Programs, cells and letting God be God (A concluding reply to the Smithy)
| April 30, 2010 | Posted by vjtorley under Intelligent Design |
![]()
I would like to thank Dr. Sullivan for his recent post, Nature, Artifacts, Meaning and Providence which has helped to clear the air enormously. In his closing comments, Dr. Sullivan calls for calm in the debate over life’s origin, and urges that the origin of life should be examined dispassionately, in an atmosphere free from theological bias. He is of course quite right, and in this post, I intend to engage him on precisely those terms. What I propose to do is address some general issues raised by Dr. Sullivan in his latest post on ID.
Life – an agreed definition?
While our views on the formal conditions for something’s being alive are somewhat divergent, I think we can now agree on the finalistic conditions.
In his his recent post, Nature, Artifacts, Meaning and Providence, Dr. Sullivan made some highly pertinent criticisms of the finalistic definition of life that I originally proposed, viz. that a living thing is a thing with a good of its own. This was followed by a helpful clarification (see UPDATE 2) by Professor Feser of an alleged difference I had pointed out between his way of talking about immanent causality and Dr. Sullivan’s. After reading their comments, I hope that Dr. Sullivan, Professor Feser and I can all agree on the following finalistic definition of life, which is adapted from a remark made in an earlier post by Professor Feser:
A living thing is a natural entity characterized by causal processes occurring within it, which can only be understood as terminating within and benefiting the organism considered as a whole.
Now I’d like to discuss the formal conditions for being alive. Dr. Sullivan has no quarrel with the second and third conditions I proposed (a nested hierarchy and embedded functionality), but he queries the legitimacy of describing the cell in terms of a program. To him, this terminology might be all right if it were merely metaphorical, but the literal usage strikes him as problematic. Now, cells of course do not understand “meaning,” and I would not say that “what happens in the generation of an organism is the application of meaning, according to grammatical rules, to transmit semantic content” (to quote Dr. Sullivan’s words), because this characterization overlooks the mechanics of generation. Instead, I would say that semantic content is indeed transmitted, but that this is accomplished by a chemical process, just as computers (whose programs embody semantic content) actually perform their calculations by means of processes at the electronic level. I would also claim that if scientists want to properly understand how cells work, then the only appropriate way to do so is to speak in terms of a program contained in their DNA. In other words, scientists need to employ the notion of semantic content to grasp how living things work. Now that is surely a very odd fact.
Is the “program” in the cell a real program?
The answer, I would maintain, is: yes, and it’s as literally a program as the nose on your face is literally a nose. There’s no metaphor here.
Both Dr. Sullivan and Professor Feser have queried my terminology here, so I’d like to cite a few scientifically respectable sources for my claim.
Let me begin with the late Daniel Koshland, Jr. (1920-2007), former editor of the journal Science, a long time professor of molecular and cell biology at UC Berkeley, and author of an oft-cited essay entitled, The Seven Pillars of Life, in Science 22 March 2002: Vol. 295. no. 5563, pp. 2215 – 2216, DOI: 10.1126/science.1068489. I shall quote a key extract:
What is the definition of life?… I think the fundamental pillars on which life as we know it is based can be defined. By “pillars” I mean the essential principles – thermodynamic and kinetic – by which a living system operates…
The first pillar of life is a Program. By program I mean an organized plan that describes both the ingredients themselves and the kinetics of the interactions among ingredients as the living system persists through time. For the living systems we observe on Earth, this program is implemented by the DNA that encodes the genes of Earth’s organisms and that is replicated from generation to generation, with small changes but always with the overall plan intact. The genes in turn encode for chemicals – the proteins, nucleic acids, etc. – that carry out the reactions in living systems. It is in the DNA that the program is summarized and maintained for life on Earth.
Here’s software developer Bill Gates (who is incidentally an atheist): “Human DNA is like a computer program but far, far more advanced than any software ever created.”(The Road Ahead, Penguin: London, Revised, 1996, p. 228.)
When Bill Gates says something like that, I pay attention.
I’d also like to quote from an article by Alex Williams, a creationist who spent most of his professional career working as a botanist for the Australian government, and who is currently a Research Associate at the Western Australian Herbarium, specializing in the taxonomy of grasses. The article is entitled, “Astonishing complexity of DNA demolishes neo-Darwinism,” and was published in the Journal of Creation 21(3), 2007 (pages 111-117). It is available online at http://creation.com/images/pdfs/tj/j21_3/j21_3_111-117.pdf . Here’s a short extract:
The traditional understanding of DNA has recently been transformed beyond recognition. DNA does not, as we thought, carry a linear, one-dimensional, one-way, sequential code — like the lines of letters and words on this page. And the 97% in humans that does not carry protein-coding genes is not, as many people thought, fossilized ‘junk’ left over from our evolutionary ancestors. DNA information is overlapping – multi-layered and multi-dimensional; it reads both backwards and forwards; and the ‘junk’ is far more functional than the protein code, so there is no fossilized history of evolution. No human engineer has ever even imagined, let alone designed an information storage device anything like it. Moreover, the vast majority of its content is metainformation — information about how to use information. Meta-information cannot arise by chance because it only makes sense in context of the information it relates to.
That’s just a short quote to whet the reader’s appetite. The author goes on to describe how DNA instantiates coding techniques that are more efficient than anything dreamed of by human computer programmers, with the same code having layers upon layers of meaning. His discussion of meta-information is also well worth reading. More recently, Alex Williams has published an update on his research at http://creation.com/astonishing-dna-complexity-update .
It was Williams’ article that alerted me to what ID was all about, a few years ago. I could finally understand the scientific evidence that living things had been designed by an Intelligent Creator. Living things contained programs that were cleverer than anything we could design. To not infer a Designer for these programs would be an act of intellectual blindness.
