds of matter and the laws of their motion with respect to each other. (In other words, the laws of physics.)
Philosophic Inquiry, page 338.
Although this is the definition of materialism please note that it is naturalistic metaphysics.
“Materialists deny that the world includes both mental and material substances. Every substance is a material substance. Minds are fashioned somehow from the same elementary components from which rocks, trees, and stars are made.” Philosophy of Mind, page 51.
“Nowadays, materialism of one stripe or another is more often than not taken for granted: in David Lewis’s words, materialism is nonnegotiable.” Philosophy of Mind, page 51.
“The story may be apocryphal, but the answer is the only one that a consistent materialist could have given; everything is to be explained in terms of what occurs in nature, according to the laws of physics.” Philosophic Inquiry, page 392.
On Physicalism “in the widest sense of the term, materialism applied to the question of the nature of mind. So construed, physicalism is the thesis – call it ontological physicalism – that whatever exists or occurs is ultimately constituted out of physical entities. But sometimes ‘physicalism’ is used to refer to the thesis that whatever exists or occurs can be completely described in the vocabulary of physics.”
The Cambridge Dictionary of Philosophy, Second Edition. p. 706.
“One way of stating the principle of physical causal closure is this: If you pick any physical event and trace out its causal ancestry or posterity, that will never take you outside the physical domain. That is, no causal chain will ever cross the boundary between the physical and the nonphysical.” Mind in a Physical World, page 40.
“So all roads branching out of physicalism may in the end seem to converge at the same point, the irreality of the mental. This should come as no surprise: we should remember that physicalism, as an overarching metaphysical doctrine about all of reality, exacts a steep price.” Mind in a Physical World, page 119.
Here are some comments on naturalism from the Stanford Encyclopedia of Philosophy:
“Contemporary philosophy’s three main naturalisms are methodological, ontological and epistemological. Methodological naturalism states that the only authoritative standards are those of science. Ontological and epistemological naturalism respectively state that all entities and all valid methods of inquiry are in some sense natural.”
“Arguments for naturalism are lacking in the literature. Most naturalists simply posit their naturalism and work downstream from it, hoping that its consequences will prove attractive to the susceptible (Maddy 2007, 3). Naturalism thus effectively becomes a personal credo with little direct attempt to bring anyone else on board: I accept only X-standards in some domain because I find them more credible than others. Now perhaps at the end of the day one cannot do better. But we shouldn’t assume that at the outset.”
“By the middle of the twentieth century, the acceptance of the casual closure of the physical realm led to even stronger naturalist views. The causal closure thesis implies that any mental and biological causes must themselves be physically constituted, if they are to produce physical effects. It thus gives rise to a particularly strong form of ontological naturalism, namely the physicalist doctrine that any state that has physical effects must itself be physical.
From the 1950s onwards, philosophers began to formulate arguments for ontological physicalism. Some of these arguments appealed explicitly to the causal closure of the physical realm (Feigl 1958, Oppenheim and Putnam 1958). In other cases, the reliance on causal closure lay below the surface. However, it is not hard to see that even in these latter cases the causal closure thesis played a crucial role.”
Causal closure. Get it? Everything explained in terms of physical laws.
Now I don’t know what planet you are from, but where I live, if you can’t deduce from reading these definitions that EVERYTHING must be explainable in terms of the laws of physics then your reading skills are not up to par and I will not be engaging with you any longer on this subject. My description of the basic intellectual commitments of naturalism is fair.
EL @ 45 more… “They may not. But clearly we cannot rule it out in the future – or, if you assume we can, you are assuming your consequent!”
Clearly you don’t understand a word of what I’ve written. We can rule it out just like we can rule out the idea of a square being a circle. Physics is about the material world. Information is about the immaterial world. It’s not logically possible for the laws of physics to manipulate abstract symbols. Not now. Not ever. To say that it “might happen” sometime in the future is about the lamest comment I have ever seen out here and I’ve seen a few.
Well, if all that is “clear” to you, I suggest you aren’t seeing straight. I’ll say to you what I said to Ilion – don’t assume that those who disagree with you are either stupid or dishonest. I am neither. It’s possible of course that I have either misunderstood Dennett, or failed to see the flaw in his position. But I don’t believe either is the case.
I have to call what I see, and what I see is someone who can’t even properly grok a pretty straightforward article by Dennett and who seems to not even understand the more fundamental positions the man is taking, despite talking him up repeatedly as the man with the answer to philosophy of mind questions. Really, when you think his intentionality article is about qualia, that moment you refer to as “when the penny dropped” starts to look more an more look like “that time when your mind went all Phineas Gage on you”.
I’m not making an assumption that you’re either deluded or dishonest. I’m making an increasingly supported inference based on the revealed facts here. You say you don’t believe this – great. That’s not exactly compelling evidence here.
Yes, and yes (although I’m not sure what a “fact of the matter” is – but yes it is a fact that the list is something (it has a history, and that history, if we can find it out, will tell us what it is “really about”).
Congratulations – if you believe that there is a fact of the matter what the list is about irrespective of what anyone labels it, you’re in fundamental disagreement with Dennett. In fact you’re rather off on your own philosophically, since everyone from substance dualists to materialists would regard an artifact like that as having no meaning when divorced from a mind.
I await your insistence that this is all a big misunderstanding.
She can, however, control her own thought. No-one else can. We have privileged access to our own thoughts.
Really? So there’s an ‘inner life’, subjectively, completely walled off – even in principle – from third party investigation, and what we are thinking about is definite, not a matter of interpretation?
Congratulations again: You’re in opposition to Dennett. In fact, at least from this tiny declaration, you’re closer to Searle than anyone else. That’s good! Searle’s less insane than most. It comes with people openly questioning the main’s claim to be a physicalist.
You’re tripping up on this point: You say that you ” agree with what I think Dennett is saying, which is that the paper list is “really about” what the writer of the list thought it was about”. But you’re missing this important move: What the writer of the list “thought it was about” is itself a matter of interpretation, and the writer’s thoughts don’t decide the ‘fact of the matter’ of the list, because there is no ‘fact of the matter’ about the writer’s thoughts. Likewise, Dennett wouldn’t even pin the meaning of the list to the ‘original writer’ – have anyone pick up the list and derive or assign meaning, and it’s still valid. That’s the thing about derived meaning.
Don’t believe me? Dennett again:
Suppose some human being, Jones, looks out the window and thereupon goes into the state of thinking he sees a horse (cf. Fodor 1987). There may or may not be a horse out there for him to see, but the fact that he is in the mental state of thinking he sees a horse is not just a matter of interpretation (these others say). Suppose the planet Twin-Earth were just like Earth, save for having schmorses where we have horses. (Schmorses look for all the world like horses, and are well-nigh indistinguishable from horses by all but trained biologists with special apparatus, but they aren’t horses, any more than dolphins are fish.) If we whisk Jones off to Twin-Earth, land of the the schmorses, and confront him in the relevant way with a schmorse, then either he really is, still, provoked into the state of believing he sees a horse (a mistaken, non-veridical belief) or he is provoked by that schmorse into believing, for the first time (and veridically), that he is seeing a schmorse. (For the sake of the example, let us suppose that Twin-Earthians call schmorses horses (chevaux, Pferde, etc.) so that what Jones or a native Twin- Earthian says to himself–or others–counts for nothing.) However hard it may be to determine exactly which state he is in, he is really in one or the other (or perhaps he really is in neither, so violently have we assaulted his cognitive system). Anyone who finds this intuition irresistible believes in original intentionality, and has some distinguished company: Fodor, Searle, Dretske, Burge, and Kripke, but also Chisholm 1956, 1957, Nagel 1979, 1986 and Popper and Eccles 1977). Anyone who finds this intuition dubious if not downright dismissible can join me, the Churchlands, Davidson, Haugeland, Millikan, Rorty, Stalnaker, and our distinguished predecessors, Quine and Sellars, in the other corner (along with Douglas Hofstadter, Marvin Minsky and almost everyone else in AI).
Please notice what Dennett is arguing here: He’s pointing out that there are a number of philosophers (Fodor, Searle, Dretske, Burge, Kripke, etc) who believe there is a fact of the matter what a person is thinking that is not the result of third-party interpretation, or a derived meaning. Dennett is expressly disagreeing with these philosophers. Again: A mind has meaning the way a map has meaning, by Dennett’s view – it is derived by a third party. And even this derivation is only a derivation. And a derivation being a derivation is a derivation and…
Take your pick: Original intentionality, or Dennett. Because you can’t have both. Is there an indisputable fact of the matter about what you’re thinking about right now? A meaning that is not merely derived or assigned? (I again repeated, even the deriving and assigning would itself have to be derived and/or assigned under Dennett’s view, and on and on.) Then you’re siding against Dennett.
And before you whip out another vague sermon, I’ll say again: He spells this out in numerous places, but it’s right there in his Intentionality paper. If he talks about “love” elsewhere, this is the lens the word is viewed through.
EL @ 51 “But it bears no relation to anything anyone who claims to be a naturalist calls naturalism. So what is its point? Sure, we can’t explain everything.”
Of course we can’t explain everything. That’s not the problem. The claim of naturalism is that IN PRINCIPLE, all explanation will ultimately be found in the laws of physics. Physics is not complete now and may never be. Doesn’t matter. Just because naturalism can’t explain everything is not what makes it false. What makes it false is that it cannot, in principle, ever, ever, explain information. Read the definitions I just posted. Do you just make stuff up as you go along?
p.s. Ilion, thanks for your comments. I’m about EL’d out here. I’ll check back in tomorrow morning while I watch some early coverage of the British Open.
EL @ 53 “So: either it’s a straw man, or it’s wrong. Naturalism is usually taken to be the view that things within the universe have causes within the universe. That can be true whether or not we are able to find out what those causes are. And clearly we cannot find out the cause of every event in the universe – we run up against the inverse problem, as I said: there is a many-to-one mapping between data and causes.”
I’m getting close to the end. I can see the finish line…
“things within the universe have causes within the universe”
So this is how “you” define naturalism. I guess all those philosophy encyclopedias, books, and dictionaries I cited have it all wrong.
If you would stop and reflect on what I am saying for just a few minutes instead of looking at the first sentence or two and then composing your reply you might actually understand my argument, at least. I just occurs to me that you couldn’t agree with it if you wanted to. You still don’t understand it. You just don’t understand it. Wow.
“Anyone who finds this intuition irresistible believes in original intentionality, and has some distinguished company: Fodor, Searle, Dretske, Burge, and Kripke, but also Chisholm 1956, 1957, Nagel 1979, 1986 and Popper and Eccles 1977, Elizabeth Liddle 2011). Anyone who finds this intuition dubious if not downright dismissible can join me, the Churchlands, Davidson, Haugeland, Millikan, Rorty, Stalnaker, and our distinguished predecessors, Quine and Sellars, in the other corner (along with Douglas Hofstadter, Marvin Minsky and almost everyone else in AI).”
nullasalus @ 58
First, I’d like to agree with you about Dennett. He’s philosophy’s version of biology’s Dawkins. They are of a piece. They are incoherent, irrational, and also obnoxious but that’s neither here nor there.
Second, I think you hit the nail on the head about EL. She just doesn’t understand what she’s talking about. It’s pretty clear to me now that she really just doesn’t understand. That’s why her replies are evasive, irrelevant, repetitive, and irrational. I could come up with more adjectives but what’s the point. She really just doesn’t understand. I know I’m repeating myself but it’s with a sort of wonder. I should have seen this sooner.
“I’m about EL’d out here.”
Gee… and I thought I was the only one who had become Liddled out.
Nullasalus:
Actually, yes!
But I didn’t say consciousness was what the article was about. I said it was relevant to it.
“Intentionality” is a key concept in the argument about the Hard Problem, which, in turn, is about mind-body duality.
And “aboutness” is one of the (many) definitions of “qualia”.
Nullasalus, I might equally conclude that you don’t know what the article is about!
Look, the reason Dennett came up in this conversation was because I cited him, early on as saying that
This seemed relevant to the OP, and I still think it is relevant to the OP. The OP makes a different point, but I think its relationship to Dennett’s point is interesting, as both take the view that free will can be understood at a level of analysis that is “compressed”.
You then quoted from Dennett’s intentionality article, which I think is only tangentially relevant to the point on which I cited Dennett, summed up his position as:
I think this is a quite wrong understanding of what Dennett is saying. For a start, why would Dennett talk about a “self-forming act” if he denied that selves existed? Well, you could, I suppose, conclude (as you did, unexpectedly to me) that this just means that Dennett is inconsistent and incoherent. The other possibility is that he is perfectly consistent but that you have misunderstood what he is saying about intentionality.
Obviously I think the latter is the case.
But which ever of us is correct, it seems odd for you to assume that I have misunderstood Dennett. You might equally charge that Dennett has misunderstood himself! I don’t think what he says in the intentionality article contradicts his “self-forming act” concept at all. Clearly you must, as you thought his intentionality article revealed the view that selves do not exist.
So either both I and Dennett have misunderstood Dennett, or, possibly, you have!
So I don’t think I have verified that I don’t understand what Dennett is talking about. At worst, I have verified that Dennett doesn’t know what he is talking about either. At best, I have verified that you have misunderstood Dennett.
I leave those possibilities for you to ponder.
tgpeeler:
Well, obviously I disagree with your assessment tgpeeler!
I certainly don’t claim to understand everything (who does?) but I’m not stupid. I’m actually quite smart.
And I’ll repeat what I’ve said elsewhere: when two smart people disagree, it’s usually worth figuring out why. The answer is often interesting.
To dismiss the other as dumb, dishonest, evasive, or whatever, is to miss an opportunity IMO, whether it is “evolutionists” dismissing IDists (who generally are not dumb) or IDists dismissing “evolutionists” (who generally are not dumb either).
I’m a scientist, trained in scientific methodology, and my domain is neuroscience. That’s not to try to give my words authority, simply to give you pause for thought that when I say make an argument relevant to cognition and volition, it may be worth considering that my argument may have merit. And if it does not, it may be worth attempting to pinpoint where it does not, rather than dismissing the whole thing as the the evasive, irrelevant, repetitive irrational burblings of a woman who “really just doesn’t understand”.
I’ll address your actual response to me later.
cheers
Lizzie
“I’m about EL’d out here.”
That appears to be an intentional goal. If one pays attention to the behaviors of these people, one begins to notice that one of their mode of argumentation, employed by the more “polite” ones, is what I call “Argument by Attrition.”
Well, you know, the primary solution to being “Lidded out” is to ignore *everything* she posts. Sure, in her mind, that will be interpreted as that she “won” … but her mind needs some furniture, anyway, so why not let her have that particular broken-down sofa?
Liz: “I’m a scientist, trained in scientific methodology, and my domain is neuroscience.”
And you do great when your talking about things of this nature. Clearly you know your stuff. But when you get into philosophy, God, morality, etc the wheels start to fall of the bus.
Nullasalus:
Well, it does seem like it. Yes, of course the thing has no meaning when divorced from a mind. But who divorced it from a mind? Not me. I said that the thing had a history, that history included the person who wrote the list, and that person has a purpose “in mind” when she wrote that list. Hence my answer “yes”.
Obviously if the list had no history – if it was the result of some vast cosmic quantum coincidence – then it was never “about” anything. But I was assuming that someone actually wrote the list. Someone with a mind.
No, it’s not completely walled off. And actually, it’s not even quite true that no-one else can control her mind – we can all have some influence on other people’s thoughts, and you have just influenced mine! However, once you lose your sense of control over your own thoughts we tend to say you have “lost your mind”. It’s not just a metaphor. But back to your main point – we can share our inner lives to some extent – through communication. We can tell other people what we are thinking. Other people may doubt that it is “really” what we are thinking, but let’s not complicate matters with dishonest communication. Let’s at least assume that people are honestly saying what they thinking. And I’d say that what we think we are thinking is indeed what we are thinking. What else would it be? (serious question).
I do agree that we have inexpressible thoughts. So yes, some aspects of our “inner life” is impossible to communicate. We cannot fully induce our own experience in another person – there is always loss in translation, not least because not only can we not fully express all that we are thinking, we can also not eradicate in the other person the knowledge that would bring to bear on the same thoughts. In other words (and this is how I would put it in neuroscience terms): we each have a unique, and constantly updated repertoire of neural behavours that we experience as thoughts. We can trigger the activation of a similar exemplar in another person, and thus induce a similar experience, but we cannot produce the exact same experience, no matter how skilled we are in communication.
I am not aware that Dennett thinks any differently, and it is certainly explicit in Hofstadter, who seems at least to think he agrees with Dennett.
Well, that last is a fair point. But I was taking the question at its face value. If I find what looks like a shopping list, and I want to know if it is “really” a shopping list, what I need to do is find out who wrote it and why they did so. If I do, and they tell me it was a shopping list, then it’s a shopping list. This isn’t rocket science! On the other hand if I am an avant garde composer (a rather passe one) and I am looking for “found texts” to write an opera, it may not matter that the thing was originally meant to be “about” items to buy in a shop, I may recycle it for a purpose of my own. It may become “about” the inner anguish of my prima donna. Maybe. I’ve heard worse operas.
It seems to me that what Dennett is saying (and of course I may be mistaken, but I don’t think so) that the paper derives its meaning from the use to which it is put. The obvious user is the person who wrote the list. But sure, someone else could recycle it for something else, in which case it would be “about” more than one thing. But his point, AFAICT, is not the multivalence of the list, but the fact that if you write something on a list, the list derives its intentionality (what it is “about”) from the use to which you put it (reminding you what to buy at the shop). If, instead of writing a list, you simply make a list “in your head” (perhaps using your “phonological loop” – that’s what I do) then that list in your head also has “derived intentionality” in just the same way as the shopping list does – from the use to which you put it. Indeed, that’s exactly what he says:
“Suppose you have composed a shopping list, on a piece of paper, to guide your shopping behavior. The marks on the piece of paper have derived intentionality, of course, but if you forgo the shopping list and just remember the wanted items in your head, whatever it is that “stores” or “represents” the items to be purchased in your brain has exactly the same status as the trails of ink on the paper. There is no more real, or intrinsic, or original intentionality than that.”