Finally, I’d like to cite Dr. Don Johnson, who has a Ph.D. in chemistry and a Ph.D in computer and information sciences, gave a presentation entitled Bioinformatics: The Information in Life for the University of North Carolina Wilmington chapter of the Association for Computer Machinery, on April 8, 2010. Dr. Johnson’s presentation is now on-line at http://vimeo.com/11314902 . Both the talk and accompanying handout notes can be accessed from Dr. Johnson’s Web page at http://scienceintegrity.net/ . Dr. Johnson spent 20 years teaching in universities in Wisconsin, Minnesota, California, and Europe. Here’s an excerpt from the presentation blurb:
Each cell of an organism has millions of interacting computers reading and processing digital information using algorithmic digital programs and digital codes to communicate and translate information.
I’d like to quote a brief excerpt from Dr. Johnson’s presentation:
“Somehow we have a genetic operating system that is ubiquitous. All known life-forms have the same genetic code. They all have the same protein manufacturing facilities in the ribosomes. They all use the same types of techniques. So something is pre-existing, and the particular genome is the set of programs in the DNA for any particular organism. So the genome is not the DNA, and the DNA is not the program. The DNA is simply a storage device. The genome is the program that’s stored in the storage device, and that depends on the particular organism we’re talking about.”
On a slide entitled “Information Systems In Life,” Dr. Johnson points out that:
- the genetic system is a pre-existing operating system;
- the specific genetic program (genome) is an application;
- the native language has codon-based encryption system;
- the codes are read by enzyme computers with their own operating system;
- each enzyme’s output is to another operating system in a ribosome;
- codes are decrypted and output to tRNA computers;
- each codon-specified amino acid is transported to a protein construction site; and
- in each cell, there are multiple operating systems, multiple programming languages, encoding/decoding hardware and software, specialized communications systems, error detection/correction systems, specialized input/output for organelle control and feedback, and a variety of specialized “devices” to accomplish the tasks of life.
To sum up: the use of the word “program” to describe the workings of the cell is scientifically respectable. I would like to add that although I used the term “master program” in a previous post, it matters little for my purposes how many programs are running in the cell; what matters is that they are well co-ordinated. In the absence of this co-ordination, they would be unable to accomplish their respective tasks smoothly and harmoniously, as they would be liable to interfere with one another.
I believe that the question of whether the program contained in the DNA of cells is a real program needs to be turned on its head. The program in DNA is a paradigm of what a good program should be like. The question we should be asking ourselves is: do our poorly written human programs, which are but a pale imitation of the Real Thing, deserve to be called programs in the true sense of the word? In other words, the shoe is on the other foot. If the program in our DNA is not a program, then nothing is.
Future directions for science
If living cells embody programs which are far superior to anything written by our own scientists, then the future direction of science is clear: we have to reverse-engineer the cell. This is part of a grander project, which Dr. Steve Fuller has written about: the endeavor to reverse-engineer the Divine plan. Let me add that I do not believe that this project is tied to a mechanistic conception of life; rather I see it as a simple consequence of the fact that the Universe was designed to be understood. In so doing, we are “thinking God’s thoughts after Him,” as Newton put it.
As I see it, the atheistic denial of a Designer of nature is therefore a “science-stopper.” When scientists unthinkingly accept the common prejudice that Nature is blind, they stop looking for reasons why nature might do things in a particular way that may appear scientifically puzzling. Instead of digging deeper, they conclude that the organism they are looking at is a “kludge” or that its DNA contains “junk.”
The intellectual impetus behind ID is the conviction that the design we see in nature is intelligible to rational human beings who are prepared to look at nature with an open mind.
What does my “program argument” prove, anyway?
Both Professor Feser and Dr. Sullivan raise the legitimate question of whether my argument from “There is a program in our DNA” to “DNA was designed by an Intelligent Being” begs the question, in terms of its teleological assumptions. Let me say at the outset that I would not use this argument on a dyed-in-the-wool skeptic who denied the existence of teleology in living things. When arguing with such a skeptic, I would cite the ID argument made in Dr. Stephen Meyer’s Signature in the Cell. It is a simple fact that the DNA in the cell exhibits two properties: Shannon complexity and functional specificity. Thus we can describe it as containing specified information. The best explanation for the vast amount of specified information found in even the simplest living things is an intelligent designer. In the absence of such a designer, the likelihood of laws of nature and/or chance events generating the amount of specified information found in the cell is astronomically low. Dr. Meyer’s argument is solid and scientifically respectable, and can be used against any skeptic. It appeals to probabilities, not because it contains mechanistic assumptions, but because it seeks to engage skeptics on their own turf.
My argument that living things instantiate programs, and that neither the laws of nature nor chance are reliably capable of creating programs, leaving intelligence as the only reliable explanation of the programs we find in living things, is an argument that would appeal to anyone with an open mind. The argument does appeal to an immanently teleological feature of organisms: life instantiates programs. In that sense, it is indeed Aristotelian. But the argument does not require an explicit avowal of Aristotelian teleology. It simply invokes a commonly used way of talking about DNA, which many scientists feel increasingly comfortable with, and it proceeds from that starting point. Thus it appeals to a way of talking which is implicitly teleological, and then appeals to the elegance and perfection in the cell’s programs as evidence of a Higher Intelligence. As scientists make further discoveries of the beauty of the cell’s code in the years to come, I believe that this argument for a Designer of the cell will gain strength.
Beyond “either-or”: let God be God
In his post, Dr. Sullivan makes a plea for thinking that goes beyond “the dichotomy that God is either the blind watchmaker that winds up the universe at the big bang and then lets it unspool according to blind laws, or that he has to enter into the world and tinker around with particles in order to make things come out as he likes.”
I agree. The Judeo-Christian view is that God continually upholds nature, sustaining it in being by his Word. No living thing could survive even for an instant without God. God is infinitely more than a watchmaker.
But we know that life had an origin at some point. How did it originate? In my original response to the Smithy) , I was somewhat harsh in my criticism of the view that the laws of nature alone, combined with just about any old set of initial conditions, could have generated the first living thing. The language I used was rather judgmental, and I’d like to apologize for any offence caused. I have reflected on Dr. Sullivan’s arguments in his recent post, Nature, Artifacts, Meaning and Providence and have modified my own views somewhat. What I’d now like to do is make a short list of all possible origin-of-life scenarios, and briefly discuss the theological implications of each.