Dennett, is seems to me, is simply saying that when Jones thinks he is seeing a something called a horse, he thinks he is seeing a something called a horse. Whether he believes it is a terrestrial or a TwinEarthian horse cannot be ascertained simply by asking Jones himself what it is, because whether it is a terrestrial horse, or a Twin Earth schmorse (called, in Twin Earthese, a horse) the brain states will be identical – the horsey thing will create a specific effect on his visual cortex, and his Broca’s area will activate the vocal gestures required to enunciate the words “a horse”. And if you ask him what he is seeing , those are the words he will utter. In other words, it seems to me, Dennett et al take the view that the only way we can tell whether Jones thinks he is seeing a terrestrial horse or a TwinEarth “horse” is by asking what meaning Jones is assigning to his perception – and so the “aboutness” of his perception is “derived” from the use to which Jones (not a “third party”) puts it – is he using his perceptive apparatus to detect a terrestrial horse or a TwinEarthian “horse”? Only then can we determine whether Jones’ perception is about – whether an intentional relation exists between it and – a terrestrial horse, or,alternatively, a TwinEarthian “horse”.
To support my interpretation of what Dennett is getting at here (and I have to say, I think it is very clumsy), I’ll quote from a passage on intentionality in his book Consciousness Explained. He gives the example of a child (“Betsy”) playing Hunt the Thimble, looking straight at the thimble but failing to “see” it (even though it must be casting its image on her retina):
“We might put it this way; Even if some representational state in Betsy’s brain in some way ‘includes’ the thimble, no perceptual state of Betsy is about the thimble yet. We may grant that one of her conscious states is about the thimble: here ‘search image’. She may be fiercly concentrating on finding the thumble, the very thimble she was allowed to examine just a minute or two ago. But no strong relation of intentionality or aboutness yet holds between any of her perceptual states and the thimble, even though there may well be information in some state of her visual system that would make it possible for someone else (an ouside observer, for instance, studying the states of her visual cortex) to locate or identify the thimble. What must happen is for Betsy to ‘zero in on’ the thimble, to separate it as ‘figure’ from ‘ground’ and identify it. After that has happened, Betsy really does see the thimble. The thimble will be ‘in her conscious experience’ – and now that she is conscious of it, she will be able at last to raise her hand in triumph – or go quietly to sit with the other children who have already spotted the thimble.”
I’ll take Dennett, thanks. And yes, I know it is a continuous loop.
Sure. But where we are at odds is whether this means that thoughts, love, selves, etc are not “real” – do not exist, which is what you claimed Dennett was arguing. He isn’t. “Derived” does not mean “not real”. Does it?
If you think it does, then I’d like to hear your case! Because this seems to me to be the crux of the disagreement, not only between you and Dennett, and between you and me, but between most materialists and non-materialists.
Non-materialists think that by accounting for such higher order concepts as “love” and “self” and “mind” in terms of fundamental physical processes, materialists are denying their existence – we are “reducing” them to no more than elementary particles.
My argument is that our human ontology is, rightly, a series of nested models. We can model phenomenon at a fundamental physical level, and we can model them at a much higher (highly compressed) level (and many stations in between). One level of modelling does not have greater or lesser veridicality than the other, but the properties we ascribe to phenomena that we model at higher levels are very different from the properties of the phenomena at lower levels that give rise to them. Thus, “love” and “mind” are no less real – no less veridical models – than “neuron” or “ion” or “electron”, but have very different properties, despite the fact that they composed of relations between entities that we can, if it is useful to do so, model at a much finer (and less compressed) grain.
To risk an analogy: We can model it what you are seeing on your screen right now as a 3D matrix of rbg values; we can also model it (in much more compressed form) as a series of ascii characters. Both models are veridical, but each models entities with very different properties. One is not more real than the other, but what it is “about” in each case is very different. And that “aboutness” is a function of the use to which we put the model.
And that therefore “Materialism” does not necessitate “reducing” perfectly real higher level phenomena to low level entities. What it does mean is that we can account for the existence of the higher level entities in terms of lower level entities with very different properties.
junkdnaforlife:
You mean I start to say things you disagree with
It’s true that I don’t have a lot of patience for a lot of philosophy. I think it’s all too easy in philosophy to forget that the subject matter – epistemology, ontology, ethics – is about knowing, perceiving, and behaving, all subjects to which the the cognitive and behavioural sciences are highly relevant. I think philosophers ignore them at their peril. Dennett doesn’t, which is why I like his approach.
Ilion:
Blimey. Oh well, I may be a polite person, but I also have a high tolerance for rudeness, fortunately. So I’ll correct you on one thing: If you choose to ignore my posts, that’s absolutely fine, but don’t expect me to consider that it means I have “won”. For a start, I’m not interested in winning or losing – I’m interested in a) in finding out what people think and why we differ and b) in reaching a better understanding of the world myself.
For a second, I would never regard the departure of anyone from a conversation as a “victory” anyway.
I value communication, and when it ends, I consider it a loss.
However polite, or otherwise, my interlocutor
Peace
Lizzie
tgpeeler:
Clearly communication has failed, anyway.
Let’s go back to your original syllogism. Your first premise was:
And let me now accept your definition with the stipulation that “could ultimately be explained by the laws of physics” means that all phenomena in the universe could be predicted, probabilistically, at any rate (we need to leave room for quantum uncertainty) by a set of fundamental physical if…then rules.
OK.
Your next was:
And this is the premise I dispute. You seem to regard it as self-evident that physical rules cannot predict the manipulation of symbols. That is not self-evident to me. Indeed, that seems to me precisely the point at issue! So, clearly, I cannot accept it as a premise from which I can draw the conclusion:
Your syllogism seems to me to parse down to:
If naturalism is true all phenomena can be explained by physics; information is a phenomenon that cannot be explained by physics, therefore naturalism is false.
So your entire argument hangs on the premise that “information cannot be explained by physics” – yet the naturalist position is that it can!
So we are nowhere. What we need to do to resolve the issue is determine whether or not that premise is correct: that physics cannot explain information.
And to support your premise, you offer the argument that:
Now, obviously “laws” don’t “manipulate” anything. Nor does “physics”. So you have a category error here. But let’s leave that aside for now.
You also write:
Physics is certainly the study of the material world, but it includes the study of information. Do you dispute this? Are you saying that because information has neither mass nor energy it ouside the domain of physics?
Patterns and arrangements have neither mass nor energy, yet they are vital concepts in physics. Yet seem to be saying that any discussion of the relations between things with mass and/or energy is outside the domain of physics!
Yes, indeed information is not matter or energy. It’s a relational concept. But that doesn’t mean it’s not part of physics. All of physics is relational – A physical law says: if this, then this, right? And isn’t that exactly what information is? Something – a message, say – is informative if what happens next is contingent on it. That’s why Information theory and the Second Law of Thermodynamics are so closely interlinked:
http://en.wikipedia.org/wiki/E.....ion_theory
EL @ 72 “And this is the premise I dispute. You seem to regard it as self-evident that physical rules cannot predict the manipulation of symbols.”
Where to begin? If naturalism, at a minimum, stipulates the causal closure of nature, and it does, then it is stipulating a monism that allows for “natural” or “material” or “physical” substances and nothing else, and that these substances can only be explained or accounted for by means of the laws of physics, which govern the behavior of these substances. There is a vicious circularity here that I will ignore for now, but what naturalism says is that everything is natural and all of that can be explained by physics and nothing else.
If you THINK about it, then, one has to settle on some definition of the terms that is “public” as opposed to “private.” For instance, if I am using the term naturalism in its generally accepted way for this context, and I’m pretty sure I am, and you say well that’s not what “I” think it means, well then, we are not going to be communicating. So let’s get to the term “physics” first.
From M-W online dictionary we have:
1: a science that deals with matter and energy and their interactions
From Wickipedia we have:
from Ancient Greek: ????? physis “nature”) Physics is a natural science that involves the study of matter[1] and its motion through spacetime, along with related concepts such as energy and force.[2] More broadly, it is the general analysis of nature, conducted in order to understand how the universe behaves.[3][4][5]
And now for “symbol”
: something that stands for or suggests something else by reason of relationship, association, convention, or accidental resemblance; especially : a visible sign of something invisible
3: an arbitrary or conventional sign used in writing or printing relating to a particular field to represent operations, quantities, elements, relations, or qualities
From Wiki:
A symbol is something such as a particular mark that represents some piece of information. For example, a red octagon may be a symbol for “STOP”. On a map, a picture of a tent might represent a campsite. Numerals are symbols for numbers. All language consists of symbols. Personal names are symbols representing individuals.
Notice the glaring lack of “physics” in the definition of the word “symbol.” When the relationship of the symbol to something else is describe, no where do I see “because general relativity or quantum physics says so.”
So yes, I do regard it as “self-evident” that physical rules cannot predict the manipulation of symbols because, speaking of category errors, physics deals with the PHYSICAL (or material or natural) world and symbols do not.
It’s kind of like thinking that a circle will never be a square because, well, a circle is a CIRCLE and a square is a SQUARE.
But to play along here, since you seem to think that physical rules CAN, in principle at least, manipulate symbols, feel free to tell the rest of us how that might work. Tell us how one of the four forces in nature “tells” or describes why cat means a certain kind of mammal and snake means a certain kind of reptile. Go ahead. I’m genuinely curious, well, marginally curious, about how you think this is even possible.
EL @ 72 more… “So your entire argument hangs on the premise that “information cannot be explained by physics” – yet the naturalist position is that it can!”
This is awesome. Finally, you get the argument. And your response is: “you’re wrong!”
Skipping through the woods singing tra la la – “yes, physics can explain information!!!!!” Made my day… Thanks for that.
Then what are they made of?
So for example, a crystal.
It has no mass/energy?
It’s not arranged of molecules?
The arrangement can’t be explained by the laws of physics and chemistry?
There is no natural explanation for it’s “pattern”?
What do brains do then. When we make AI systems that, when shown an image of a cat, print out the statement ‘It’s a cat’ is it relying on some immaterial force?
Remember, AI systems can also learn to categorise things, then don’t just need to be told. Is our ability to categorise objects and generate symbolic representations down to the way our brains work, which are built with matter and operate according to the laws of physics?
um no, tgpeeler.
You’ve got that backwards.
It’s your argument that merely says ““you’re wrong!”
Your conclusion depends on the truth of your premise that “information cannot be explained by physics”, right?
So in order to make your case, you have to demonstrate that “information cannot be explained by physics”, right? You can’t just say “Lizzie you are wrong, information cannot be explained by Physics, tra la la la la” can you?
You can’t see what you did there?
Conversely, far from my response being “you’re wrong” it was (and I quote myself):
“What we need to do to resolve the issue is determine whether or not that premise is correct: that physics cannot explain information.”
So, you need explain to me why physics cannot explain information (preferably without starting from the premise that naturalism is wrong
)
However, I see you may have done so in the post above, so I will take a look now….
I just noticed that Tom and I are having the same discussion with Dr Liddle from different perspectives — but arriving at the same conceptual flaw in her understanding of information.
She literally does not understand what information is, she does not realize that it is necessarily (being an immaterial phenomenon) manifest in symbolic representations, and does not “get it” that those symbols must go through rules (protocols) in order to have an effect.
She literally thinks that she can simulate the rise of information, then indicate its presence by reading a numercial value within a certain threshold from the output of the simulation.
She’s trying to check her headlight pressue with the dipstick, and wondering why the mechanic is looking at her funny.
DrBot @ 76 “What do brains do then. When we make AI systems that, when shown an image of a cat, print out the statement ‘It’s a cat’ is it relying on some immaterial force?”
No. Not being current on AI I would assume that what it relies upon is some sort of pattern recognition software that is connected to some imaging system on the front end and a printer on the back end. All intelligently designed, if I need to add that. What a brain is doing is also pattern recognition which involves the manipulation of symbols blah blah blah…
+ – * / =
Symbols
Mathematics is loaded with them.
To me, mathematics is just a foreign language. =P
Elizabeth:
I have not really followed this thread, and I don’t want to intrude. But I have just posted on similar arguments on the interaction thread by vjt (and, by the way, in response to one post from you)
So, I would suggest: what if we say that “consciousness” cannot be explained by an objective theory based on the known laws of “nature”? Maybe information can be there and follow the laws of physics, but what about the “meaning” of information?
I think that meaning cannot be defined without any reference to a conscious observer. If you define information just as in Shannon theory (but we know that is not truly information), than we can treat it mathemathically.
But if we define information with regard to its meaning, as we in ID do for functional information, than we cannot avoid referring to a conscious observer. Function, being an expression of purpose, cannot be recognized in complete absence of a conscious, purposeful observer.
Meaning and purpose are properties of consciousness, of subjective experience. Information can certainly be “frozen” into material supports, but its meaning and purpose cannot be recognized without the intervention, direct or indirect, of conscious beings.
EL “However, I see you may have done so in the post above, so I will take a look now….”
Ready, fire, aim. Could this possibly be any more tedious or painful? I’m not optimistic. First we get the rant that I haven’t explained anything (when all I’ve done is explain HOW physics can’t cause information – so often and in so many ways that I’m sick of it myself) and then, finally, we get an “oh, maybe you already did that, I’ll go look.” Great.
UpRight @ 78 “She literally does not understand what information is, she does not realize that it is necessarily (being an immaterial phenomenon) manifest in symbolic representations, and does not “get it” that those symbols must go through rules (protocols) in order to have an effect.”
Indeed. It’s astonishing really. I haven’t decided yet who the bigger fool is here. I’m pretty sure it’s me. Head – wall – concussion – repeat and expect different results…
Mung:
Yes, of course there is. That was my point.
However, I have indeed made an error here – a snowflake has a pattern which will be destroyed when you crush it.
I careless assumed that there would be no loss of energy or mass, but I don’t think that’s true. I think the resulting mess of crystal bits will have less energy (possibly less mass) than the snowflake did, if I remember my very rusty materials science correctly.
Certainly some bonds will have been broken.
OK – so naturalism is false!
Oh, wait…
Doesn’t this apply to information as well? Isn’t the snowflake pattern itself information?
If not, why not?
“(when all I’ve done is explain HOW physics can’t cause information – so often and in so many ways that I’m sick of it myself)”
That’s the objective of “argument by attrition”.
Mung @ 80 “To me, mathematics is just a foreign language.”
Exactly. Mathematics is the universal language. Symbols and rules. And yes, foreign to most of us… just look at congress…
“And yes, [mathematics is] foreign to most of us… just look at congress…”
Shoot, that’s not even “mathematics” that they can’t speak, but simple arithmetic.
tgpeeler:
Well, I do apologise for not reading your earlier post first. But what you originally offered was a syllogism that seemed to me to depend entirely on one of your premises being true. What was important was making the case for that premise. As I said, I’ll take a look now.
Ilion, sigh… you are correct.
Upright BiPed
Look this is making me a bit cross.
The problem is not my understanding of information. The problem is understanding what YOU mean (and, for that matter what each individual on this site means) by the word “information”.
The reason we have been argy-bargying about this for so long isn’t that I don’t “understand” information, but because I’m trying to understand what you mean by it!
It’s actually a word with a great many meanings, and if any of us are to undertand each other then we need to make it crystal clear what meaning we are using!
Simply saying “information can’t be explained by physics” is completely meaningless unless whoever makes the claim makes it also absolutely clear what they mean by information in this context.
There are vast areas of physics that deal with information. Which aspect of the concept are you claiming cannot be explained by it?
You are absolutely right in one sense – I “literally” do not understand – still! – what you are talking about when you talk about information! From my point of view, it’s been like trying to nail jello to a wall!
I’m sure it’s been equally frustrating for you, but, as I keep saying, copping out by deciding I’m some deluded nutcase who can’t get a simple concept straight isn’t very persuasive! I’m not! I’m perfectly capable of being wrong, and I’m perfectly capable of noticing on occasions when I’m wrong (as I have, as it happens, just above) and I’m also perfectly capable of changing my mind when an error is pointed out.
So instead of raising your elegant eyebrows at poor deluded ignorant Lizzie, try articulating a clear definition of what YOU mean when you use the word.
*growl*
Also read my latest post to you if you haven’t already.
lol.
So that’s it? You think information isn’t quantifiable? Really?
OK, well, I guess my work here is done…
But shouldn’t you be taking this up with Dembski? Or kairosfocus maybe?
um, no. I’m asking you whether you want your headlights checked or you oil level checked, and, given one or the other, what units you’d like them reported to you in.
*growls again and pours herself a gin and tonic*
Hi Elizabeth,
The argument was one of logic and reason. It is NOT LOGICALLY POSSIBLE is quite different from it is not PHYSICALLY possible.
The argument was that it is not LOGICALLY possible. Just search on the phrase “logically possible.”
So you appear to be disputing the definition of information. You must say that the definition of information is incorrect. So I think it’s your burden to dispute the definition and give proper argumentation.
Wrong. The burden is now upon you to demonstrate that the definition of information is not correct.
No Lizzie, the state of an object is nothing more than the state of an object. It contains nothing that is called ‘information’.
We’ve been through this over and over again.
Information is a non-material abstraction of the state of an object/thing instantiated into either matter or energy by the use of symbolic representations. It requires a mechanism in order to bring it into existence, and requires protocols prior to its effect.
ID says that ‘mechanism’ is only associated within the world of living things. Materialism says that chance and law can accomplish it.
The ball is still in your court.
Dr Liddle??
Can’t understand what I am describing as information??
You cooperated in a conversation about that very topic, then suggested the majority of the following operational definition of information based upon that conversation, and I agreed with it:
Information is a representation of a discrete object/thing embedded in an arrangement of matter or energy, where the object/thing represented is entirely dissociated from the representation, but where the association of the two can be established by means of a protocol instantiated in the receiver of the information.