As I see it, the first living thing could have been generated by one of three processes:
(a) the laws of nature alone, with no need for a specific set of initial conditions, because any set of conditions would generate a living thing somewhere in the universe;
(b) the laws of nature, combined with a very specific set of initial conditions;
(c) an act of intelligent intervention, which may or may not have been followed by other acts of intervention.
Can anyone think of any others?
I have discussed something like scenario (a) previously from an ID perspective, in a short post of mine:
Because ID is agnostic regarding the Designer’s modus operandi, it allows for the possibility that scientists might one day discover bio-friendly laws, which, when combined, constitute a “magic pathway” leading from simple substances to complex life. But these laws would themselves have to be highly specific (e.g. relating to particular molecules), extremely numerous (perhaps numbering in the tens or hundreds of thousands), and in some way sequential (so that together, they would make up a series of stepping stones leading to life and complex animals). In short, they would be quite unlike any laws discovered to date, as the laws we know are general, relatively few in number, non-sequential and information-poor.
On this view, the laws of the universe are designed for life, but not for any particular life-form such as ourselves. Our own individual existence could still be planned, however, by God choosing a particular set of initial conditions at the moment of the Big Bang, which He knew would eventually give rise to us.
What ID tells us here is that if you want laws that will generate life under any set of initial conditions, they would have to be very, very specific. Life has a high degree of specified complexity. A simple set of laws won’t do the trick.
Scenario (b) has been discussed by Professor Michael Behe in The Edge of Evolution (The Free Press: New York, 2007, pp. 231-232). In essence, Professor Michael Behe’s proposal is that God set up the universe at the beginning of time with an extremely finely tuned set of initial conditions, so that all He had to do was press “Play,” as it were, and the universe then unfolded naturally, resulting in the first living organism. On this view, God designed the initial conditions, with a view to producing the first living thing.
The design implications of scenario (c) are too obvious to require spelling out.
Summing up, it seems to me that all three scenarios are ID-compatible. Scenario (a) would appear quite congenial to theistic evolutionists, and perhaps (b) as well. Scenarios (a) and (b) require no act of supernatural intervention within the cosmos to create life, but of course they require intelligence to design a cosmos that can generate life.
What does ID have to say about these scenarios? ID should remain “above the fray,” as it is concerned with science rather than theology. What the scientific discipline of Intelligent Design can tell us, however, is that the design of life, by whatever process, requires a great deal of specificity – whether in the laws of nature themselves, the initial conditions of the universe, or in an act of Divine intervention resulting in life.
I’d like to conclude by thanking Dr. Sullivan for a lively exchange. Dr. Sullivan’s concluding comments can be found here. I am grateful for the opportunity this exchange has afforded me to sharpen my own views on the origin of life.
149 Responses to Programs, cells and letting God be God (A concluding reply to the Smithy)
Leave a Reply
You must be logged in to post a comment.
Doesn’t teleology smack one in the face simply because of the fact that one can see?
@Phaedros
Not if one has already committed themself to the myopic perspective of materialism, I suppose.
What if there is no dividing line between life & non-life ? What if its a continuum ?
vjtorley very well written article. I followed your argument here very clearly, which I had trouble doing with your last “philosophy” post. But that was my fault not yours since I don’t have any higher education in philosophy to understand your points.
Also Thanks for this very informative link:
Bioinformatics: The Information in Life by Don Johnson
http://vimeo.com/11314902
As well, I think Bill Gates is an agnostic not an atheist:
Excerpt: Bill Gates: In terms of doing things I take a fairly scientific approach to why things happen and how they happen. I don’t know if there’s a god or not, but I think religious principles are quite valid.
http://wiki.answers.com/Q/Is_Bill_Gates_an_atheist
But if one has done that, then they must have reasoned that always, or almost always, x must be the case given y. And isn’t that the very definition of teleology?
I posted this on the wrong topic, my apologies.
http://en.wikipedia.org/wiki/Teleology
Hi bornagain77,
Glad you liked this post. Thanks for the information about Bill Gates, by the way.
I watched Don Johnson’s video presentation last night, and found it very interesting.
I would propose not to be so “scientific” regarding the definition of life. The question is if science is able to analyze “life” – describing it as “program” is quite unique imo.
It reminds me of Dicken’s Hard time where children were taught what a horse scientifically means – a quadruped etc…
Maybe some Goethian approach is needed to complete the perspective.
Percieving life and animals means also emotions, often strong emotions. These are often for us more important than any “programs”.
Describing a poem by counting letters in it and anlyzing it’s words doesn’t help to understand it better.
It was also great Swiss zoologist Adolf Portmann’s opinion and metaphore, that science is like looking behind the scene in the theater. Knowing what is there might be interesting, but it does’t elucidate the play itself.
Regarding Gates and his “opinions” about DNA – I wouldn’t overestimate his opinions what DNA is like or not like.
DNA may serve as a book, or encyklopaedia as well. Firstly you must to know how and where to read. I wouldn’t call an encyklopaedia “program”.
http://cadra.wordpress.com/
vjtorley, there are a couple of very interesting papers in the Don Johnson video:
First this very excellent paper:
A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA – David J D’Onofrio1, Gary An – Jan. 2010
Excerpt: The comparison of functional and structural characteristics of the DNA complex and the computer hard drive leads to a new descriptive paradigm that identifies the DNA as a dynamic storage system of biological information. This system is embodied in an autonomous operating system that inductively follows organizational structures, data hierarchy and executable operations that are well understood in the computer science industry.,,,, It is also important to note that attempting to reprogram a cell’s operations by manipulating its components (mutations) is akin to attempting to reprogram a computer by manipulating the bits on the hard drive without fully understanding the context of the operating system. the idea of redirecting cellular behavior by manipulating molecular switches may be fundamentally flawed; that concept is predicated on a simplistic view of cellular computing and control. Rather, (it) may be more fruitful to attempt to manipulate cells by changing their external inputs: in general, the majority of daily functions of a computer are achieved not through reprogramming, but rather the varied inputs the computer receives through its user interface and connections to other machines.