So … I would say that claim is demonstrably false.
Dr Liddle, I have never said that “information cannot be quantified” – when it exists.
Your claim was that you could bring information into existence by no more than chance and law.
See the distinction?
tgpeeler:
Well, no it isn’t. Or at least you haven’t persuaded me that a physical explanation of information is like a married bachelor or a square circle. Pointing out that wiki or dictionary definitions of information and symbol do not use the word “physics” is hardly persuasive.
Well, it’s a long story, tgpeeler, and it starts with the beginnings of life on this planet which I think is likely to be due to physics and chemistry, and which you probably dispute. Then, once life has started, I think that the laws of physics and chemistry gave rise to a system in which self-replicators continued to self-replicate with variance in the efficiency with which they self replicated, and that these variants arose from mutations in the molecule DNA, and organisms bearing copies of those molecules that promoted more efficient self-replication because more numerous.
At some point, these simple one-celled self-replicators acquired mutations that caused them to congregate in colonies, and because this gave them a survival advantage, they flourished. As time went on, colonies in which individual that responded to chemical signals from other members of the colony in certain ways, under certain conditions did better still, and multi-cellular life started to develop. I’ll fast forward a bit, because you already disagree with this, probably, though not all IDists do, and eventually we get to sexually reproducing organisms that are mobile, and respond effectively to advance signals of danger or food – chemical signals, light signals, sound signals, etc, and the first neural systems started to develop. Fast forward a bit further, and we get organisms with brains that are able to make complex forward models not just of whether predator or prey is in the offing, but about what actions are most likely to increase pleasure and minimise pain (these appetitive and aversive reactions having evolved earlier, being advantageous), and able to induce comparable forward models in other fellow organism by means of communicative signals – warning cries, gestures, etc. Fast forward a bit further, and we get highly communicative social organisms that live in groups and are able not only to learn mappings between complex trains of events and consequences, but can map objects and events on to arbitrary vocal gestures, and use these to transmit information (there we are!) to each other about past and future events.
All these are mediated at the physical level, of course, by physics and chemistry – ions, ion channels in cell membranes, ionic currents, spikes in electrical potentials, excitatory and inhibitory neural connections etc.
But the content of the information that is transmitted can only be understood at a level of patterning far above the level of the neurons and ions. And so we do not refer to ourselves as “this organism over here is firing its neurons in a pattern that signals an appetive drive facilitate the input of ethanol and juniper” but simply “I need a gin”.
Well, that was a bit of a romp. I’ll try to flesh out the details in a later post perhaps
But now, I really need that gin…
EL @ 90 “It’s actually a word with a great many meanings, and if any of us are to undertand each other then we need to make it crystal clear what meaning we are using!”
Dear God in heaven. 90 freaking posts into the thread and the old “what is information exactly?” rears its ugly head. I love this. Too funny.
um, UBP
Doesn’t its quantity equal zero when it doesn’t exist?
Yes indeed. And I want to know how to quantify it when I’ve done it. Obviously if the quantity is zero, I haven’t done it.
I want to know how to measure it. I hope the dipstick you offer me goes down to zero.
UPB
Well, that’s not yet an operational definition, UPD, but I agree it is a conceptual one. Unfortunately, we hit a bump in the road when you included the requirement that the protocol in question had to include a “break in the causal chain”.
But let’s continue this conversation in that other thread, shall we?
This one has already speciated to blazes.
Dr Liddle, what method did Nirenberg use?
UBP:
Correction: there is nothing that conforms to your definition of information. By other definition the state of an object most definitely contains information.
That’s the problem.
But it’s OK, because for our purposes (yours and mine) I am getting pretty close to what you mean.
Well, that bears very little resemblance to either Dembski’s or kairsosfocus’s definitions, but that’s OK.
The problem with it, as I see it, is that it depend for its definition on the process that brought it into being. That has some merit, but it means that you are potentially going to be making a circular claim if you then want to argue that this thing cannot be brought into being by any other process.
Well, if you define information as something that can only come into being within the world of living thing, then obviously it is impossible to refute the claim that information can only come into being within the world of living things.
No, you hit the net and it bounced back on your side.
In other words, your claim is still circular.
However, I’ve had a go at decircularising it. See what you think.
UPD
I’m not sure. What method did he use?
Yes Dr Liddle,
You become testy ever since it became clear to you that your operational definiton of information had necessary entailments that go beyond the mechanism you’ve prescribed for their existence. No duh.
Your #1 complaint is what I referred to as a “break in the causal chain”.
What exactly did you think your words “entirely dis-associated” would mean? Perhaps, completely without association?
How would you get through a physical process that entails a complete dis-association from physical symbol to physical output, and not have a break in the physical chain? All other instances of recorded information have it, why should your results be judged on any other criteria?
The description is accurate, but now you don’t want to accept it.
“By other infinition the state of an object most definitely contains information.”
It does? How may particles of information are contained in the state of a carbon atom?
EL @ 95 “Well, it’s a long story, tgpeeler, and it starts with the beginnings of life on this planet which I think is likely to be due to physics and chemistry, and which you probably dispute. Then, once life has started, I think that the laws of physics and chemistry gave rise to a system in which self-replicators continued to self-replicate with variance in the efficiency with which they self replicated, and that these variants arose from mutations in the molecule DNA, and organisms bearing copies of those molecules that promoted more efficient self-replication because more numerous.”
YMBSM. I give you a tightly reasoned argument in a valid form. I give you terms. I give you premises. I argue the premises logically without reference to authority or agenda. I give you a necessary conclusion. And you give me this?
“which I think is likely to be due to physics and chemistry”
An opinion? Not only just an opinion, but an opinion with a major weasel word. No explanation. No rationale. Nothing. HOW is it likely to be due to physics and chemistry?
And this???
“I think that the laws of physics and chemistry gave rise to a system in which self-replicators continued to self-replicate with variance in the efficiency with which they self replicated,”
What kind of system? What are the inputs? What are the internal processes? What is the logic? What are the rules? Who determined them? What are the outputs? Who designed the overall system? Did it just happen? How? Where did the self-replicator come from? What did they look like? Why would anything replicate? Why is there a struggle for life and where did that come from? Explain that in naturalist terms. What drives the replication process? Where did the enzymes (specialized proteins) come from that are necessary for the construction of proteins? This isn’t an argument, it’s a FAIRY TALE.
“these variants arose from mutations in the molecule DNA, and organisms bearing copies of those molecules that promoted more efficient self-replication because more numerous.”
So now you’ve brought DNA, DNA, the most complex information processing system on the planet (in the universe, in all probability) into the mix with nary a word of EXPLANATION. You need it so you just assume it. Stephen J Gould (and Rudyard Kipling) called stories like this “just so stories.” There are no arguments in this. There is no evidence. There is nothing but the same, tired, trite, crap that Dawkins feeds an unsuspecting and largely unthinking public.
I seem to recall a reference to you being a children’s author. Now I’ve seen a sample of your work. Don’t bother fleshing anything out. I won’t be reading it. The rest of your post is just more of the same. I’m sure you are nice lady and great at whatever it is that you do but you do not understand the first thing about reason, how it works, how you justify conclusions, nothing. So, as Ilion warned, I have finally been lizzied to death. Someone else who has a lot more time than I do can spend endless cycles trying to help you see reason. Adios.
p.s. Where did you get that Ph.D.? I could use one and I have a few extra hours to burn in August…
tgpeeler:
Glad to have amused you tgpeeler, but as a logician, you can surely distinguish between:
A: What is information exactly?
And
B:What exactly do you mean by information?
No?
*********
BTW, vis a vis physics, information, states and entropy, this is worth a read:
http://plato.stanford.edu/entr.....n-entropy/
tgpeeler,
Just curious, but what do you think “a mark”, “red octagon”, and “a picture of a tent on a map” are? They are material objects. How could they not be? Thus, how exactly is the definition of symbol lacking any mention of physics given the definition of physics you provided? Here it is again:
Symbols are made up of matter. Ergo, they fall under the science that deals with matter and energy and their interactions.
I can’t think of any symbol out there that isn’t made up of matter or energy. How would we perceive such a thing and be able to determine its symbolism? If you can, please describe it. I’d be very interested in reading such a description.
UPD
Golly. Well, if testiness were a reliable indicator of uncertainty of ground, there are people ahead of me in the queue.
UPB: I’m a bit testy because I put a lot of work into trying to operationalise your (non-operational) definition, when you sprung this “break in the causal chain” clause in! Nonetheless, I have attempted to incorporate it. I’m waiting for your response.
Well, I wanted to know how to operationalise it. My own conception was that there would have to be an intermediate mapping object of some kind, that could take any one of a large number of forms, rather than a simple template or jig. That is what I have now suggested.
Break in the “physical” chain? You said “causal” before. But that’s no better – in a cell there is no “break in the physical chain”. DNA maps to mRNA, mRNA maps to tRNA, tRNA maps to amino acid. All these are physical objects – molecules, and each physically interacts with the next. The mapping consists of physico chemical bonds.
No, it isn’t “accurate”. It’s nonsense. That’s why I’m trying to establish what you actually mean.
OK, bye then, tgpeeler.
Good luck with your PhD
UPB,
I’m just curious, if an object’s state is not related in any way to information, then an object’s change in state would have no relationship to information either, correct?
For example, let’s say a change from a positive charge to a negative charge – that would not have any relationship to information?
UPD:
I don’t know, UPD. It would depend of course on your definition of information
And I doubt the relevant quantity would be particles.
But let’s say I send you a message in morse. But I send it via a gang of switches (they needn’t be wired to anything – just an old switch plate will do).
An up position represents a dot and a down position represents a dash.
I write my message by setting the switch positions, and pass it to you under the table.
You decode the message, reset the switches to code your answer, and pass it back.
In that example the state of the object (the switch plate) clearly contains information, right?
Now, take a DNA molecule. In any given cell, some of the nucleotides will be suppressed with suppressor proteins and some will not be.
Those genes that are suppressed will not be expressed in that cell at that time. Those genes that are, will be.
At a later time, different genes will be suppressed, and different genes active.
Therfore, the state of the DNA object contains information – or, if it does not, nor does any DNA molecule, and I assume your position is that DNA contains information.
Now, take a snowflake: The physical state of the end of each of the points determines where the next water molecule will form. Thus the state of the crystal at time t contains information (in a very important sense) that codes for the behaviour of the water molecules and their position at time t+1.
Same with the brain (back to biology). Our brain state at time t physically codes (with a high degree of fidelity) for the brain state at time t+1. It’s how brains work.
Same with weather patterns – the state of the weather at time 1 strongly constrains the state of the weather at time t+1.
Now, I’m not using your own definition of information in all these examples, but I’m using it in someone’s definition in all of them, and I think that in some of the cases, you yourself would agree that the state of the relevant object contains information.
UPB,
What “state” is the carbon atom in? Let’s say it’s positively charged, for example. Then the “particles of information” (if that’s what you want to call the measure) would be 1. If the state is negative, it would have a measure of 0. A binary set of states conveying information.
Nicely done UB – you’ve just described the information a computer could understand!
Dr Liddle in 107
The definition you created from our observations of information is nonsense huh?
So when you typed…
… you were just being nonsensica is that right? For some good reason no doubt. Probably having something to do with gracing us with your presensce, or how much you enjoy discovering other points of view, our pehaps to try an understand our perspective, correct?
Funny, that the definition you typed out only became non-sensical when it was time to put in into play.
Doveton, you seem to have missed the point. What is the number of particles of information contained in a state of a carbon atom?
When you answer that question, your other remarks will become relevant, but not before.
“I don’t know, UPD. It would depend of course on your definition of information”
May I give you a clue Dr Liddle?
There is no information contained in the carbon atom.
Information regarding the carbon atom is information ABOUT the carbon atom, but it is not IN it the carbon atom.
It requires a mechanism to bring it into existence, Dr Liddle, because it does not exist in the carbon atom itself.
These are things we went through thoroughly almost one month ago.
What is nonsense, UPD, is the idea that in a cell, the process by which a DNA sequence is mapped to an amino acid has a “break in the physical chain”.
Where is that break?
Changing the word from physical to causal doesn’t help you at all. We have a series of molecules in the cell, interacting with each other, the output being a chain of amino acids (although let’s just stick with the amino acids for now).
What is non-”physical” about that?
I’ve already told you what I had in mind when I used the word “dissociated”. I certainly didn’t mean “a miracle happens here”.
I notice that you are not actually responding to my posts. I’ve made several points to you that you’ve ignored.
I’d like you to address them. Feel free to be as rude as you like, but please be specific. But I really am getting fed up at your contant accusations that I am somehow trying to wriggle out of something when I am doing my damnedest to wriggle in.
Someone is wriggling, right now, said Rabbit, and I know it isn’t me.
I didn’t miss the point and I addressed your question. Oddly though you seem not to understand my point – that the term “state” means something when applied to material objects. Here you go:
a : a condition or stage in the physical being of something
b : any of various conditions characterized by definite quantities (as of energy, angular momentum, or magnetic moment) in which an atomic system may exist
Thus until you define the state in your question, it is meaningless.
In fact, I even chose to pick one possible state to illustrate the point. Maybe you missed that. In any event, if you have a different state in mind for your carbon atom, feel free to elaborate.
Oh…and do notice in the definition of state that word “quantity”. When you define the state of your carbon atom, that should give some clue as to the number of particulars of information it contains. Thanks in advance!
Dr Liddle,
“Where is that break?”
Do you remember this conversation Dr Liddle?
How about this one:
Or this:
Or this:
You asked where the break was. I have grown tired of the dishonesty. I am out for a couple of hours.
UPB,
I don’t understand the differentiation you are implying about “information within” an object vs “information about” an object and what difference the distinction makes. For example, is there information within a stop sigh or about a stop sign or both? Could you elaborate on this or point me to where you discussed this previously. Thanks!
Doveton,
Sorry, but I am sure you think you are being all coy and snappy.
Just one question: did you assign the meaning “1″ to the charged state, or did the carbon atom do that?
EL @ 105 “Glad to have amused you tgpeeler, but as a logician, you can surely distinguish between:
A: What is information exactly?
And
B:What exactly do you mean by information?
No?”
I am hardly a logician but, yes, I do grasp the essential difference between the two questions. But did you not grasp that the point of my comment had nothing to do with these questions? That’s what I find aggravating. The constant deflection, diversion, mis-direction, lack of focus and mental discipline, whatever you want to call it. I make a comment that any reasonable person would grasp as a criticism about the timeliness of your concern about what information means and you come back with something completely irrelevant that now I have to (well I don’t HAVE to) address while the real issue gets lost or ignored or eventually forgotten. As others have noted.
It’s just too draining to deal with that time after time after time. I (and others) spend valuable time trying to discuss these issues and we get, well, ignored, really, when you get down to it. You’ve got your talking points that have little basis in reason or fact and as soon as you hear a key word your brain glazes over and you start in on your pre-programmed stream of unconsciousness that usually has very little to do with the guts of the issue. That’s my observation, anyway.
I’ve followed a couple of other threads that you’ve been central too and, silly me, I thought I could do better. Ha ha ha. Boy was that an error in judgment. You are way past my meager skills. Best of luck to you.
UPD
I too am tired, UPD, not with anyone’s dishonesty (least of all my own, because there is none) but with your apparent evasion of my points and unwillingness to engage (as I see it).
I should not have asked “where is the break” – I should have asked “why is there a physical break there”? That was careless phraseology on my part, not dishonesty. I apologise.
But I’ve asked you several times about why you keep insisting on a “causal” or “physical” break at this point, and I’ve suggested that perhaps what you mean is a catalyst (which is perfectly causal and perfectly physical, but at least inert).
You have not responded to this point.
You’ve changed your terminology from “causal” to “physical” but when presented with my question as to where (that’s where my “where?” came from), in any of the mappings I listed, there was a non-physical” link in the chain, you do not respond, merely accuse me of dishonesty in asking a question to which I have not received a satisfactory answer yet (yes, you did tell me where to look, I agree).
Moreover you have not yet commented on my set of criteria on the other thread, although you have continued to accuse me of evasion on this.
You have also not attempted, AFAICT, to address my point re circularity, except, repeatedly, to claim that I once accepted your conditions, now I don’t, therefore I must be scared.
No, I didn’t “once accept” your argument, because I interpreted your definition (which was not operational, despite your repeated insistance, which is precisely why I tried, and am still trying, to nail you down on the remaining ambiguities) – I’ve balked, for obvious reasons, ever since you brought up this requirement for a “break in the causal chain”.
But I’ve even suggested a possible solution!
So it seems to me I’ve gone the extra mile here, UPD. I’ve tried, repeatedly, to get you to explain why you think this “break” in living cells is a “break” and given you reasons why I think it is not (a causal or physical break), but suggested a definition that I think may still satisfy you, but eradicate the circularity.
But I do think I’ve had enough of being accused of dishonesty.
I don’t actually mind much being accused of being stupid, although it’s a bit frustrating, and also a bit of a conversation stopper. I’m still bemused why people here insist so often that those who disagree with them must not be seeing the point. As I’ve said before, when I find myself in disagreement with someone who is obviously not stupid, my interest is piqued (as it was with you) and I want to get to the bottom of where the disagreement lies.
But accusations of dishonesty I find myself having little tolerance of.
I am not dishonest, and I post here in good faith.
I assume others do likewise.
I hope to see you later, but if not, it’s been interesting.
Thanks (I actually mean that).
Lizzie
tgpeeler: as your entire argument, a as you agree, rests on the claim that information cannot be explained by physics, it is not irrelevant to ask you for the definition of information you are using.
It’s critical.
I leave you with that thought.
Cheers
Lizzie
UPD:
Re-reading your paragraph here:
This is absolutely fine. As I said I’d thought we were nearly there.
But here you specifically describe the link (the dissociated link) as “a physical object which converts one sequence into the other while they remain separate”
No problem. I’m not quite sure why you describe this as a “break in the physical chain” or a “break in the causal chain”, because it seems to me to be neither.
But if that “break” can take the form of a “physical object” there is no problem at all.
It leaves me curious about your terminology, but that doesn’t necessarily matter.
But all the more reason for you to read my last post on the other thread and check my criteria. I am now heartened that they may satisfy you.
UB,
I assigned the designation of course. “1″ is afterall a human convention and in this case it’s being used as a designation for identification purposes. It’s no different then the using designation “75 degrees” to describe how hot something is.
Doveton @ 106 “Symbols are made up of matter. Ergo, they fall under the science that deals with matter and energy and their interactions.
I can’t think of any symbol out there that isn’t made up of matter or energy. How would we perceive such a thing and be able to determine its symbolism? If you can, please describe it. I’d be very interested in reading such a description.”
So close yet so far away… Of course ALL symbols are instantiated in matter/energy. I never said they weren’t. Didn’t you learn in 4th grade math class (Mrs. Pollitt, bless her heart) that there is a difference between a ‘number’ which is abstract and a ‘numeral’ which is a concrete (i.e. written down) representation of that number?
This is the whole point. Even though the symbol (information carrier) is instantiated in a physical substrate, the MESSAGE is separate and apart from the substrate.
To say that since symbols are instantiated in matter means they are a part of physics is just nuts. I can’t really believe you even said that, almost. What does physics have to do with language? Physics is EXPRESSED in a language for crying out loud, the language called mathematics.
Now as to your question as to how I might determine that matter is acting as a symbol? How would I know that? Is that the question? In other words, how would I detect an agent that created a symbol? Here’s the infallible clue. If there is information there is intelligence. There is mind. Only a mind can freely and purposefully manipulate symbols according to rules so as to encode information in said symbols.
Let’s say you go outside and look up in the sky at the white fluffy clouds scudding across the sky. You look and you think, natural clouds, natural causes. No problem. Now let’s say you go outside and look up in the sky and see “SURRENDER DOROTHY” written in black capital letters. What do you immediately know? You know that the Wicked Witch of the West has been flying around, that’s what. Why do you know that? Because you see letters (symbols) freely and purposefully arranged according to rules (reason and English) in order to encode a message. That’s how you know. You also know the message is NOT THE SMOKE. The smoke is just the smoke. The message is different from the smoke.
I hope this helps.
To all those whose recent posts to Elizabeth Liddle reflect frustration and annoyance.
Please can I appeal to you to refrain from further expressions of those sentiments: we all get the point, I guarantee it. Especially Lizzie.
I sense that the frustrations we often feel towards atheists in general are being focused on her, personally, and that is plainly wrong. Lizzie deserves our utmost respect as a highly worthy opponent and thoroughly decent person.
Perspective is a wonderful thing: check out the usual evolutionist blogs and comment sections and be thankful that we’re not having to deal with the sort of people you find there instead.
El @ 122 “it is not irrelevant to ask you for the definition of information you are using.”
Asked and answered, counselor. Many times. But 90 posts into the conversation! ha ha ha good one.
UB,
For the purposes of this exercise, I envisioned the charge state as having been “assigned” to the atom by environment since that is normally how atoms attain any given state. I merely gave that assigned state a human designation so that I could reference it.
As far as the number of particles of information is concerned, since that too is an arbitrary human designation, and as of yet one without a scale, I am awaiting your response regarding what you think the state of the atom is so that I can assign an arbitrary, but relative, measure of the information. Thanks in advance!
So close yet so far away… Of course ALL symbols are instantiated in matter/energy. I never said they weren’t. Didn’t you learn in 4th grade math class (Mrs. Pollitt, bless her heart) that there is a difference between a ‘number’ which is abstract and a ‘numeral’ which is a concrete (i.e. written down) representation of that number?
I’m quite familiar with that differentiation, yes, however I was responding to your claim about the glaring lack of physics in the definition of symbol. Clearly it is there. If that isn’t what you meant, why did write that?
I understand that this is the claim you’re making, but I don’t find it accurate.
The symbols conferring the message “type the word “what” on your computer” have substance – we both agree. The message itself is transported to your brain via light (your are, afterall, reading the message on your screen.) Some time in your past you learned (acquired), via demonstration from others, what the words “mean” and thus your brain holds (within the Broca’s and Wernicke’s areas) the electro-chemical decipher key for now converted electro-chemical symbols. Your brain then translates the message and you have the instruction to type “what”. Where’s the lack of physics?
Interesting claim, but why do you think that?
Everything – from the light reflecting the symbols that stimulate the ocular rods (mostly) and cones (a little) that then convert the symbols to elecro-chemical impulses along the optical nerve to the electro-chemical recombination that occurs with the Broca’s neural framework and the chemical exchange that takes place with the Hippocampus to establish pattern memories, etc, etc.
Understanding concepts within physics may require math, but that does not mean that underlying physics of the universe don’t occur until we humans can describe them mathematically.
I understand that this is a central claim here. I just don’t see that claim well supported by any actual evidence.
Let’s say you go outside and look up in the sky at the white fluffy clouds scudding across the sky. You look and you think, natural clouds, natural causes. No problem. Now let’s say you go outside and look up in the sky and see “SURRENDER DOROTHY” written in black capital letters. What do you immediately know? You know that the Wicked Witch of the West has been flying around, that’s what. Why do you know that? Because you see letters (symbols) freely and purposefully arranged according to rules (reason and English) in order to encode a message. That’s how you know. You also know the message is NOT THE SMOKE. The smoke is just the smoke. The message is different from the smoke.
Have to disagree. What evidence is there for this Wicked Witch of the West, particularly for someone who has never seen the Wizard of Oz? I do know that it was written for human understanding and specifically for humans who understand English. However, this understanding is purely physical.
Yep. Very much so. Thanks again!
Thanks Chris
Lost my cool, a little there.
Will take a short break….
Lizzie, that is not losing your cool! I’ve seen far worse. I’ve been far worse myself!
I’ve posted a couple of responses to some other posts – if you wish to reply to them, please feel free to take as much time as you like.
Doveton:
What evidence is there that there are words in the sky? It’s just smoke, after all.
Why do scientists do science if they have no beliefs about it and no beliefs are required to do it?
How do you measure the accuracy of a claim?
Of course you did. And ’1′ always means the same thing, doesn’t it?
Of course you don’t.
Is the “1″ within the carbon atom?
So is it the 0 and the 1 that convey information, or is it the state of the carbon atom that convey information?
And what is that information about?
And where does that “aboutness” come from?
What makes a “1″ ABOUT the state of a carbon atom and not about, say, the number 1?
The “1″ is NOT the carbon atom, nor is the one IN the carbon atom. Nor is the ABOUTNESS conveyed by the 0 or 1 IN the carbon atom.
And why are you employing symbols?
Okay, Dr Liddle at #121, you then ask:
How does one thing represent something else, if both are the same thing?
Are amino acids made from nucleotides?
Does a stop sign apply the brakes on your car, or does the driver do that?
Is the word APPLE the same thing as the fruit apple?
Does the chemical compound that makes up an ant’s pheromone inherently mean “attack”, or is that meaning the result of a protocol established in the ant’s system which recognizes the compound, and is mapped to a certain response?
If the binary code 01100001 is encoded on a digital tape, is it converted to the letter “a” by means of a change in state, or does it retain its state, yet become decoded by rules instantiated in the system?
- – - – - – - – - – -
Why are you asking if there why is there a break between the symbol and the object being symbolized? Recorded representations must go through protocols prior to effect, or they are not symbols. This has been discussed over again
Liddle at 123,
” This is absolutely fine. As I said I’d thought we were nearly there.
But here you specifically describe the link (the dissociated link) as “a physical object which converts one sequence into the other while they remain separate””
So I wasn’t evading your comments, I had answered them long ago. And when you were suggesting that I was forcing you into “miracles”, I had already answered your question. That text was written on June 17th if I remember correctly, and has been repeated since then.
” But if that “break” can take the form of a “physical object” there is no problem at all.”
I described it that way a radioactive half-life ago. Glad you’ve caught up.
” It leaves me curious about your terminology, but that doesn’t necessarily matter.”
You shouldn’t be, when I used that term I specifically asked “if I may use that term”. To most people that question itself is a reasonable indication that the term could be a placemat for a better term if one is necessary. You never asked for a clarification.
” But all the more reason for you to read my last post on the other thread and check my criteria. I am now heartened that they may satisfy you”
I have yet to return to the other thread, but will do so. It would be unfair to say that I hold out much hope. The last time you tried to change the test, you spoke in terms of reproductive success, and measuring the percentage of fidelity, and probabilities of yadda yadda. All of which is nowhere near the criteria we had set out.
And yes, I am more than happy to move this conversation back to its other thread.
Good. Well, clearly this conversation is difficult for both of us, but let’s see what happens next.
I’ll look forward to your response on the other thread.
Doveton, are you by chance related to EL? Just sayin’… later, much later…
Mung,
Well, the evidence is the symbols themselves as confirmed in memory processing within the Hippocampus passed through analysis in the Broca’s area.
One main reason comes to mind – it is a fascinating and intellectually stimulating way to garner understanding about the interesting universe around us.
Why would I measure it when I can merely note evidence to the contrary?
Absolutely not. Why would it? Does ’1′ mean the same thing in Sudoku as it does in the formula 1+1=2? I certainly don’t think so.
That’s what I noted.
Of course not – I assigned a “1″ as a designation for the state. The question should be, is the state “within” the carbon atom or is it “about” the carbon atom and what is the distinction?
The state conveys the information within the atomic system; the 0 and 1 convey the information within my model of that system.
Which information?
Either the atomic system or the system parameters within the model.
The context created by the system.
Mung,
I agree; see above.
They are convenient placeholders for human identification. Well, for humans who have been taught how to use them anyway.
Doveton, you might want to think about the observed fact that humans did not invent symbol systems or recorded information. We came along later and found it already existed. And since it is sold as the product of billions of years of evolutionary advancement, one might ask themselves how did it exist as the basis of life.
tgpeeler,
Doveton, are you by chance related to EL? Just sayin’… later, much later…
Directly related? No. I don’t think so anyway. Indirectly related? Maybe. My ancestors all hail from the UK, so who knows.
I’ll take the question as a compliment anyway. Not sure it’s as much a compliment to Dr. Liddle however.
My biology classes didn’t present the genome as a symbolic system.
But let’s just say it is for the sake of an argument. Even if true, it doesn’t change my point since we humans devised our own unique symbolic system long before we discovered DNA or anything about it and our system doesn’t much resemble how DNA works anyway.
Doveton,
The way our symbol systems work and the symbol system in DNA works are exactly the same. The same discrete objects, the sames use of protocols, the same input output dynamics…all the same. Quite frankly, I’d be happy to hear of a communication system that operates any differently, please, tell us.
Here’s a website that shows diagrams of both Claude Shannon’s communication model (from The Mathematical Theory of Communication, 1998) and Hubert Yockey’s DNA communication model (from Information Theory, Evolution, and the Origin of Life, 2005).
Game, set, match: Upright BiPed.
Hmm… the link didn’t work, for whatever reason. Sorry. Let’s try again:
Is DNA a Code? « Cosmic Fingerprints
UB,
Doveton,
The way our symbol systems work and the symbol system in DNA works are exactly the same. The same discrete objects, the sames use of protocols, the same input output dynamics…all the same.
Could you provide me with some research studies demonstrating this? I’d be very interested in reading about the research comparisons. Thanks!
Well, simply put, DNA is not a language; it’s an encryption. DNA does not “communicate” – it mechanically “translates” to proteins directly, and that translation is accomplished via sequential conversion of the codons to the amino acids making up the protein. The actual mechanical action of the conversion IS the result of DNA, not of the DNA “talking to” anything.
In addition, DNA does more than make proteins, so by definition it can’t be a code or language since the symbols in DNA do not relate to only one specific object or concept. DNA is a more dynamic structure than our symbolic systems.
And, unlike human language, DNA follows no “Power Law” a la Zipf.
As far as I’m concerned, there’s very little similarity between DNA and our system of symbolic communication, but I’d be interested in reading alternative research on this.
Jammer,
I’ve seen similar comparisons. The problem with Yockey’s diagram, however, is that DNA has no transmitter or even a message source; DNA IS the message (sort of) in that it’s a polymer. Since it’s a polymer, the “message” of DNA isn’t received anywhere; DNA itself “translates” to proteins, stop marks, etc. So unless you’re saying that DNA is a language that DNA itself uses to communicate with itself (which seems a little silly to me, but what do I know), the argument presented above isn’t accurate.
notes:
The DNA Enigma – The Ultimate Chicken and Egg Problem – Chris Ashcraft – video
http://www.metacafe.com/watch/5542033/
,,,the first DNA code of life on earth had to be at least as complex as the current DNA code found in life:
Shannon Information – Channel Capacity – Perry Marshall – video
http://www.metacafe.com/watch/5457552/
“Because of Shannon channel capacity that previous (first) codon alphabet had to be at least as complex as the current codon alphabet (DNA code), otherwise transferring the information from the simpler alphabet into the current alphabet would have been mathematically impossible”
Donald E. Johnson – Bioinformatics: The Information in Life
Deciphering Design in the Genetic Code
Excerpt: When researchers calculated the error-minimization capacity of one million randomly generated genetic codes, they discovered that the error-minimization values formed a distribution where the naturally occurring genetic code’s capacity occurred outside the distribution. Researchers estimate the existence of 10 possible genetic codes possessing the same type and degree of redundancy as the universal genetic code. All of these codes fall within the error-minimization distribution. This finding means that of the 10 possible genetic codes, few, if any, have an error-minimization capacity that approaches the code found universally in nature.
http://www.reasons.org/biology.....netic-code
As well there was a ‘optimality’ found for the 20 amino acid set used in the ‘standard’ Genetic code when the set was compared to 1 million randomly generated alternative amino acid sets;
Does Life Use a Non-Random Set of Amino Acids? – Jonathan M. – April 2011
Excerpt: The authors compared the coverage of the standard alphabet of 20 amino acids for size, charge, and hydrophobicity with equivalent values calculated for a sample of 1 million alternative sets (each also comprising 20 members) drawn randomly from the pool of 50 plausible prebiotic candidates. The results? The authors noted that: “…the standard alphabet exhibits better coverage (i.e., greater breadth and greater evenness) than any random set for each of size, charge, and hydrophobicity, and for all combinations thereof.”
http://www.evolutionnews.org/2.....45661.html
moreover, it is not just one code that must be accounted for:
“In the last ten years, at least 20 different natural information codes were discovered in life, each operating to arbitrary conventions (not determined by law or physicality). Examples include protein address codes [Ber08B], acetylation codes [Kni06], RNA codes [Fai07], metabolic codes [Bru07], cytoskeleton codes [Gim08], histone codes [Jen01], and alternative splicing codes [Bar10].
Donald E. Johnson – Programming of Life – pg.51 – 2010
===========
The DNA Code – Solid Scientific Proof Of Intelligent Design – Perry Marshall – video
http://www.metacafe.com/watch/4060532
ENCRYPTION: In cryptography, encryption is the process of transforming information using an algorithm to make it unreadable to anyone except those possessing special knowledge, usually referred to as a key.
encryption – Encryption is the conversion of data into a form, called a ciphertext, that cannot be easily understood by unauthorized people.
Encyption The coding of a clear text message by a transmitting unit so as to prevent unauthorized eavesdropping along the transmission line.
encrypt: to put (a message) into code
2 + 2 = 4
- – - – -
You may not want to wade in too deep all at once Doveton. If you want to go through your life thinking that UUU inherently means phenylalanine as a byproduct of physics, despite the unrefuted evidence against it, then by all means, be my guest.
I’m certainly not going to try and stop you.
Cheers…
@Upright BiPed
RE: post 141
I don’t follow you point here. Could you clarify that statement for me? What do you mean when you say that mankind did not “invent symbol systems or recorded information”? Who/what did the invention and recording?
Thanks!
Doveton:
The actual mechanical action of the conversion IS the result of DNA, not of the DNA “talking to” anything.
What do you mean? DNA bears the information for the protein exactly as a sequence of bits in a hard disk bears the information for a program. Where is the difference?
In addition, DNA does more than make proteins, so by definition it can’t be a code or language since the symbols in DNA do not relate to only one specific object or concept. DNA is a more dynamic structure than our symbolic systems.
Again, I don’t understand. DNA is a code, and is a redundant code. If you mean that DNA does other things than coding for proteins, I (and IDists in general) will certainly agree. Matzke and co. probably less.
But protein coding genes are for coding for proteins. That is quite clear. And each codon in a protein coding gene corresponds to only one AA (or stop information). So, DNA is a redundant code, but not an ambiguous code, IOWs, it is not context dependent. Human languages are redundant and ambiguous. Therefore, DNA is more sinmilar to a programming language than to a human language. But it is symbolic anyway.
As far as I’m concerned, there’s very little similarity between DNA and our system of symbolic communication
Why do you say that? Look at any protein database site. Here for instance is the nucleotide sequence of the coding exons of the human hemoglobin gene:
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAGGCCATGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGTTTGACAAGTTCAAGCACCTGAAGTCAGAGGACGAGATGAAGGCGTCTGAGGACTTAAAGAAGCATGGTGCCACCGTGCTCACCGCCCTGGGTGGCATCCTTAAGAAGAAGGGGCATCATG
AGGCAGAGATTAAGCCCCTGGCACAGTCGCATGCCACCAAGCACAAGATCCCCGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCTGCAGAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGGAAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG
And here is the sequence of the protein in FASTA form:
MGLSDGEWQL VLNVWGKVEA DIPGHGQEVL IRLFKGHPET LEKFDKFKHL KSEDEMKASE DLKKHGATVL TALGGILKKK GHHEAEIKPL AQSHATKHKI PVKYLEFISE CIIQVLQSKH PGDFGADAQG AMNKALELFR KDMASNYKEL GFQG
Well, the nucleotide sequence is essentially the huamn transcription of the gene sequence, and the FASTA sequence of the protein is a human way of representing the AAs sequence in the protein. The seconf can be absolutely derived from the first by the genetic code.