http://www.tbiomed.com/content/7/1/3
and this one as well:
Survival of the fittest theory: Darwinism’s limits – Jerry Fodor and Massimo Piattelli-Palmarini – Feb 2010
Excerpt: Much of the vast neo-Darwinian literature is distressingly uncritical. The possibility that anything is seriously amiss with Darwin’s account of evolution is hardly (ever) considered. ,,, Natural Selection has shown insidious imperialistic tendencies.
http://www.newscientist.com/ar.....imits.html
Thanks to all, esp vjt and ba77, for thought provoking posts and many excellent links. As I have seen your names on other threads you know I am “hung up” on information at what I hope is a fundamental level. I note the use of “program” in vjt’s post (I will go read all the others and links later and must read yours again, actually) but I still wonder if or why “we” cannot use the term information? Is it really too ambiguous as Seversky has (interminably) claimed? If so can we then speak of language instead? If DNA/RNA are common to every living thing (aren’t they?) then that seems to this amateur like a clear dividing line, if not a workable definition, for what is living/not living. And since, by definition, information/language are linked it seems that the naturalist explanations for I/L can be dismissed because of issues I have prosed on about (interminably). I am being SUMMONED. Not back until tomorrow night. Sorry for the “drive by” nature of this post.
Beautifully written position of ID. Dr. Torley.
I must admit I had not paid a lot of attention to the cause of ID until this recent give-and-take with medieval theology developed. Your considered juxtaposition of these two theistic explanatory approaches has given me a deep respect for ID and yourself.
You have also helped me see that my suspicions of the value in a dogmatic positing of medieval metaphysics has been well placed.
I appreciate you and your thoughts.
Thanks for your work here.
vjtorley:
here is a very interesting quote at the 30.5 minute mark of the Don Johnson video:
“Because of Shannon channel capacity that previous (first) codon alphabet had to be at least as complex as the current codon alphabet (DNA code), otherwise transferring the information from the simpler alphabet into the current alphabet would have been mathematically impossible” Donald E. Johnson – Bioinformatics: The Information in Life
further notes:
the current codon alphabet is anything but simple:
Deciphering Design in the Genetic Code
Excerpt: When researchers calculated the error-minimization capacity of one million randomly generated genetic codes, they discovered that the error-minimization values formed a distribution where the naturally occurring genetic code’s capacity occurred outside the distribution. Researchers estimate the existence of 10 possible genetic codes possessing the same type and degree of redundancy as the universal genetic code. All of these codes fall within the error-minimization distribution. This finding means that of the 10 possible genetic codes, few, if any, have an error-minimization capacity that approaches the code found universally in nature.
http://www.reasons.org/biology.....netic-code
DNA – The Genetic Code – Optimal Error Minimization & Parallel Codes – Dr. Fazale Rana – video
http://www.metacafe.com/watch/4491422
The coding system used for living beings is optimal from an engineering standpoint.
Werner Gitt, – In The Beginning Was Information – p. 95
Collective evolution and the genetic code – 2006:
Excerpt: The genetic code could well be optimized to a greater extent than anything else in biology and yet is generally regarded as the biological element least capable of evolving. http://www.pnas.org/content/103/28/10696.full
Here, we show that the universal genetic code can efficiently carry arbitrary parallel codes much better than the vast majority of other possible genetic codes…. the present findings support the view that protein-coding regions can carry abundant parallel codes.
http://genome.cshlp.org/content/17/4/405.full
The data compression of some stretches of human DNA is estimated to be up to 12 codes thick (Trifonov, 1989). (This is well beyond the complexity of any computer code ever written by man). John Sanford – Genetic Entropy
@Mung
“But if one has done that, then they must have reasoned that always, or almost always, x must be the case given y. And isn’t that the very definition of teleology?”
Good point.
But unfortunately for them they often do not reason. Instead they hold materialism as a priori and simultaneously deny that their ideology is simply an unwarranted belief. They want it both ways.
above @13,
But that is precisely the position of StephenB.
According to him, an atheist is not capable of reason based on the the conclusion the atheist reaches, which says that there is no God.
What we have is the faith-based belief of a theist in direct opposition to the reasoned belief of an atheist.
Following StephenB’s logic, if the final conclusion you reach is the acceptable one, then the arguments you put forth were probably valid.
This is not following the evidence at all.
It is your side which relies on faith and belief, not your opposition.
@toronto
I don’t see StephenB posting in this topic, so I am not sure where you’re going with it really.
But if you are asserting that materialism and atheism do not rely on beliefs and a priori commitments you are sadly mistaken.
However, since you have made such a claim, why don’t you go ahead and prove materialism/atheism for us.
above @15,
Your claim is that we, the opposition/Darwinists/materialists/evolutionists, do not reason. StephenB, in a previous post, has said the same.
In taking this position you are telling our side that there is no point in our presenting evidence in support of our position since you have already determined the only proper conclusion that could be reached by a reasonable person, is your conclusion.
You can change my worldview to yours with a reasoned argument because I do believe you use reason and logic in coming to your conclusions.
There is no evidence that I could present however that could change yours since you don’t believe I am reasonable in coming to my worldview.
StephenB and others have presented this argument before, with StephenB being the clearest.
If our side takes StephenB’s position we could discount any evidence you present on the grounds that you are obviously not reasoning properly.
I don’t want to see that happen.
We should both present our evidence knowing the other side is evaluating the evidence and not the source.