So, humans seem to use symbolic ways of representing nucleotide or AA sequences that are exactly of the same kind as the symbolic sequence of nucleotides in DNA. Where is the difference? When the information about a specific, functional sequence has to be stored for further use, human and cells seem to use the same tools.
And, again, the correspondence between nucleotide sequence and AA sequence is completely symbolic, and requires knowledge of the genetic code to be effective. That knowledge, in the cell, is stored in the transcription system, asn specially in the enzymes that couple tRNA to AAs. For humans, a table of the genetic code usually is enough.
ciphertext:
What do you mean when you say that mankind did not “invent symbol systems or recorded information”? Who/what did the invention and recording?
If I may try an answer, I would say that the simple meaning is that the functional information for proteins is in the DNA, and is coded by the symbolic DBA code, as shown in my previous post. Humans have only discovered both the information and the code, observing what was in the cell.
Humans have not discovered the sequence of a functional protein binding heme and oxygen: they have just found that protein in the cell.
And the symbolic system connecting protein genes to the coded proteins hase not been created by us: we have just paifully deciphered it by long lab work.
UB,
I’m glad to see you can paste from likes of Wikipedia, Whatis, and other such sites. Did you by chance note the difference between encryption and (in terms of how we humans use it in cryptography) the message that gets encrypted? It probably would have been more accurate to say that DNA is the cipher (the actual algorithm for encryption), but the point is that DNA is not the code or plaintext.
Not sure what your point is here.
- – – – -
If you have “unrefuted evidence against it”, I’d love to read it. Thanks in advance!
I certainly would hope not; I certainly don’t think people should be stopped from drawing their own conclusions about the world around them. That said, I do think that folks who claim to have unrefuted evidence that contradicts a person’s freely drawn conclusion should ask if the person would like to investigate said evidence, and if yes, should then provide a way for said person to do his or her own investigation of said evidence.
UPD:
Interesting.
I think this may be the key to our problem.
Back shortly.
gpuccio,
What does DNA “talk” to? What “language” does DNA “speak” in? Why doesn’t DNA follow Zipf’s Law pattern?
In other words, it does not follow that because DNA seems to store information in the same way that hard drives store bits, DNA must be code.
I provided the reason above.
Doveton:
You’ve got to be kidding. You’re going to introduce “power laws” to the debate? What a red herring.
After reading through the postings in this thread, I believe I have become more confused on the subject of “meaning”. I’ve always operated on the assumption/presumption that there is no intrinsic “meaning” inherent in any physical entity. Rather that “meaning” is ascribed to a physical object by a “non physical” entity (I associate this “non physical” entity with the notion of “consciousness”). I’ve not been presented any evidence to the contrary.
It seems to me that there simply isn’t a mechanism (maybe a lack of sufficient symbolism?) available for us to provide an explanation between how the physical substance of existence (elements and forces) gave rise to a non-physical entity (consciousness). There appears to be a great body of symbolism available to ascribe meanings to the physical substances of existence (chief in my view being philosophy and mathematics, but also chemistry and physics [as allied sciences]). But I am not sure about how one could use symbolism developed with the express purpose of ascribing meaning to objects of the physical realm, to instead describe objects that I believe to be non-physical.
In my opinion, it would be a problem equivalent to explaining the “color” of light to a blind person. It would be beyond their perceptual ability to understand (by this I mean to both ascribe “meaning” and discern “meaning”) most, if not all, of the visible spectrum with respect to vision. You could not use any symbolism that relied upon visual stimulation. Either directly, as in the “showing of a color swatch”, or indirectly as in “the sky looks blue during the day” and “See that building? It is painted in blue coloring”.
Note: I do accept the potentiality of explaining “blue” (and other visible light) using auditory or other perceptual clues. However, my point is to say that; Similar to the difficulties experienced by a blind person in attempting to understand vision (i.e. lacking in perceptual capacities), we might not have the perceptual capacity to understand what (if anything) allows for communication of information between physical and non-physical entities (or…the physical substance of existence and consciousness).
What does DNA “talk” to?
In the ribosome, to the tRNA protocols.
What “language” does DNA “speak” in?
Base four digital.
Why doesn’t DNA follow Zipf’s Law pattern?
Science has some data regarding about 2% of the genetic code. You don’t know the rest, but even so, you seem willing to disregard what we already know to be true.
“If you have “unrefuted evidence against it”, I’d love to read it. Thanks in advance!”
Have you ever read any data on the issue?
The tRNA holds the amino acid on one end of its structure, and the anti-codon on the other. The two discrete entities never interact.
So is your point to say that DNA isn’t the resultant coded message, rather it is the formula you would apply to obtain the resultant coded message?
UB,
What tRNA protocols? Do you mean the binding sites? Seems odd to refer to mechanical binding as “talking”.
I’m not familiar with a description in molecular biology for this language. Could you point me to a reference for it? Thanks!
This doesn’t answer the question.
Sufficient work has been done for folks to declare that DNA is language or code. If so, then there’s more than enough evidence to demonstrate the frequencies for words that correspond to the Zipf Law. Nothing in the genome shows any such correspondence however. Given that all words in languages that humans recognize do have frequencies that correspond to Zipf’s Law, it seems premature and/or erroneous to declare that DNA is language.
Hello ciphertext,
For the purposes of protein synthesis, DNA contains representations of the states of a discrete objects. Those representations are encoded by means of a base four symbol system. Those symbols are fed into an assembler (the ribosome) which acts to bring the representation in contact with the protocols (tRNA) that allow the transfer of one sequence into another sequence while they remain seperate. It is the point where the information is transfered to the output and the output becomes constrained by it. The second sequence (the ouput) is then folded into a three-dimensional protein, as directed by the symbolic representation contained in DNA.
DOveton, does your computer process symbols?
UB,
I’m quite familar with how tRNA operates. This is not, however, “unrefuted evidence for UUU (and UUC) transcripting to phenylalanine as a byproduct of physics. Can you point me to said unrefuted evidence?
“Sufficient work has been done for folks to declare that DNA is language or code.”
It was. It was done a long time ago. Nirenberg, Khorana and Holley won the 1968 Nobel for doing it.
Doveton, you’ve become confused.
It is I who disagrees that the mapping of polyuracil to phenylalanine was physically determined. If is you who proposesd that the mapping is a product of physics.
UB,
No.
UB,
That’s very nice, but that still isn’t a reference for unrefuted evidence.
UB,
Wouldn’t be the first time…
I most definitely understand this. You made the claim that you had unrefuted evidence to support your disagreement. I have asked to to point me to that evidence so that I might evaluate it. You have yet to provide it however.
UB,
Really, no 1s and 0s for you huh? Great.
I’m not going to hold your hand for you. You can read.
Object A does not physically interact with object B.
Full stop.
- – - – - –
If you would like to say “but I have other evidence that demonstrates how they became associated” then you may by all means provide it.
Onlookers, please read here, for an admission against interest:
_________
>> http://en.wikipedia.org/wiki/Genetic_code
Genetic code
From Wikipedia, the free encyclopedia
The genetic code is the set of rules by which information encoded in genetic material (DNA or mRNA sequences) is translated into proteins (amino acid sequences) by living cells.
The code defines how sequences of three nucleotides, called codons, specify which amino acid will be added next during protein synthesis. With some exceptions,[1] a three-nucleotide codon in a nucleic acid sequence specifies a single amino acid. Because the vast majority of genes are encoded with exactly the same code (see the RNA codon table), this particular code is often referred to as the canonical or standard genetic code, or simply the genetic code, though in fact there are many variant codes. For example, protein synthesis in human mitochondria relies on a genetic code that differs from the standard genetic code.
Not all genetic information is stored using the genetic code. All organisms’ DNA contains regulatory sequences, intergenic segments, chromosomal structural areas, and other non-coding DNA that can contribute greatly to phenotype. Those elements operate under sets of rules that are distinct from the codon-to-amino acid paradigm underlying the genetic code . . . >>
____________
First rule of holes: if you need to get out, stop digging in deeper.
“First rule of holes: if you need to get out, stop digging in deeper.”
When the horse is dead, get off.
Ciphertext,
I mean to say that DNA is similar to a cipher as looked at from the POV 3 bases being “unlocked” and copied as mRNA which then synthesizes the polypeptide based on the sequence of the 3 base sets.
BIPED: Doveton, does your computer process symbols?
Doveton: No
And the moment he typed “NO” all the little N’s and all the little O’s in his keyboard shreaked out loud – as if they lost a bet – while all the other little letters heaved a great sigh of relief.
There was a big Goodbye! Celebration with hugs and snapshots with freinds, while the N and the O shook hands with the crowd and slapped on their running shoes. And off down the wire they went….
Upright BiPed:
You are of course correct that there is no law of physical necessity why UUU should map to phenylalanine. The reason it does so in a cell is because a specific RNA molecule -one of a family of RNA molecules called tRNA molecules – has a bonding site at one end for UUU and at the other for phenylalanine.
So the first question we should ask is: how many tRNA molecules are physically possible, and, of those, how many have a bonding site for UUU at one end and some amino acid other than phenylalanine at the other?
I don’t know the answer, but I don’t know any good reason why there could not be a tRNA molecule that has any combination of codon at one end and amino acid at the other.
And with 64 possible codons and 20 possible amino acids, I make that 1280 possible tRNA molecules.
So why, in a cell, of the 1280
possible of tRNA molecules, do we actually find only a small subset, namely 61? And that within this set there are no duplicates at the codon end?
That’s the key question, right? Why such a specific set (with no duplicate codon ends)?
Well, the short answer of course is that the DNA in all cells (that I know of) codes for those 61 tNRA molecules, and for no others.
But what of a cell where it doesn’t? Where, by bad luck, a much larger subset of the possible 1280 were coded for in the DNA? Well, the first thing that would happen is that if there were more than one tRNA molecule in a cell that bonded to UUU, the coding would be very unreliable. Perhaps there is a tRNA molecule with a UUU binding site at at one end, and methionine at the other. Sometimes the right protein would be made, sometimes the wrong protein.
Would such a cell have many offspring? Probably not.
And what about a cell with DNA that coded for too few tRNA molecules, so that some amino acid could not be made at all? Again, probably not.
Obviously the most efficient thing would be just 20 tRNA molecules – one for each amino acid. That might be what an Intelligent Designer would do. However, if you just let the thing replicate with DNA mutations, with the ones with better sets of tRNA molecules tending to produce more offspring than the onse with worse sets, you might well end up with rather more variety than you need, but as that is cost-free pretty well (DNA is cheap to make) then that doesn’t matter. Once all twenty amino acids are covered, and are no ambiguities (tRNA molecules that have the same codon end but different amino acid ends) there isn’t really much room for improvement.
Now, never mind whether you accept my Darwinian account of tRNA molecule selection or not – the point is that while there is no physical reason that I am aware of why other tRNA molecules might not be in the final cut, there IS a selective reason why the final cut should cover all the amino acids that seem to be useful AND have no duplicates.
And while I hesitate at this juncture to offer another sim, I would suggest that it would be trivial to code an evolutionary algorithm that started with randomly generated tRNA molecules, and narrowed them down to an optimal set. I also suggest that in any given run of the sim you’d get a different set. What would be common to all sets would be a One to One-or-More mapping between virtual amino acid and codon, but which tRNA molecules ended up in any given set would be entirely a matter of chance.
Now, you could well argue that this is just how human language works – it doesn’t matter whether we call a bird a bird or a oiseau – all that matters is that there is an approximately one-to-one mapping between signifier and signified. But that wouldn’t mean that such an arbitrary mapping had to be the product of a mind. I think I’ve shown that as long as there is a reproductive advantage in a One to One mapping, the closer the set of tRNA molecules the cell makes is to an optimal set, the more copies of cells containing that set will tend to be made.
Which may not be exactly physics, but it isn’t exactly Not Physics Neither.
BTW: I started a reply to you on the other thread – I’ll go finish it now.
Doveton:
It is not DNA that is code. The genetic code is a code, a symbolic code which allow to translate the information in DNA into the final fucntional form (the functional sequence of AAs in the protein.
And, as I have showed you, if us humans have to transmit the information about a protein sequence, we use forms of “language” that are similar, because that is the best way to transmit a functional sequence.
You ask: “What does DNA “talk” to? ”
Well, in a sense it is not DNA that “talks”, but rather the designer of living system that implements his design through (among other things) DNA. But, in another sense, DNA transmits the information stored in it:
a) to new moleculel of DNA, in DNA replication (and therefore, to new cells).
b) to mRNA, in transcription, and throgh it to the final protein, through the translation process.
ciphertext:
After reading through the postings in this thread, I believe I have become more confused on the subject of “meaning”. I’ve always operated on the assumption/presumption that there is no intrinsic “meaning” inherent in any physical entity. Rather that “meaning” is ascribed to a physical object by a “non physical” entity (I associate this “non physical” entity with the notion of “consciousness”). I’ve not been presented any evidence to the contrary.
You are perfectly right. A lot of confusion is created in these discussion when people (from both sides) try to treat information (and other similar concepts) as though it were an objective reality, either material or immaterial. The simple truth is that information is a subjective reality, that exist only in a conscious intelligent being.
A book does not contain really information. It contains specific forms that are recognizable by a conscious intelligent being and create information in its consciousness, because that same information was in the beginning represented in an other conscious intelligent being, who transferred effective forms to a material mediun so that similar representations could be evoked in other conscious intelligent being. Like meaning and purpose, information has no objective reality, but it can be transmitted though objective supports.
For instance, a protein is certainly an objective reality, and if it has an enzymatic activity, it certainly objectively accelerates some reaction in the right context. These are objective facts. But only a consciousness can define the enzimatic function, and recognize a finality in those facts. Otherwise, they are facts exactly like the existence of a stone or of a grain of sand.
Meaning and purpose are properties of consciousness. In a non conscious universe, no meaning or purpose would exist.
That’s why, in my empirical definition of dFSCI (often presented here) I need the empirical concept of “conscious intelligent being” to define both the design process and the procedure to detect it.
No objective theory, least of all strong AI, can explain subjective reality. The hard problem of consciousness is and will remain unsolved. We cannot explain consciousness. We can only accept it as part of reality, and try to describe and understand its properties.
KF,
And yes, as I’ve stated before, in casual conversation, DNA is referred to as “code” because in a simplistic sense it’s an apt way to think about the structure. However, that term is not accurate in any literal sense and certainly not accurate scientifically for the reasons I gave. I’ll elaborate.
A code in science is a member of a class of objects called “symbols”. Symbols are objects that stand in place of actual physical concepts in language. There are two levels of symbols: primary symbols and secondary symbols. The word “universe” is a primary symbol for the physical universe. If people agree to use the slang term ‘verse’, that would be a second level symbol. Any second level symbol is called a code. So, a code is a symbol of a symbol.
Given the above, the specific problem with thinking of DNA as code is that guanine, cytosine, adenine, and thymine are not codes in the genetic structure, by definition. Three bases unlocked and copied as mRNA are not a code, by definition. They aren’t even symbols in the sense of human language because they are the actual objects themselves. They don’t stand for anything. You might argue that the arrangement of the DNA is a symbol, but that’s being really liberal with the term and in the end makes the concept of DNA even less like computer code. The bottom line remains that it does not relate literally to human code at all.
Indeed. Along with getting off of dead horses, this is worthwhile advice.
Elizabeth:
You are of course correct that there is no law of physical necessity why UUU should map to phenylalanine.
Taht’s true.
The reason it does so in a cell is because a specific RNA molecule -one of a family of RNA molecules called tRNA molecules – has a bonding site at one end for UUU and at the other for phenylalanine.
Well, the tRNA has not a true “bonding site” for the codon, but rather an anticodon, which is its semantic correspondent. But the important point is that the correct coupling between tRNA and the correct aminoacid does not happen because the tRNA has a specific site for the aminoacid, but rather because a very specific protein, one of 20 aminoacyl-tRNA synthetases, “recognizes” the correct tRNAs with the correct antocodons, and couples them with the correct aminoacid.
IOWs the correct working of the genetic code is ensured not by the tRNAs, but rather by 20 highly specific proteins, one for each aminoacid, grouped in two perotein classes (10 in one, 10 in the other).
Now, these 20 proteins are very old and very complex, Just as an example, the glycil tRNA synthetase in E. coli is made of two subunits, one of 303 AAs, the other of 689 AAs.
As you can see, all your follwoing reasoning about the darwinian selection of tRNAs is basically wrong: what you have to explain is at least:
a) a redundant code of 64 codons to code for 20 aminoacids
b) the whole DNA strucutre and replication system
c) the whole transcription system
c) 20 extremely complex proteins, which are necessary for translation in all living beings
d) the correct tRNAs
e) The whole translation system, that is the ribosomes with their very long RNA molecules and their 50 or more specific proteins (some of them are in the famous table of the Durston paper).
Talk of irreducilble complexity!
And don’t tell me that protein synthesis had to be simpler in some imaginary precursor: show me that simpler system, or engineer it in the lab, and I will believe. Not before. I am a scientist, not a man of faith.
“universe” is a symbol
“verse” is a code
Got it.
Adios
@Doveton
RE: post 181
Perhaps the issue is that there is a mismatch in how you defined “code” as it is being used in this thread, and how others have defined it?
Code as defined by dictionary.com
Indicates that there are a couple of different variations upon definitions the word. However, I found interesting that the definition of code as used by “genetics” explicitly states: “to specify the amino acid sequence of a protein by the sequence of nucleotides comprising the gene for that protein”
Now, to be certain genetic code has a slightly different definition, but not appreciably so.
I think what you are describing in your post is symbolic code also known as “pseudo-code”. However, I don’t believe there is an analogue for its application in the biological sciences is there?
For a start, why would Dennett talk about a “self-forming act” if he denied that selves existed? Well, you could, I suppose, conclude (as you did, unexpectedly to me) that this just means that Dennett is inconsistent and incoherent.
Yeah, I think I’m going to stick with “Dennett is inconsistent and incoherent” – based on a plain reading of the man’s thoughts there and elsewhere – rather than go with the word of a person who clearly either doesn’t understand or cannot accept what Dennett is thinking. “Self-forming acts” for Dennett are metaphor. They are something derived, with their meaning assigned.
What I said was: “There’s not even a fact of the matter that persons or selves exist. All that exists is metaphor and convenient ways of speaking. The only “selves” that exist are what are treated as selves by convention. And there’s no convention other than what’s treated as convention by another convention.” If you want to say “selves exist, because I’m assigning that meaning to that configuration of atoms over there, and that’s all it takes for something to exist”, you go right ahead. It just exposes why the metaphors and such are so important for your position: Because once you speak bluntly, it becomes clear how empty and incoherent your view is.
Well, it does seem like it. Yes, of course the thing has no meaning when divorced from a mind. But who divorced it from a mind? Not me. I said that the thing had a history, that history included the person who wrote the list, and that person has a purpose “in mind” when she wrote that list. Hence my answer “yes”.
And there it is. Of course, I asked you if there was a fact of the matter about the list, irrespective of what anyone labels it. So of course you throw out an answer of ‘yes’ and stipulate ‘so long as someone labels it’.
And I’d say that what we think we are thinking is indeed what we are thinking. What else would it be? (serious question).
What we derive them to be thinking. Again, you don’t get Dennett, and you’re missing out on a key understanding he is trying to offer. And apparently you’re doing so because you acknowledge that if Dennett is really saying what he’s saying, then what he’s saying is ridiculous.
I am not aware that Dennett thinks any differently, and it is certainly explicit in Hofstadter, who seems at least to think he agrees with Dennett.
Of course you’re not. I mean, Dennett only explicitly says that all meaning is derived meaning. He only denies original intentionality, he only explicit says that there is no ‘fact of the matter’ what a person is thinking other than what we derive them to be thinking.
Really, you’re missing all this because you’re quite reasonably responding to it with “That’s insane”, then making the additional move of, “So therefore he can’t really be saying THAT. No, he has to be saying something else entirely.” Which is leading you off into vagueness land, where all you can really do is gesture in the air and mumble “emergence” or “recursion”.
Seriously – entertain for a moment the possibility that you are wrong, and that you have misread Dennett deeply on this point. Because I’m giving you his own writings, written clearly, and you’re not absorbing them.
But his point, AFAICT, is not the multivalence of the list, but the fact that if you write something on a list, the list derives its intentionality (what it is “about”) from the use to which you put it (reminding you what to buy at the shop). If, instead of writing a list, you simply make a list “in your head” (perhaps using your “phonological loop” – that’s what I do) then that list in your head also has “derived intentionality” in just the same way as the shopping list does – from the use to which you put it. Indeed, that’s exactly what he says:
No, it’s not ‘exactly what he says’. Dennett’s statement applies not only to the list, but also *to our interpretation of the list*. What you don’t appreciate is that the uses you talk about – ‘I’m using this list as a grocery list’ – is yet another thought, and yet another thing that must be interpreted, yet another thing with derived meaning. The very act of ‘making a list in your head’ is also derived, as is whether or not there is a list ‘in your head’.
When you affirm that certain thoughts are indisputably about this or that – that you are thinking about Texas right now, period, no interpretation needed, and a third party interpretation that says you’re thinking about daffodils is incorrect – you are parting with Dennett, because Dennett has no room for people’s thoughts matter-of-factly being about one certain thing. If a thought/brain state X is truly “about” some other thing, and if it’s not merely “about” it in the same way that “eggs” on a list is “about” (a shopping list, a recipe, a poem, nothing at all), then that aboutness is intrinsic – and Dennett is wrong, and materialism itself is wrong.
Dennett, is seems to me, is simply saying that when Jones thinks he is seeing a something called a horse, he thinks he is seeing a something called a horse.
No, that’s not the point. Do you think his opponents are arguing against the claim that when Jones ‘thinks is he seeing a something called a horse, he thinks he is seeing a something called a horse’? Do you think his opponents are arguing that this is all about what we can discover by talking to Jones?
Come on.
Dennett’s right there saying “However hard it may be to determine exactly which state he is in, he is really in one or the other (or perhaps he really is in neither, so violently have we assaulted his cognitive system).” – and then moving on to note that this is the view he (Dennett) is arguing against. When he says “we may grant that one of her conscious states is about the thimble”, that’s yet another instance of derived meaning. Betsy’s state is ‘about the thimble’ in the same way ‘eggs’ on the list is about whatever the third party minds derive it to be about.
The Betsy example does nothing for you, first because the entire example has to be read through Dennett’s quaint looking-glassing of the words involved, from consciousness to thought. But when Dennett talks about Betsy ‘looking for the thimble’ or ‘thinking about the thimble’, those words cash out to – they must cash out to, for Dennett – third party interpretation. Derived meaning.
This isn’t about perceptual states versus representational states.
I’ll take Dennett, thanks. And yes, I know it is a continuous loop.
Apparently, you don’t even know what Dennett is talking about. But I’m not surprised that you wouldn’t let a little thing like vicious circularity get in the way of believing something.
Sure. But where we are at odds is whether this means that thoughts, love, selves, etc are not “real” – do not exist, which is what you claimed Dennett was arguing. He isn’t. “Derived” does not mean “not real”. Does it?
But where we are at odds is whether this means that bigfoot, the loch ness monster, ghosts, etc are not “real” do not exist, which is what you claimed Sagan was arguing. He isn’t. “Imaginary” does not mean “not real”. Does it?
Again, I know that you’re not about to let a little thing like vicious circularity muck up your views here, but ideas do have logical consequences. And you so far seem to be struggling to valiantly resist Dennett: You’re crying “No! I know what I’m thinking! I have unique, personal, indisputable access to my thoughts and no one else has this access! I’m thinking about love! You can’t tell me I’m thinking about something else and be right!”
But yes, Elizabeth – I can. According to Dennett. Well, I can be “right”, but that too is just another instance of derivation, of interpretation, of assigned meaning. All thought is, because in the end we’re all just two-bitsers. According to this view, all we have are metaphors, manners of speaking. There is no deeper, certain reality regarding what anyone is “thinking about”, because if there was such a deeper, certain reality, then original intentionality would exist and Dennett’s view would be defunct on the spot.
Because this seems to me to be the crux of the disagreement, not only between you and Dennett, and between you and me, but between most materialists and non-materialists.
The indications are you don’t even understand Dennett on this point, to say nothing of agreeing with him. Again, the fact that you thought Dennett’s intentionality paper was about qualia drives home the point that you really don’t understand some fundamental aspects of these discussions, period, not to mention Dennett’s own views. When you affirmed that you think intentionality is just another word for qualia for Dennett, that pretty much verified that again.
Non-materialists think that by accounting for such higher order concepts as “love” and “self” and “mind” in terms of fundamental physical processes, materialists are denying their existence – we are “reducing” them to no more than elementary particles.
You are not ‘accounting for’ any of those things physically. I’d say you are eliminating them, but really, at this point your arguments and statements here are such a jumble that I’m starting to realize you’re not even aware of what position you yourself are taking.
Again: All meaning, for Dennett, is derived meaning. All ‘thoughts about’ are derived, assigned – and that includes selves, mind, and love. “Donna loves Greg” is nothing but an interpretation, a derivation assigned to acts of the thing I interpret or derive to be Donna and Greg – and my interpretation itself is only an interpretation in virtue of yet another interpretation, and so on unto vicious circularity. The same goes for “Donna hates Greg”.
So when you say “Love is my God” and “Love is real” – well gosh, EL. That’s one interpretation of your thoughts, one meaning someone is deriving. But I can derive something else from the same physical particulars. “EL has embraced a coping mechanism” for example. “EL worships Hate” would be another. And the best part is, since the only meaning and intentionality available is two-bitser intentionality, assigned/derived intentionality, by Dennett I wouldn’t be wrong about any of this. There’s no original intentionality, no indisputable fact of the matter about what you or me or anyone else is thinking.
You’re going to have to accept what it means for all intentionality to be derived intentionality. You’ve swallowed up the vicious circularity part. But really, there’s other consequences you’re going to have to take too.
Doveton:
Tell that to Crick:
What is plainly happening is that since the implications of there being a definite digital code in DNA are quite evident but inconvenient to your position, you are now trying to deny the antecedent to evade the consequent.
Only to end in increasingly patent absurdity.
“If you need to get up out of the hole, stop digging in further . . . ”
G’day
GEM of TKI
Nullasalus:
There’s probably not a lot of point in continuing this conversation, but let me just take one of your points:
Consider that you have just boxed yourself into a position from which you cannot be wrong. That is not a good position to be in.
You are saying, in effect:
Dennett is inconsistent
Lizzie thinks Dennett is consistent
Therefore Lizzie must have misunderstood Dennett.
Because Lizzie has misunderstood Dennett, Lizzie has demonstrated that she is incapable of understanding that Dennett is inconsistent.
Therefore Lizzie’s claim that Dennett is consistent is likely to be wrong.
This supports the case that Dennett is inconsistent.
But there is another possiblity:
Dennett is consistent.
Lizzie has understood Dennett
Nullasalus thinks Dennett is inconsistent.
Therefore Nullasalus has misunderstood Dennett.
Good night
Consider that you have just boxed yourself into a position from which you cannot be wrong. That is not a good position to be in.
No, I’ve built a position for myself where the data and evidence support my view. Oh, it’s terrible to be in a position where the data supports me, and you’re stumbling into accidental support of my claims by badly flubbing some pretty basic claims. Woe is me.
I haven’t just been sitting here merely asserting that Dennett’s position is incoherent and that you have misunderstandings. I’ve happily provided references, I’ve quoted Dennett directly, I’ve pointed out what his views entail. You’ve danced around this, and even dove for the bizarre move of ‘Well intentionality and qualia are the same thing for Dennett’, which is a little like saying that a plus sign and a multiplication sign are ‘pretty much the same thing for Leibniz’.
You are saying, in effect:
No, I’m providing evidence – direct quotes from Dennett, buttressed by arguments and observations – supporting my interpretation of him, and criticizing his thoughts based on those quotes and references to his work. You’ve responded by weakly objecting, and screwing up Dennett’s own relatively simple claims. Whether it’s due to simply not knowing what you’re talking about or actively bluffing, I can’t say.
Now you’re playing the old chestnut of “The one who insists that 2 + 2 = 4 is a fanatic because he’s certain he’s right. The one who entertains the possibility that 2 + 2 = 5, blue, or cow is open-minded and should be lauded”.
In short, I have not ‘boxed myself into a position where I cannot be wrong’. I’ve provided evidence – and you’ve accidentally provided me evidence – that I’m right. You’ve done a pretty poor job of replying to this, so now you’re falling back to the tried and true method of ‘Maybe I’m right, maybe you’re right – who’s to say! You’ll admit it’s logically possible for me to be right though, yes?’ to draw the subject away from that inconvenient ‘evidence and argument’ stuff.
I don’t expect you to cop to this – run of the mill internet, really. But hopefully something will sink in for you down the road.
Nullasalus:
My point precisely
So Doveton makes an appearance in #106:
Doveton 129:
Upright BiPed 164:
Doveton 168:
Doveton 129:
Unless you received that message on your computer. In that case, no symbols. Or no substance.
OMG. Upright, KF, null, GP, Mung… you guys have the patience of Job. Beam me up, Scottie…
thanks tgpeeler. And Chris Doyle even more so, lol.
But really, is it because we have a different point of view? Or could it perhaps be the actual nature of the “arguments”?
I’ve suspected for some time that many of Elizabeth’s posts are fueled by a certain chemical not known for it’s contribution to rational thought.
So Doveton appears to agree that “0″ and “1″ are symbols, and that as symbols what they represent can be changed, and that as symbols what they mean can be assigned, and that as symbols they can convey information about something, say, the state of a carbon atom.
So the questions are:
How do “0″ and “1″ attain their status as symbols?
Where does the assignment for what “0″ and “1″ represent come from?
Who or what assigns meaning to symbols?
Who or what determines that symbol x conveys information about y?
What is information?
Unless one actually types the word “what” on a keyboard connected to a computer.
At that point, there are no more symbols. Or substance.
Butting back in (very temporarily) I don’t think doveton’s capable of serious abstract thought and I’m almost positive EL is not. Without revisiting the WWWest example, who couldn’t figure that out as an ILLUSTRATION of the point. Carry on gents. You are doing great!
p.s. You may want to ask doveton how to explain the answers to your questions in terms of general relativity, QM, the Standard Model, and/or the four fundamental forces in nature. That should be fun. He’s probably already got it dodged. The man’s a wizard when it comes to E&E. (escape and evasion we used to call it)
Ciphertext,
No question. However, if that is the case, the question then should be, is the definition of code being used in the thread appropriate for the comparison to computer code? That’s the issue I was attempting to point out.
Not there isn’t, and indeed that is my point. Pseudo-code is the basis of how computer coding works, but is not analogous to how DNA works.
Mung and tg:
Just found these little droppings on my pillow:
I suggest it’s because we not only have a different point of view, but very different fundamental assumptions underlying our arguments. I’m still prepared to try to find out what these are, but it isn’t helped by the kind of snide comment I note above. Nor your repeated accusations that I am lying.
Well, I have to disagree. I think we both are. In fact I’m sure we all are. But I do think that insinuating that your opponent isn’t is a exceptionally cheap way to try to score a point.
Not pretty. And not, tbh, indicative of the serious abstract thought of which I’m sure you are capable.
KF,
And? Watson referring to DNA as “code” in a casual letter to his son goes right along with what I noted as well. I don’t see the problem.
Not at all – I for one would welcome such an implication if it actually existed, for it would be a monumentally fascinating discovery, to say nothing of an exciting opportunity for research. However, given what we have discovered, this just plainly isn’t the case.
Mung,
Could you elaborate on this statement. It does not make sense to me in the context of the discussion.
Mung,
Humans assign that status.
Humans.
Humans.
Humans determine both the meaning of symbol x and the syntax of the use of symbol x.
There are a number of definitions. Here’s one I particularly like:
2 a (1) : knowledge obtained from investigation, study, or instruction (2) : intelligence, news (3) : facts, data
From Merriam-Webster
The symbols conferring the message “type the word “what” on your computer” have substance – we both agree.
Unless one actually types the word “what” on a keyboard connected to a computer.
At that point, there are no more symbols. Or substance.
Once again, this doesn’t make any sense to me. Are you suggesting that the typed characters, “w”, “h”, “a”, and “t” are not symbols of binary constructs? Are you really under the impression that they have no substance on your monitor and in the computer’s memory? What do you think your monitor does?
Lizzie,
Well put, though I confess I reacted to this a bit differently.
Such statements can indeed be meant to score points, but on the off chance it’s a genuine opinion, my thought is that those who think I (or you or anyone else for that matter) am incapable of serious abstract thought are under no obligation to stoop to my level.
Hey…there are plenty of other folks out here to discuss things with; life is too short to waste time in discussions that aren’t stimulating.
@Doveton
Though, I suggest this as a benefit to all reading the post.
RE: Post 195
Perhaps we should “baseline” the definitions for symbol and code, such that our (technically the discussion thread’s) conversation can be more productive. It (base lining the definitions) has the added benefit of “calibrating” the conversation, such that the conversation will remain civil in tone. I find that once frustration enters into the mix, the communicable parties become less and less civil in their tone, for so long as the frustration continues.
Let me take a stab at offering the first definitions for both “symbol” and “code”.
Symbol, def. #2– a letter, figure, or other character or mark or a combination of letters or the like used to designate something: the algebraic symbol x; the chemical symbol Au.
Code, def. #1 — a system for communication by telegraph, heliograph, etc., in which long and short sounds, light flashes, etc., are used to symbolize the content of a message: Morse code.
Code (verb), to translate (a message) into a code; encode.
That is a reasonable observation regarding computing. However, inherent in that perspective is the
concept of “abstraction”. Usually, you name a particular “level” of abstraction based upon its
symbology. In brief, the lowest level of abstraction is machine code. Which, in the world of
binary computing (virtually all digital computers in operation today) means “0′s” and “1′s”. (Truthfully, you could get much lower to “frequencies” of electric current, as that is really what
the 0 and 1 represent in the computing hardware.) When you step out of the machine code realm,
you have to make use of compiler software. One of the drawbacks to abstraction. But, it frees the
programmer from having to know machine code rather than simply to know ABOUT machine code. The reasons are many for why you would want to employ abstraction, but chief among them is the gains in efficiency and functionality you obtain by doing so. You are using a “sort” of pseudo code with respect to
machine code when you write a program using one of the many computer programming languages available
(i.e Java, C, Perl, C#, etc…). Essentially, you’ve traded the symbols of 0 and 1 for
other symbols such as: PUT, GET, While, For, and Print, to name a
few. Those symbols “mean” more, carry more information, than either the 0 or 1. Indeed,
you can substitute the instruction desired to be performed by using one PUT symbol versus many,
many, many 0‘s and 1‘s that require a precise and appropriate arrangement. The compiler,
will take the PUT and convert it to machine code. Incidentally, we refer to the
collection of “abstracted” symbols (commands) as source code. This level of abstraction is where I believe the “DNA is code” proponents are suggesting DNA resides. Certainly, the DNA strand itself isn’t a biological equivalent of machine code. I believe that those would be the proteins themselves. However, if you consider the DNA to be an ordered assembly of proteins that symbolize the instructions (i.e. source code) to be given to cellular components for the construction of other proteins; the notion of DNA being an abstracted form of biological “code” does seem at least “tenable”.