How? What evidence would you consider reasonable coming from a source you consider unreasonable?
bornagain77 (#12)
Thanks very much for the excellent links. There must be a good catalogue somewhere of ID-related articles, specifically related to the program contained in DNA. Is there any catalogue that you’d recommend?
vjtorley, actually I just collect little snippets here and there and have not seen anybody make a concise “catalog” of all the programming in DNA, a bit early I would guess in that functions are still being uncovered at a rapid pace; about the best I’ve seen anybody do as far as listing all the known functional elements of DNA so far has been this brief passage I picked up from Dr. John Sanford’s book – Genetic Entropy:
“There is abundant evidence that most DNA sequences are poly-functional, and therefore are poly-constrained. This fact has been extensively demonstrated by Trifonov (1989). For example, most human coding sequences encode for two different RNAs, read in opposite directions i.e. Both DNA strands are transcribed ( Yelin et al., 2003). Some sequences encode for different proteins depending on where translation is initiated and where the reading frame begins (i.e. read-through proteins). Some sequences encode for different proteins based upon alternate mRNA splicing. Some sequences serve simultaneously for protein-encoding and also serve as internal transcriptional promoters. Some sequences encode for both a protein coding, and a protein-binding region. Alu elements and origins-of-replication can be found within functional promoters and within exons. Basically all DNA sequences are constrained by isochore requirements (regional GC content), “word” content (species-specific profiles of di-, tri-, and tetra-nucleotide frequencies), and nucleosome binding sites (i.e. All DNA must condense). Selective condensation is clearly implicated in gene regulation, and selective nucleosome binding is controlled by specific DNA sequence patterns – which must permeate the entire genome. Lastly, probably all sequences do what they do, even as they also affect general spacing and DNA-folding/architecture – which is clearly sequence dependent. To explain the incredible amount of information which must somehow be packed into the genome (given that extreme complexity of life), we really have to assume that there are even higher levels of organization and information encrypted within the genome. For example, there is another whole level of organization at the epigenetic level (Gibbs 2003). There also appears to be extensive sequence dependent three-dimensional organization within chromosomes and the whole nucleus (Manuelides, 1990; Gardiner, 1995; Flam, 1994). Trifonov (1989), has shown that probably all DNA sequences in the genome encrypt multiple “codes” (up to 12 codes). (Dr. John Sanford; Genetic Entropy 2005)
Here was another level of “coding” found:
Comprehensive Mapping of Long-Range Interactions Reveals Folding Principles of the Human Genome – Oct. – 2009
Excerpt: We identified an additional level of genome organization that is characterized by the spatial segregation of open and closed chromatin to form two genome-wide compartments. At the megabase scale, the chromatin conformation is consistent with a fractal globule, a knot-free, polymer conformation that enables maximally dense packing while preserving the ability to easily fold and unfold any genomic locus.
http://www.sciencemag.org/cgi/.....6/5950/289
Here is a site that gives a clear example of what Dr. Sanford means by Poly-Functional equals Poly-Contrained:
Poly-Functional Complexity equals Poly-Constrained Complexity
http://docs.google.com/Doc?doc.....Zmd2emZncQ
Plus there are other levels of coding that interact with the DNA,,,
—-Toronto: “According to him, [StephenB] an atheist is not capable of reason based on the the conclusion the atheist reaches, which says that there is no God.”
According to StephenB, an atheist typically chooses not to reason because he is fearful about the conclusions he might arrive at if he were to follow reason’s first principles. Thus, they, like you, tend to deny the law of causality if it enables them to avoid drawing conclusions that are not congenial with their inclinations. You got it exactly backwards, but thank you for playing.
I am afraid that the whole concept of DNA == program is a metaphore that more obscures than helps.
First of all – using the metaphore language – we should consider carefully where the computer is if DNA is a program? It must be obviously the cell. It is the cell that “interprets” DNA – after all do not forget that DNA is only an inanimate molecule.
Nowadays even almost 7 year olds are able to wite “a program”. But I am afraid that these “programmers” do not know how computers that run their “programs” really work. He would have to know also quantum physics to understand in depth how semiconductors in computers work.
In this sense the “program” in a computer is the most trivial part.
Assebled programs also means this:
00101001101101101111….
(looks like
ACTCAGCGGCTTACGATTACG…
doesn’t it?)
I am afraid in this case you don’t know where the program and where the data start. Data in binary looks same.
Unless you have uncompiled programm code – or even business requirenment on the program – studying sequenses of 0/1 is only a toil – like studying expression of genes in DNA in action. Of couse you can decipher some chunks of it. But you shouldn’t be so optimistic. Considering all those pleitropy and epistasis you will never be able to obtain the result what genes in their concert do.
Because they are like notes – the orchestra is the most responsible part in the concert – or even the conductor?
http://cadra.wordpress.com/
vjtorley, This short video may interest you:
How DNA Compares To Computer Code – Perry Marshall – video
http://www.metacafe.com/watch/4298072
StephenB @19,
I believe my second reply to “above”‘s response to me, should show where your side is the one that retreats from reason.
I posted it yesterday so please be patient.
Thanks.
@toronto
“If our side takes StephenB’s position we could discount any evidence you present on the grounds that you are obviously not reasoning properly.”
But that is precisely what your side does. In fact, more so than any other political/religious affiliate group I have ever seen. Maybe you haven’t had the displeasure of conversing with militant atheists and nihilists. I unfortunately have. All I have ever heard was the fallacious presumption of atheism and/or an a priori commitment to materialism.
How? What evidence would you consider reasonable coming from a source you consider unreasonable?
You can use whatever evidence or reasonable argumentation you like. Can you prove materialism/atheism?
above @23,
I ask you to carefully read and re-read the following a few times to ensure we understand each other.
1)Since I am an atheist, in your eyes and those of StephenB, I am already incapable of reason because I have reached a different conclusion on the existence of God than you have.
2)Since you consider my reasoning ability deficient, why would you consider any argument I provide?
3)If you engage any person in a debate and tell them they are not reasonable based on the conclusions they have reached, you have implicitly given them the permission to do exactly that to you.
4)This will effectively remove any arguments you provide, not matter how valid they are, from any consideration.
5)Do you believe it is valid for me to ignore any evidence you provide me supporting ID, based on the fact that you believe that there is a God?
—Toronto: “In taking this position you are telling our side that there is no point in our presenting evidence in support of our position since you have already determined the only proper conclusion that could be reached by a reasonable person, is your conclusion.”