Ciphertext,
Very good suggestion. Your summary seems quite accurate and well-stated btw. I agree with the definitions as you’ve laid them out.
Doveton:
Pardon me, but right now you come across a bit oddly, as this stuff is not rocket science. What do the GCAT/U elements in a string of DNA do, that is materially different from what the 1,s and 0′s do in conventional representations of PC codes?
(Hint, cf text, illustrations and vid here. Then, come back to what Crick was saying. Say slowly: “three- LETTER codons.” Cf here. Also here. BTW, the tRNA end that latches to the AA locks through a standard CCA end coupler to the COOH end of the AA. It is the loading enzyme that ensures the right AA goes on the right tRNA. This is an exercise in code translation.)
GEM of TKI
F/N: Let’s try
1 –> Pull a Yale type lock key from your pocket and look at the sequence of prongs. This is a string type data structure with coded elements in a chain. It works by key-lock fitting to push pins in the lock cylinder so the cylinder can rotate.
2 –> DNA, and RNA are similarly string structures [four state], with key-lock fitting, within the DNA strands, to mRNA and then to tRNA.
3 –> In the Ribosome, proteins are made codon by codon, with AUG as start then successive codons as elongating AAs until a stop codon triggers termination.
4 –> AAs are attached through matching anticodons on tRNAs, with the AA held by the COOH end on the opposite side of the tRNA through the standard CCA coupler.
5 –> As a result, proteins in their primary structure are strings too, generally with 20-state elements. The sequence is controlled by mRNA.
6 –> Proteins then fold and may clump and be activated, to perform their tasks in the living form.
7 –> We see a digital (discrete state) string system, based on 4-state [GCAT/U] or 20-state [AA] elements.
8 –> The specificity tied to functions is informational, and D/RNA sequences have an implied coded meaning per the rules that are often seen in genetic code tables, at least for the protein coding parts.
9 –> The information stored in the strings can be measured in essentially the same way as that stored in strings of text on a page or in a computer memory or on a CD can be measured.
10 –> Indeed this has been routinely done for decades by investigators such as Yockey et al.
__________
What is the problem here, other than that the implication is that we have coded digital information in the heart of the living cell and by far predating human life and technology?
The real issue is not with the reality of information in the macromolecules of life, but in its implications.
If that is the problem, it is — frankly — willfully obtuse to try to throw up mountain out of molehill objections to the information technology used in life forms, in the face of what has been well established, decades ago.
It is time to deal with implications, not to pretend that the past several decades of work since the early 1950s and even before, did not happen.
GEM of TKI
KF,
1s and 0s in a binary assembly represent second level symbols (letters, words, images, etc). GCAT/U do not represent any symbols whatsoever.
No, it isn’t. There is no code translation. This is simple molecule binding that has a mechanical reaction.
KF,
The key/lock is a better analogy for DNA/tRNA binding and information transfer than computer code. The only difference of course is that once the key and lock align, the lock pins then create another key as a mirror on the on the other side, which in turn is aligned to create a polypeptide.
So your steps 1-6 above are fine. You then get to this:
Who is “we”? None of the geneticists I know see this and certainly don’t either.
What implied coded meaning? Nothing is coded. Your own key/lock analogy above illustrates that nothing is coded, unless you think that a key is some kind of code and a lock is some kind of translator. If that is the case, what “message” does your house key hold and how is it any different from your car key?
“Essentially the same way”? Feel free to demonstrate such a measurement then.
Could you provide a reference for Yockey’s (or anyone elses’ work) measurement of DNA information. Thanks!
KF,
The problem here is that I can’t find any evidence that DNA is digital code for anything.
Not for me. I am not disputing that DNA imparts information.
I’ve not said anything about information being an issue. Neither has Lizzie from what I’ve read, so I’m not sure where your complaint above comes from.
Then we’re in agreement on that point.
I’ve always said that DNA is alphabetic, not digital.
I haven’t yet been persuaded otherwise.
But it contains information, on almost any definition.
tbh, I don’t think that digital metaphors work for cells at all. They are automatons rather than computers.
DNA does indeed “code for” proteins, but it does so mechanically, by means of a specific set of objects, called tRNA molecules, in which one end mates with triplets of RNA (made using DNA as a jig, effectively) and the other with amino acid. These are then physically shunted through a machine that mates the amino acids to produce a protein and release the tRNA molecules to be reused.
I don’t think the proteins, or the amino acids are any more “machine code” or “digital” than DNA is.
In fact, the whole thing is analog, not digital – we are just tempted to call it digital because the building blocks are discrete molecules. But so are the cogs and jigs and cams and racks of an automaton.
Which, like a cell, is full of information, and information transfer systems.
I think the digital part is a red herring.
Or, if a cell is a computer, so is this:
http://en.wikipedia.org/wiki/Dr._NIM
wchich it sort of is.
But it isn’t digital.
Actually, maybe it is digital.
But I’m still not convinced DNA is!
Although there is a completely different sense in which it is (I now realise Dr Nim IS digital – I’d forgotten how cool it was).
DNA does have “flip-flops” but they aren’t the bases, they are at the level of the genes. Genes can be turned on and on, and turning off one gene can stop it suppressing another, so in that sense, a cell really is like Dr Nim – which protein is expressed is contingent on the settings of a large number of switches that respond to chemical input.
But that’s not usually the sense in which DNA is considered like a computer.
The “bits” in the sense I am using it are actually the genes, which can be in an off state or an on state.
If we want to regard DNA as “quaternary” code, then the “switcher” isn’t in the cell at all, but in the environment – a very attenuated metaphor.
And it works in a weird way – the switches are randomly reset, and the environment “chooses” the settings it likes. Then those settings go on and make critters, which in turn reset a whole lot more settings, from which, again, the environment “chooses” the one it likes.
So the environment is the programmer. This is true in a real sense. It’s the answer to where the information in the genome came from (or, at least, the Darwinian answer).
@Doveton
RE: Symbols and Code
In ruminating further, I believe I understand a “sticking” point you have regarding “DNA as code”. Is it fair to assume you object to the notion that DNA is carrying a message? And by message I mean:
Message def. #1 : a communication containing some information, news, advice, request, or the like, sent by messenger, radio, telephone, or other means.
My understanding is that to say “DNA is code”, is simply stating that you view DNA as the complete instruction set (i.e. source code) for developing the physical structures of a human form (assuming the DNA provided is human). In this instance, the message transmitted is most likely nothing more than instructions. How those instructions are interpreted depends upon the system (cell, essentially) reading the instructions. Is that not the case? Could a “spleen” cell read the human DNA and use it to attempt to make a “liver” cell? My biology is a bit rusty (I’m more versed in computer programming).
RE: Key/Lock example
I believe I take a less narrow view of the key/lock system. I think you could make a persuasive argument that the key is imparting a coded message. Non human readable obviously and quite specific. The message is useful only to the lock for which it was intended. In the case of mechanical key systems, it can be copied quite easily with varying degrees of message fidelity. The message only makes sense to a human, once they impart a meaning to it. I prefer to associate the human readable symbol “now”, with the message that the key is delivering. The message isn’t really “about” anything more than it is a directive. A very, very, basic command. The lock performs it’s action upon receiving that command. In the case of most locking mechanisms it cycles between “retain control” (or “locked” if you prefer) and “release control” (or “unlocked”) upon receiving the command from the key.
Ciphertext,
Partially, but DNA is also not a medium on which a message is stored. DNA does not “communicate” with anything; the action of transcription is purely mechanical.
This is my understanding of how “DNA is code” is casually used. And as I noted, I’m fine with this use. The problem I have is when the above is equivocated with computer code. The two are not the same thing.
To be fair I could actually go along with this, however like all analogies, it isn’t perfect and breaks down upon close scrutiny of certain detailed exceptions. So in general the idea that a key contains a message for a lock is fine, but in specific, particularly if we get into the details of information theory, the analogy becomes inaccurate.
That’s the point I’ve been addressing with my “DNA is code” comments. Certainly the analogy works at a superficial level. But if we then try to take that to a detailed level and compare it more specifically to the concept of coding for computer programs, it becomes inaccurate.
@Elizabeth Little
Posting 212
RE: DNA and codes
I am going to assume that by “computer”, you are referring to the electric powered device you are using to express your ideas on this blog.
I don’t believe you can support an assertion that DNA is like a general purpose computer you reference. Certainly that is not what I am attempting to posit. Rather, I am positing that DNA, in relation to the human body, functions like the source code one would expect to be executed by microprocessors (general or specific).
My analogy with the proteins being machine code is that they (proteins) are what would be manipulated by an interpretation of the DNA source code.
Incidentally, I do believe proteins would make a very good digital analogue. Isn’t a protein in a “discrete” state when it is folded a particular way?
There is a professor/researcher named Leonard Adelman. You might know of his work, or might not. Certainly we all have used it at one point or another to secure our transactions online. His name, Adelman, is the “A” in the RSA public-key cryptography system. He has published a paper that provides a method to solve complex mathematical problems using DNA. I have not read that paper, but know of it. I’ll link to a Scientific American article here which lists his scholarly paper and describes his work.
Interesting, ciphertext
Actually, as I suggested, I think there are a number of levels at which the computer metaphor can work. I found your idea that the proteins might be seen as the “machine code” interesting.
I’m personally more interested in the way genes are switched off and on. That really does seem digital to me.
Elizabeth Liddle:
Lizzie, I am almost certain that I’ve also heard you object to letters/alphabet as a metaphor for DNA. Would I be wrong?
So which definition of information do you believe applies best to DNA and the role of DNA in the cell?
Doveton:
Yockey published on the topic for years.
http://www.hubertpyockey.com/hpyblog/about/
http://en.wikipedia.org/wiki/Hubert_Yockey
Alphabets are digital/discrete.
And so is DNA.
Doveton:
Do you know of any communication system which is not mechanical?
Are you not communicating using your computer, and the internet, and another computer on the far end, and is that not all mechanical?
If communications systems are mechanical, then how is this a valid objection?
Say that you are using a speech to text system through which you speak your words and have them transcribed into text by your computer. Is that not mechanical?
If so, why is the presence of mechanical transcription a valid objection?
Let me know if you think I’m equivocating over transcription.
Interesting post, tgpeeler, but what about a bee doing a dance to inform other bees of the whereabouts of flowers? Information is certainly being conveyed, but is “free will” involved here?
OK, so maybe what you mean to say is that ultimately free will has to be involved in the ability to create information, like, say, a free willed creator endowing bees (or computers) with an ability to tranfer information, but not that the proximate conveyor of information (the bee) is necessarily free?
Except, of course, that the thing that made the list “in one’s brain” and “on the paper” is not identical with either one. It is clear, in an intuitive way, and scientifically, that the brain is made of many “subunits of function”, and a list created in the memory by the will is not the same thing as the will that created the list in the memory. Duh.
Dennett: a man good for hours and hours of snickering amusement.
Mung,
Neither of those two references provide a reference to his measurement of DNA information. Here’s the only statement that even indicates that such could be done:
But this is nothing more than a claim that it can be done, not that is has been. Do you have a reference for Yockey actually measuring DNA information?
@Doveton
Post: 214
RE: DNA is code
Are the inaccuracies you reference related not so much to computer code, rather than the resultant of computer code? That usually being a program as we term it?
I will certainly agree with you that I do not find the notion that the source coding contained in DNA to be particularly compatible with the notion of a robust spreadsheet application like Microsoft’s Excel. The two are world’s apart, in terms of the functionality they provide. Excel is a very complex, application program, while DNA is most certainly not an application program. I do think you could say that DNA resembles computer code of the type you would find in C libraries, or Java libraries. The sorts of code that make programming applications possible, but that code itself not be an application program.
I think it is a supportable position to say that DNA is by itself a base four digital code. If what you are saying is that there are four symbols (i.e. the G, A, T, and C) representative of the desired functionality inherent to a protein, used to message an instruction set(the code) in digital format (or discrete if you prefer) to the underlying hardware (cellular structures responsible for transcription).
Would you be surprised to know that there is research being done that attempts to use DNA as a “computing device” (of sorts)? A mathematician by the name of Leonard Adelman has published a paper providing a description of how to utilize DNA to solve complex mathematical problems.
Mung,
Partially, but DNA is also not a medium on which a message is stored. DNA does not “communicate” with anything; the action of transcription is purely mechanical.
Do you know of any communication system which is not mechanical?
Yes – speaking.
It is not purely mechanical – the thoughts I’m relating via my keyboard are the non-mechanical.
Most communication I’m aware of is not purely mechanical.
Speech isn’t.
It’s purely mechanical.
I don’t think you are, but I do think you and I are using a different definition of mechanical. Here’s mine:
a : done as if by machine : seemingly uninfluenced by the mind or emotions : automatic
Merriam-Webster
As my grand-pappy used to say, “son, if you’re sitting on a tree branch, don’t saw the part between you and the tree.”
Materialism destroys its own credentials, of course. Oh, but wait! Since science is merely a pragmatic enterprise, not concerned with Truth writ large, it’s ok to destroy the ultimate credentials of human reason since it doesn’t really affects its practical application. Then fine, stop venturing out into the swamp of “meaning” and “ultimate origins”, stop making inferences that go way beyond practical utility.
You see, they want it both ways. They want materialism to be true, for human inferences to be merely practical, and yet at the same time act as if their reason somehow stands above it all. And expect the rest of us to bow down to folly.
In your worldview, logic is a mere pragmatic facility with no demonstrable inferential power to decide the Big Questions. Moreover, your views are not at all wholly derived from logic.
“what is most likely to benefit everyone),”
What “benefit” means is highly subjective swamp and depends on the foundation philosophical baggage.
Many (more I suspect) people agree that the Blessed Virgin helps them in their time of need. Like your view, this may make them feel good, and it may even be true, but it’s neither science, nor rational.
And of course, when you peel off their masks what they REALLY want is no God “for whom all men will give an account.” But I digress.
Haha. Hahahahaha.
I just love it.
Yes, trying to get specifics out of the materialists is like pulling teeth from a hungry crocodile’s mouth. 1% fact. 99% gap and speculation. Although I would bet my last rusty button the ratio is much slimmer than that.
Thanks tgpeeler for your presence here. I can add you to the list of excellent minds that have joined the circus here. Your bullsh*t detector is in top form.
Mike 1962
Not at all. A good start would be to join a library that has good access to scientific journals. You will find a great many specifics. And many journals are now open access, so you can find the specifics online. the great thing about scientific publishing is that you have be specific. The entire methodology mandates specifics.
Yes, you are probably correct. What we don’t know certainly massively outweight what we do. However, what we can do is try to make predictive models that, if supported, tell us something about the regularities of the world, and at least generalise a little from our samples.
The DNA/codons/ribosome mechanism is more analogous to CDC machines that to mere computers:
http://en.wikipedia.org/wiki/Automatic_lathe
Mike1962:
No, they probably aren’t. I still maintain that the Golden Rule is essentially rational. As for my “worldview” – I’m not sure you should presume to know what it is.
Well, yes. That’s one of the objections I have to deriving fundamental principles of justice from religious scriptures.
Well, no – one is largely cognitive, the other largely emotive. Both are of value, but objective observers can agree on what is fair; objective observers cannot agree as to whether the Virgin Mary makes people feel good.
But I would agree that there is no absolutely objective way of arriving at moral principles. The Golden Rule has the huge virtue, however, of clearly benefiting everyone, whereas “everyone for him/herself” doesn’t. So one can see, with fairly elementary reasoning, that the first will probably benefit more people than the second, which will benefit the strong at the expense of the weak.
I’m sure you would agree.
The terms “genetic code” and “codons” are employed for a reason.
Nucleotides are grouped in threes and rendered into amino acids based on a particular set of three nucleotides. Four nucleotide possibilities per digit times three digits yields 32 codes or “codons.” Those codes are explicitly mapped to amino acid production and termination. This is analogous to MIDI codes in music or holes in a player piano’s paper roll. They are symbolic codes. That’s why we can write them out using alpha letters:
AGA GAG GTG GAG CTC CTA
Which amount to codes for the code. Deal with it. We’re dealing with codes here. You’re just playing games and nobody is impressed.
I still maintain that the Golden Rule is essentially rational.
So is ‘might makes right’. So is ‘do whatever you like when you can’.
Both are of value, but objective observers can agree on what is fair; objective observers cannot agree as to whether the Virgin Mary makes people feel good.
So the thousands of years of philosophical disagreement on what is “fair” just gets brushed aside here, eh? Or do you mean that ‘at least some objective observers can agree on what is fair’? But some objective observers can agree whether the Virgin Mary makes people feel good too.
The Golden Rule has the huge virtue, however, of clearly benefiting everyone, whereas “everyone for him/herself” doesn’t.
Actually, there are losers under a Golden Rule setup: The stronger, the faster, etc. There are benefit tradeoffs. And why should anyone care that ‘more benefit’, or maximizing ‘benefit’ to begin with? And then there are conflicting ideas of ‘benefit’ with – if objective morality is objective – no real ultimate underpinning anyway.
That’s one of the objections I have to deriving fundamental principles of justice from religious scriptures.
But many religious people would argue that they do not ‘derive fundamental principles of justice’ from religious scriptures – they come from God, or from an objective and rock-bottom good, if their view is right. Suggesting that these things are merely “derived from a book” comes with the assumption that the religions are wrong.
I was talking about the specifics with regards to the text I quoted from tgpeeler. Care to take a stab at it?
And yet for some strange reason you feel the urge to say things like this:
What makes you think your putative scenario is likely?
By all means, I’m all for it.
Aren’t your words on UD reflective of it? Haven’t you basically asserted on the pages of UD that Good is God, that you reject a personal creator and think that life “likely” came to exist via blind chemical processes, and that all the bioforms were created by blind evokution? On that basis, what serious contenders for a worldview might you have?
Do tell.
So where should we derive them?
Well, let’s see. Lay it out for me and we’ll have a look. I’m sure reasoning forms part of your “faith”, as it does with most people, including Voodoo practitioners, but unless your view somehow tickled your emotions you probably wouldn’t abide it. But, again, let’s see what ya got.