The problem is less about presenting evidence to materialist/atheists/Darwinists and more about persuading them to evaluate that evidence in the light of sound reasoning principles. It is incumbent upon reason’s advocates to [a] explain those principles and why they matter, [b] point out that materialists are not currently using them and [c] observe their reaction. If they reject those principles, and so far every atheist I have encountered does reject them [usually after having learned about them for the first time, which should tell you something], then there is no reason to heap layers and layers of new evidence on them because they will interpret all new evidence in the same way that they interpreted the old evidence.
One purpose of utilizing reason’s first principles is to rule out the impossible so that reasonable conclusions may be arrived at. Thus, if I say that nothing can come into existence without a cause, I am ruling out the proposition that something can come from nothing. With that understanding, we can do science, which is, in essence, the search for causes. If the atheist refuses to accept that principle, then, as dialogue partners, we can no longer search for causes in a rational way or even engage in rational scientific discourse. Each time we identify the most likely cause, the materialist/atheist can simply claim that this was one of those instances where the effect just came into existence without a cause. Using that anti-reasoning process, he will conclude that universes can pop into existence without a creator, life can come from non-life, and mind can come from matter.
Atheism is not really an intellectual position at all; it is an emotional and a moral position. From their anti-intellectual vantage point, atheists reject the law of causality because accepting it would take them to a first cause creator, and they find such an idea intolerable. In keeping with that point, they reject the evidence for a finely-tune, carefully designed, universe. “Who needs a fine tuner or a designer, they will ask?” That same universe that popped into existence from out of nowhere also just happend to fine-tune itself. Effects don’t need causes and so the evidence can be interpreted in any old way at all. So, the atheist simply accepts materialism on faith and stays with it in spite of all evidence to the contrary.
After reading your response, I have to say that I find nothing wrong with your reasoning or logic at all.
It is your premises I take issue with.
It’s not any sort of position at all.
While black/white, up/down, right/left can be considered polar opposites, atheism/theism cannot be thought of in that way.
Atheism is an absence of theism.
You are considering atheism as a different version of theism much like comparing Christianity to Judaism.
As an atheist I can tell you firsthand, you are wrong about how an atheist thinks.
@toronto
I don’t understand why you are unecessarily trying to complicate things nor do I understand why you keep conflating what I said with StephenB. What StephenB is saying is a lot more challenging (for you) and goes much deeper than my objection. He clarifies that in his first paragraph of post #25.
You said:
“Since I am an atheist, in your eyes and those of StephenB, I am already incapable of reason because I have reached a different conclusion”
My original post was:
“But unfortunately for them they often do not reason. Instead they hold materialism as a priori ”
My point being that materialism is unwarrantedly held as a priori, not a posteriori as you claim. In light of that disagreement I asked you to prove materialism.
That’s all. Can you prove materialism or not?
above @27,
Here is an example of an “a priori” statement.
It is a generalized assumption about atheists.
Here is a “a posteriori” statement.
“I, Toronto, an atheist, come to my conclusions through a process of reasoning and don’t hold materialism as being true “a priori”.
The second statement is a posteriori to you since I have provided you with actual verifiable information about myself that you didn’t have before I told you.
In the above, there is an implicit declaration that the speaker, (me, Toronto), has used reasoning, since I claim, “..I have reached a different conclusion.”
About this atheism and a priori belief discussions, how would Kant address this? I ask because I was just looking at a video series on his thought.
I am thinking he would be useful to either viewpoint.
—”“I, Toronto, an atheist, come to my conclusions through a process of reasoning and don’t hold materialism as being true “a priori”.
If you do not honor law of causality, you are not arriving at your conclusions through the reasoning process since, as I have pointed out several times, the law of causality is an necessary part of that process. You may be using “a” process {I have no idea what it could be] but it is not the reasoning process.
“Since I am an atheist, in your eyes [above] and those of StephenB, I am already incapable of reason because I have reached a different conclusion”
Neither above nor myself stated that you “cannot” reason properly. We both held that you choose not to reason. There is a big difference.
In keeping with that point, you should, be able to use the reasoning process to perceive that above is making an argument that is compatible with but different from my argument:
He is pointing out that since you cannot provide any evidence to support your notion that naturalistic forces can create information or all life as we know it, you must be operating from a position of faith and not reason. He is right, of course.
I am arguing that because you do not honor the law of causality, you cannot interpret evidence in a reasonble way. I am also right.
In effect, you are, as above has pointed out, conflating the two arguments into one. That in itself is a logical error. If you had not tried to pull in my name to argue against above’s position, you would have been far better off. As it stands, you have failed to address either argument.
—Just Thinking: “About this atheism and a priori belief discussions, how would Kant address this? I ask because I was just looking at a video series on his thought.”
Kant made a serious error that disqualifies him as a dependable consultant on these matters. Google “Little Errors In The Beginning,” by Mortimer J. Adler.
Toronto:
Kindly, read carefully:
Compare the infamous Lewontin remarks of 1997:
_____________________
>> It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, that we are forced by our a priori adherence to material causes to create an apparatus of investigation and a set of concepts that produce material explanations, no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is absolute, for we cannot [and why not, Mr Lewontin?] allow a Divine Foot in the door. [“Billions and Billions of Demons,” NYRB, January 9, 1997. Bold emphasis added.] >>
_____________________
Clearly, “often,” evolutionary materialists are indulging in a priori imposition of materialism, and have begged the question that the only — indeed, routinely — observed source of functionally specific complex information is intelligence.
So, they have set out to block the empirically anchored inference from FSCI in life and in major body plans to evident design of same. Not on scientific facts, but on philosophical question begging.
Worse, when issues have been argued many many times at UD, we find a habitual, typical pattern of such a priorism, and then refusal to accept first principles of reasoning when they point where materialists do not want to go. Not to mention refusal to accept that we do have strong evidence that FSCI is routinely produced by intelligence, and has only been OBSERVED to come form such intelligence. As this very post and thread substantiate among many millions of cases.
This has happened in thread after thread, so “often” is precisely correct.
Why not show us how you will be an exception?
G’day
GEM of TKI
PS: Hi Steve!
kairosfocus, welcome back!
StephenB @30,
From Bruce Waltke And The Scientific Orthodoxy:
How is it possible for me to reason, if according to your own words, I cannot evaluate evidence?
You have presumed, that because I have come to the conclusion that there is no God, I do not believe in the principles of right reason.
What other evidence, besides the fact that I am an atheist, do you have to support your assertion that I cannot evaluate evidence?
Steve
Been busy elsewhere . . .
Toronto-
You can reason because you utilize the principles of reason, but fail to recognize both where those principles come from and what there necessary implications are. In order to deny their necessary outcomes you have to deny reason.
—Toronto: “How is it possible for You have presumed, that because I have come to the conclusion that there is no God, I do not believe in the principles of right reason.”
I based my assessment on the fact that I have never met an atheist who acknowledges the law of causation. Also, I base it on the fact that, when confronted with the point, you declined to affirm that law yourself. If you accepted it, you would have immediately seized on that fact rather than ask me another question. Further, if you are an atheist, you reject the first cause argument which derives from the law of causation. Further still, if you are an atheist, believing that life can come from non life and that mind can come from matter, you reject the corollary to the law of causation, which states that nothing can be in the effect, which was not first in the cause. How many other examples do you need?
—”What other evidence, besides the fact that I am an atheist, do you have to support your assertion that I cannot evaluate evidence?”
You have not provided a rational answer to the argument for a finely-tuned universe.
kairosfocus @32,
Hi kairosfocus,
above said:
If instead he had said, “But unfortunately, ..when.. they reason, they hold materialism as a priori”, I would have been fine with that but he contends that a priori statements have no place in reasoning.
There is nothing wrong with using “a priori” knowledge when you reason. According to “above” however, if you use “a priori” statements as evidence, you are not reasoning.
I have posted a comment to StephenB regarding the Bruce Waltke thread where he said that atheists “cannot” evaluate evidence.
In what way can our side engage yours if you believe we don’t/cannot reason.
If I believed that your side could not reason, I wouldn’t spend any time here.
Phaedros @37,
As odd as this may sound, while I disagree with your conclusion, I have to say that I can’t fault your reasoning.
I’ll have to think about this.
Thanks.
StephenB @38,
The Evo position is that we, (and all life forms), are fine-tuned to the universe. You present as ..evidence.. that we are ..not.. fine-tuned to the universe, the ..fact.. that the universe is fine-tuned to us.
That ..is.. the debate between our sides.
Imagine a transistor biased to half of VCC. It doesn’t know what the power-supply voltage is but it will always bias itself to half of whatever that value is. Does the power supply fine-tune its voltage so that the emitter can sit exactly at half the voltage?
No, it doesn’t have to. It is the circuit that adapts to the value of the power supply voltage.
In other words, the transistor has fine-tuned itself to the power supply, not the other way around.
To Toronto:
Stephen writes, “Further still, if you are an atheist, believing that life can come from non life and that mind can come from matter, you reject the corollary to the law of causation, which states that nothing can be in the effect, which was not first in the cause.”
I will note that in a previous thread even though Stephen repeatedly asserted the above statements about causation, he never explained how he knows that life and mind aren’t present in natural causes – with what criteria and evidence does he differentiate between things that obviously are “present in natural causes”, such as solar systems or tornadoes, and those that aren’t. As far as I recall, he just keeps asserting the same things without explaining further.
@Toronto
“he contends that a priori statements have no place in reasoning”
That is a lie. Never did I make such absurd claim. For you to extrapolate that from what I actually said is ridiculous. I’m sorry.
Furthemore, lewotnin’s quote, which Kairosfocus presented, is exactly what I had in mind.
Toronto:
I see your:
Strawman, resting on an agenda-serving equivocation.
Do you not see the question-begging assumption inserted in this? Or, how you have misinterpreted and thus twisted the words of others?
There is a big difference between self-evident first principles of reasoning and assertions of a priori knowledge that in effect beg the question. A real SET is such that so soon as one denies it, one reduces him or her self to absurdity, i.e. once we understand what it says based on our experience of the world as reasoning persons, we see that it is not only true but must be true. That is, one immediately knows or should immediately know the absurdity of attempted denial.
For instance we can try Royce’s “error exists.” (These days, I often call this warranted credible truth no 1.) We understand what errors are, starting from even before our first classroom days. We will easily see that errors are real. But also on reasoning we see that if we try to deny WCT 1, we must give an instance of it.
So, “error exists” is undeniably true.
But, the sort of a priori evolutionary materialism above — despite Lewontin’s [fallaciously] confident declaration of how it is “self-evident” to most leading practitioners of science — is utterly different from this.
We do not directly know the deep past based on experience or observation. Indeed it is inherently unobservable. We may only examine traces in the present and reconstruct more or less possible or plausible causal explanations. But such — as I pointed out yesterday — is at most an exercise in pre-historical inference to best explanation across competing possible causes. Such competitive explanation arguments must cover the range of reasonable possibilities, and must compare them on adequacy relative to material facts, logico-mathematical and dynamic coherence and explanatory power: elegantly simple i.e. neither simplistic nor an ad hoc patchwork. As ISCID aptly puts it:
Similarly [and with reference to Aleta], that which begins to exist — say, Q — has a causally sufficient reason. That is, there must be some cluster of circumstances and forces P that on coming into existence are sufficient for the emergence of that thing Q. Within P, there often are specific conditions p1, p2, . . . pn, that are necessary. Where P is met Q WILL happen or be sustained. Where one or more of p1, p2, . . . pn are absent, Q CANNOT begin, or cannot be sustained. For instance, oxidiser, heat and fuel are each necessary and jointly sufficient to initiate and/or sustain a fire.