I don’t know, I see a lot of squabbles about “fairness” and I find it far from objective. But let’s see what ya got.
Great. I think you just saved us both some time.
“Benefit” itself is subjective. If we can’t find an objective source for that, how can we move on to an implementation?
Anyway, go ahead and use that argument with a mugger if you happen to get mugged and see how far you get.
Answer me this? Is it “right” or “wrong” for a lion to kill a gazelle? If it’s not “wrong”, then why is it not wrong if stronger humans exploit weaker humans? Slavery DOES work! For the slaveowners. Why is it “wrong?”
Seems to me, that to really get to the goal you have in mind, someone or something is going to have to effect a change in human nature to remove all the nasty things about us that get us into trouble. Eugenics anyone? (Or God?) But who will save us from the saviors?
BTW, don’t take any of this as a personal affront to you in any “everyday” sort of way. I’m sure you’re a very nice gal in person, who most people here would be happy to sit and have a beer/coffee/tea with.
The Tarnished Rule
Do unto others as you would have them do to you, unless they cannot do unto you what you would do to them.
Doveton:
Are you serious?
What is the source of your scepticism?
mike1962 @ 229
p.s. Like trying to grab smoke… or as I said earlier in this thread, I think, who can remember, it’s like being ignored and argued with at the same time.
Doveton:
So what. You were taking about transcription and arguing that because transcription is mechanical DNA cannot communicate anything.
Your objections, as I’ve shown, is specious.
So now what is your objection?
Debateable. But the transcription is. And that was the point.
And when you speak, are the sound waves mechanical?
I think we’re using different definitions of communications system.
http://www.cosmicfingerprints.com/solve/
http://www.cosmicfingerprints......de-simple/
Mike1962,
I believe you mean “CNC” machine, in which case I pretty much agree that the mechanism is more analogous to that than a computer.
Mike1962,
Which, as noted in the discussion Ciphertext and I had earlier, is not the same thing as computer code and message data. I’m good with you illustrating my point so well, however. Thank you!
Mung,
Yep.
Wow…all that cutting and pasting and not one measurement by Yockey of information in DNA. Just curious, but do you know what “measurement” means, Mung?
Incidentally, your last link is not working.
Mung,
First, that isn’t an accurate phrasing of my objection; you’ve put the cart before the horse above.
Second, you haven’t demonstrated that my objection is specious.
I repeat: My objection all along has been the equivocation of the casual use of the term “code” for DNA with computer code. DNA is not analogous to computer code as I, Cipertext, and now Mike1962 have demonstrated.
Debateable. But the transcription is. And that was the point.
I believe we are talking paste each other here; transcription not being at all like speech and in fact not being communication was my point. Perhaps we have actually been in agreement all along.
Not by according to the definition I provided when context is speech.
Could be, but then again, that would not change my point.
Mung,
I prefer this diagram myself:
http://upload.wikimedia.org/wi.....tional.png
Pardon me if this has been brought up within the context of this thread already, but the talk of “codes” reminded me of posting at another blog. The blog linked to the Isaac Asimov TOE (Theory of Everything…not Evolution) discussion. Neil DeGrasse Tyson was moderating. On the panel was Jim Gates, of Super Symmetry fame. He has a paper (4 years old) that talks of his discovery of “Error Correction Codes” found when using N-supersymmetric models to “explain” (for lack of a better term) the “stuff of existence” (i.e. particles, forces, etc…). I’ve linked to the paper here for your reference.
Now, this all hinges on whether string theory (in one of its more peculiar forms) is “true”; as to whether the universe contains ECC codes. ECC codes (parity checking, essentially) are used computer systems extensively to insure the fidelity of the data being manipulated. Very useful when you want to insure the credibility of your calculations. The use of specialized RAM (Random Access Memory) known as ECC-RAM is even required in Highly Available, Fault Tolerant systems such as a bank’s data center or the control systems of “mission critical” components for space vehicles, fighter craft, ship/land based “Fire Control” equipment (weaponry controllers), and similar such devices.
However, this sort of thinking still informs the two ideological camps. The “Mathematical Axioms are a product of the physical realm” camp and the “Mathematical Axioms exist in the physical realm” camp. Not quite the same meaning. Essentially boiling down to whether the axioms exist because of, or in spite of, the known universe.
Doveton:
Yockey and others have measurements of info in bio molecules. (This book preview shows how they go about it. You will find an answer to the “dna is not a code” objection, here, note in that the diagram from Yockey mapping the genetic system to Shannon’s model of a comm system.)
The just above should not be amazing or a matter for serious objection.
The matter is quite similar to how we can have information measures of strings of text symbols in English, like in this comment.
Actually such should not be controversial or even an issue, once you see that these are string structures and the various elements have a message-function or are directly derived from such (for proteins).
The way this is measured is — as e.g. Shannon did with the original paper back in 1948 for English text — to simply tot up symbol relative frequencies, converted into probabilities, and to then do the negative log probabilities. This yields an additive measure, in bits if the base is 2. [Or if you want to detour, you can calculate Shannon's H, an avg info per symbol measure. That is what it boils down to.]
If the distributions were flat random [as they can in principle be, the chemistry of chaining is rather unconstraining on sequence successions . . . ] we would have 2 bits per symbol for D/RNA, and 4.32 bits per symbol for typical 20-AA proteins. That they are not quite that way in real life is not unexpected, once we deal with constraints imposed by target function or code patterns, and what happens is rarer symbols get higher info per symbol measures [such as X's in English] and more common ones do not [such as E's in English, about 1/8 of English text is made up of Es].
Durston et al’s metric on protein families is directly related, as well.
Why are you making a mountain out of a molehill on this?
GEM of TKI
KF,
Thank you for the links!
My objection to the Cosmic Fingerprints explanation is already laid out in 148 above.
As for Information Theory, Evolution, and the Origin of Life, I’m just curious, KF – given that Yockey’s whole point (one he can’t emphasize enough it seems) in that book is that although evolution is without question a natural process (and demonstrates this mathematically) and although it definitely points to the origin of life being natural (which he also takes great pains to demonstrate mathematically), the natural process for the origin of life is likely unknowable – why do you rely on this work as a reference? He makes no bones about his perspective on Intelligent Design even goes so far as to make fun of Behe’s argument. What is it about this work you admire?
That said, I’ll take a look at his calculations, though it’s rather plain that this is not a rebut of my point. Yockey goes so far as to note on pages 29-30:
If that’s the case, it seems this work and the previous discussion are not dealing with the same subject.
I’m not trying to; people just keep posting questions to me on the subject.
Doveton:
In an engineering context the metric for information is more concerned with the characteristics of symbols than their meaning. That is why there is a negative log probability of symbols metric. That says nothing about the fact that information to be recognised as such has characteristics different from noise, and yet int eh same context signal to noise ratio is a key construct.
The yardstick has a few peculiarities.
Yockey believes and hopes tha the can account for the origin of the info on ultimately forces of chance and necessity.
I did not cite him on that issue — where I disagree with him on grounds summarised here — but in answer to your request as to whether he measured info in bio-molecular contexts on Shannon-Hartley derived metrics.
Plainly, he did.
And equally plainly, when observed events E from a definable narrow and UNrepresentative zone T in a space of possible configs W, is such that E contains over 500 functionally specific bits, then we begin to see the needle in a haystack challenge faced by a search on the scope of our solar system, where its 10^57 or so atoms could not go through as many as 1 in 10^48 of the number of states that would correspond to the number of configs for a 500 bit string.
That is why I hold that
Chi_500 = I*S – 500, bits
. . . will identify cases where the resources of our solar system are hopelessly inadequate to find UNrepresentative, functionally specific configs. (Samples tend to pick up what is typical, not what is rare and atypical.)
Functional DNA, RNA and proteins in a great many cases easily pass this threshold.
The only empirically identified source for such FSCI is intelligent design. With an Internet full of cases in evidence.
GEM of TKI
mike1962 @ 221
From my post #1 on this thread: “Third, now I’d like to pose some questions about information generated by humans. Not the biological information that anti-ID types blather on about endlessly – “you can’t define or measure it so it’s not science.” I am avoiding that entire swamp right now and restricting this discussion to information (like this post, for instance) created and encoded, sent, and decoded and understood by human beings. That should be uncontroversial enough that the actual issues can be addressed.
Heh, heh, what an optimist. The whole point is that onotologic naturalism fails and I can show that by using human language.
Concerning the bee dance, the question of free will as human beings exercise it, I would say of course not. I would also contend, although I haven’t made a case for it, that the code is somehow contained in the bee DNA so that certain cues code to certain “dance steps” that can be interpreted by the bees in the hive. I don’t know. I don’t know that anyone does at this point.
In any case, my project was to show that any version of a robust naturalism, one that includes the causal closure of nature, is, in principle, incapable of accounting for human information. So it fails.
If “nature” or the “material” or “physical” world are all that exist, and that’s a textbook definition, or part of one (granted, naturalism can be pretty plastic but that’s why I stuck to a minimalist version that contains only the core commitments), then certain other things necessarily follow.
These are (at least): no God, no minds or souls, no purpose, no design, no free will. All explanations for EVERYTHING in nature must then, by definition, law of identity, be grounded in the laws of physics. I don’t know why this is so hard to get. If all that exists is natural then all of that is necessarily explainable by physics.
But physics cannot account for information since the prerequisites for information (reason, language – symbols and rules, free will, and purpose) are in principle inexplicable by physics. I’ve explained that endlessly to EL but don’t seem to have made a dent. I probably need to go back to writing class.
EL @ 211
Some quotes from Yockey’s “Information Theory, Evolution, and the Origin of Life.”
from the preface (x) The genetic information system is essentially a digital data recording and processing system.
p.2 The reason that there are principles of biology that cannot be derived from the laws of physics and chemistry lies simply in the fact that the genetic information content of the genome for constructing even the simplest organisms is much larger than the information content of these laws.
p.3 The genetical information system, because it is segregated, linear, and digital, resembles the algorithmic language by which a computer completes its logical operation.
p.5 The belief of mechanist-reductionists that the chemical processes in living matter do not differ in principle from those in dead matter is incorrect. There is no trace of messages determining the results of chemical reactions in inanimate matter. If genetical processes were just complicated biochemistry, the laws of mass action and thermodynamics would govern the placement of amino acids in the protein sequences.
p.6 Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in biology. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.
p.7 Similarly, the sequences of nucleotides or amino acids that carry a genetic message have explicit specificity. (Otherwise how does the organism live?)
p.7 The genetic information system is the software of life and, like the symbols in a computer, it is purely symbolic and independent of its environment. Of course, the genetic message, when expressed as a sequence of symbols, is nonmaterial but must be recorded in matter or energy.
p.94 …They find the genetic code to be very near or possibly at a global optimum for error minimization.
p.118 …no natural chemical procedure exists to form an optically active biochemistry.
p.119 All speculation on the origin of life on Earth by chance can not survive the first criterion of life: proteins are left-handed, sugars in DNA and RNA are right-handed. Omne vivum ex vivo. Life must only come from life.
And a couple from Richard Dawkins in “River Out Of Eden.”
p.17 … we know that genes themselves, within their minute internal structure, are long strings of pure digital information. What is more, they are truly digital, in the full and strong sense of computers and compact disks, not in the weak sense of the nervous system. … The machine code of the gene is uncannily computerlike …
p.19 Life is just bytes and bytes and bytes of digital information. (Finally, Dawkins says something that is almost correct. Life is more than digital information. But still, credit where credit is due. He gets it that life and information are inextricably linked.)
Enjoy…
mike1962 – if you can offer any improvements (or anyone else for that matter) please feel to chime in.
EL – these from “Philosophy of Mind” by John Heil.
p.23 Modern science is premised on the assumption that the material world is a causally closed system. This means, roughly, that every event in the material world is caused by some other material event (if it is caused by any event) and has as effects only material events. … We can reformulate this idea in terms of explanation: an explanation citing all of the material causes of a material event is a complete causal explanation of the event.
p.23 The notion that the material world is causally closed is related to our conception of natural law. Natural laws govern causal relations among material events.
Or Jaegwon Kim “Mind in a Physical World.”
p.40 One way of stating the principle of physical causal closure is this: If you pick any physical event and trace out its causal ancestry or posterity, that will never take you outside the physical domain. That is, no causal chain will ever cross the boundary between the physical and the nonphysical.
p.119 So all roads branching out of physicalism may in the end seem to converge at the same point, the irreality of the mental. This should come as no surprise: we should remember that physicalism, as an overarching metaphysical doctrine about all of reality, exacts a steep price.
Bravo!! A candid admission that this is complete nonsense.
I’m not making this up.
Doveton:
Whence the skepticism? What’s your point?
Mung,
Just curiosity. I’ve never seen the math.
See Yockey (2005) Chapter 4 – The measure of the information content in the genetic message and Chapter 5 – Communication of information from the genome to the proteome and Chapter 6 – The information content of complexity of protein families.
Was it something I said???
One rude little fact . . .
“p.5 The belief of mechanist-reductionists that the chemical processes in living matter do not differ in principle from those in dead matter is incorrect.”
At the same time, there is no such thing as “living matter” — just as there is no such thing as “formless matter” — rather, there are living entities.
Agreed. He didn’t quite capture that as precisely as we would have liked. I missed it so thanks from me for pointing that out. Still, he got it that life and information are like peanut butter and jelly. Can’t have one without the other. Now someone can come back and say, you CAN TOO have one without the other so you must be able to have life without information… sheesh…
For an operational definition of a peanut butter and jelly sandwich see:
http://en.wikipedia.org/wiki/O.....definition
lol…
The relational mapping between a bee’s input of ‘bob-up-and-down-this-way’ and the resulting output of ‘the food is over here’ represents a physical (causal) break that can be found in all forms of information tranfer.
Without that special inert quality, information could not exist at all, because quite literally nothing could represent anything else.
The alternative view, of course, is that ‘bob-up-and-down-this-way’ somehow inherently means ‘the food is over here’ as the end product of physical law.
Not only is that view irrational, but it doesn’t stand up to the observed physical evidence captured in every single instance of recorded information known to exist.
Not only does the representation have to exist (where one discrete thing has relational mapping to another discrete thing) but the receiver of that information must be able to access a protocol in order to establish the relationship (which does not exist in either the representation, or the thing being represented).
For the materialist, the headache is conceptualizing of a physical process whereby 1) a non-physical relationship (represenation) is established between two discrete objects, and 2) a protocol can be established at the receiver which re-establishes this non-physical relationship, in order that it may cause an effect.
In other words, two seperate feats of coordination never observed to be the product of physical forces, and at their very heart is the glaring quality of not being physically determined.
This is the underlying fact leading to Crick’s claim of a “frozen accident” in DNA. Yet it must be understood that every parcel of information that has ever existed on this planet diplays the same dynamic.
You are in trouble with the evidence if your worldview doesn’t allow for the physical freedom that information requires in order to exist. The constant flow of information on this planet woud be equal to a miracle.
But don’t we need operational definitions of peanut butter, bread, slice and butter knife?
Seriously UPB. I don’t know why what you have provided since early on in this discussion doesn’t qualify as an operational definition.
What happened to this thread??!! Upright and Mung finished it with a bee dance explanation and a PBJ definition. I guess we’ll never have to fight about this again with them, will we… ha ha ha
Well, Lizzie found out that syllogisms were dangerous and should be avoided at all cost.
I guess… I’ll give odds that she’ll make the same tired assertions in other threads even though she’s run away from this one.
Not run away – didn’t realise it was still going.
Doesn’t seem to have got very far though.
Mung’s link: “The operational definition of a peanut butter sandwich might be simply “the result of putting peanut butter on a slice of bread with a butter knife and laying a second equally sized slice of bread on top””
So, if you spread yout PB with a spoon, you don’t have a PB sandwich.
Much as I dislike Dr Luddite’s penchant for passive-aggressive argument-by-hand-waving, etc, I have to say that it’s not fair to accuse her of having run away.
Even if it weren’t the fact that real life keeps happening, these UD threads are far too difficult to keep track of.
That’s the great thing about operational definitions!
That depends on your operational definition of butter knife.
re. Ilion. point taken. sorry EL. For example, I too, thought this was finished but just happened to notice it was still active.
@EL:
Not sure if you are still reading this thread, but I’m intrigued by your comment that CSI is too conservative. I would agree that CSI is conservative. By definition it cannot describe all instances of intelligent activity. What would you propose as a more comprehensive definition of intelligent activity?
Ilion – thanks for making that point. Yes, I do find this site something of a nightmare to keep track of!
In fact, I’m right now trying to set up my own blog, where I will try to address various issues that have been raised with me here, and will be a sitting duck for anyone who wants to challenge
Eric Holloway: My take on CSI is this: even if it were a good design detector in principle, which I don’t (I should make that clear, I don’t want to lead you on!) I think it sets far too high a bar for design to have to climb.
And, while I can’t verify this for myself, there is at least one article out there claiming that the Number-of-Events-in-the-Universe constant is actually many orders of magnitude too low, and if it were correct, CSI would be completely useless even at detecting known examples of design!
But as I said, that’s not my math, so I don’t take a personal stand on that, but I still think it’s way too high. If I thought that life depended on the fortuitous coming together of the raw ingredients of even the simplest living cell we can imagine, I’d immediately reject it as an explanation without even bothering to calculate a p value.
So if I were Dembski, I’d drop that constant (which trips people up anyway) and define CSI not as a quantity that exceeds some threshold, but as a simple metric, and leave the threshold-setting as a separate argument: “This biological object contains x bits of CSI of x; this means that the probability that of it occurring by chance in the entire history of the universe is less than one; therefore, design”.
Which would leave the measure open to other, less dramatic claims, such as: “this astronomical signal contains x bits CSI; this means that it is highly unlikely to have been generated by chance processes, and we should start investigating possible intelligent origins for the signal”.