In the key cases in view, origin of life and body plan level biodiversity, we know that we are dealing with self-replicating systems based on digital codes [AGCT etc], and co-ordinatred processing of such codes in molecular nanomachines in the cell and in the developing body. Such — per von Neuman et al — includes:
In this context, parts (ii), (iii) and (iv) are each necessary for and together are jointly sufficient to implement a self-replicating von Neumann universal constructor. That is, we see here an irreducibly complex set of core components that must all be present in a properly organised fashion for a successful self-replicator to exist. [[Take just one core part out, and function ceases: the replicator is irreducibly complex (IC).]. This irreducible complexity is compounded by the requirement (i) for codes, requiring organised symbols and rules to specify both steps to take and formats for storing information, and (v) for appropriate material resources and energy sources.
Immediately, we are looking at islands of organised function for both the machinery and the information in the wider sea of possible (but mostly non-functional) configurations. In short, outside such functionally specific — thus, isolated — information-rich target zones, want of correct components and/or of proper organisation and/or co-ordination will block function from emerging or being sustained. So, once the set of possible configurations is large enough and the islands of function are credibly sufficiently specific/isolated, it is unreasonable to expect such function to arise from chance, or from chance circumstances driving blind natural forces under the known laws of nature. But, of course — while we do not yet have the capacity to build such a universal constructor — we know the routinely observed source of its components and of functionally specific complex organisation and associated information — let’s call this FSCOI — intelligence. And such intelligence or purposeful agency is a matter of our routine experience and observation.
Thus, absent a question-begging Lewontinian a priori commitment to materialism, we know the causally sufficient explanation for the sort of entity we are discussing: intelligence. Such is explanatorily adequate and causally sufficient. Ans, as for Aleta’s question on what is in the effect being in the cause, the required complex information is the classic example of this. A mind is causally adequate to create complex, functionally specific information, but chance plus necessity acting without mind, have no such credible capacity, absent a priori question begging.
(This is why Wm A Dembski and Marks have put up the issue of active information: it is unreasonable to expect that information of the degree of complexity we have in mind, emerges by chance — undirected — contingency, on issues addressed in Abel’s 2009 paper on the universal plausibility bound. These grounds are the same ones that underlie the statistical form of the 2nd law of thermodynamics.)
So, Toreonto, we can see the vast difference between a genuine self evident first principle, which we have every reason to confidently accept as true on pain of absurdity, and question begging assertions of materialism that thrive on censoring out otherwise credible alternative possible explanations, thus turning inference to best explanation into attempted inference to best MATERIALISTIC explanation.
Question-begging closed mindedness is irrational and cannot properly be equated to a priori knowledge or even to an inferred best explanation.
G’day
GEM of TKI
above @43,
above @13,
Here is the part of your statement we should focus on:
“..they often do not reason. Instead..”
Whatever follows “Instead” is the thing that is done instead of reasoning.
Here is an equivalent statement:
“..they often do not play music. Instead they perform bluegrass”
While you may not have meant that, do you see why I would think that based on what you have written?
I hope you understand why I am firm on addressing this statement and some from StephenB.
You take the Evo side and with one brushstroke paint us a group that not only is wrong, but incapable of coming to conclusions that are so obvious to you, in effect claiming there is something wrong with us.
There is nothing wrong with us at all that treating us as equals wouldn’t fix.
There wouldn’t be name-calling, strawmen, or attempts at adult-child lecturing.
What do you say?
kairosfocus @44,
I have been wrong about many things in my life and I may be wrong here.
Every time I have been taught something it was the result of patience and focused guidance.
In order for me to understand you, you will have to focus on the specific point in contention.
When a beginner software student wants to know how to write a comment, it does no good to explain how a linker works.
You are not focusing on the point here.
The point is that I, an atheist, have been charged with the crime of not having the ability to reason.
Who does have the ability to reason?
According to your side of the debate, your side does.
That is the problem.
A blind, deaf man left in a jungle can reason.
He smells some flowers, slowly moves in that direction, crushes some flowers in his hand and then puts his hand on the ground. As the insects climb up into his hand, he eats them.
He has reasoned this out by himself despite not having an education or knowing anything about first causes.
You are focusing on the lower level processes of a logic toolbox instead of the higher level of reasoning.
PS: If you are interested [IYI] onlookers, here is how I draw out the WCT approach to worldview synthesis. A key relevance of this is that scientific research programmes, as Lakatos pointed out, have worldview-embedded cores, with belts of auxiliary ideas, concepts and constructs that more directly engage empirical reality. Those belts in part often armour the core of a research programme from the otherwise telling blows of empirical reality. In this case, IYI, we need to ask ourselves some searching questions on the origin of digital codes, digital programs, algorithms, data structures and the like, then extend this to the case of entities that are self replicating a la von Neumann. (And BTW, IYI, one of the many strawman arguments against Paley is the one that neglects to mention that in Ch 2 of his key essay [which was the foil for Darwin's theorising and speculations . . . ], he addresses the case of self replicating watches, and draws out how they are inherently more complex and functi0nally specific than the well known ordinary kind. [In recent months I have been learning that a LOT of the exchanges across time have been won by secularists and materialists through strawman tactics, up to and including the Inherit the Wind slanderous stereotypes of Secretary of State Bryan and co. That means that Toronto's strawmen above and similar errors in the Weak Argument Correctives -- notice how studiously evo mat advocates like to whistle by the graveyard in the dark. Well, this J'can duppy says: "BOO!" -- are not to be shrugged off as minor problems.])
PPPS: I need to underscore that not all inferring is properly reasonable. And, when one consistently violates or dismisses first and self evident principles of reasoning, one is being utterly irrational. So much so that though one is inferring one is hardly reasoning.
–> I seem to have had a mispost so this is try 2 pardon
—Aleta: “I will note that in a previous thread even though Stephen repeatedly asserted the above statements about causation, he never explained how he knows that life and mind aren’t present in natural causes – with what criteria and evidence does he differentiate between things that obviously are “present in natural causes”, such as solar systems or tornadoes, and those that aren’t. As far as I recall, he just keeps asserting the same things without explaining further.”
Since you were not paying attention during that dialogue, I doubt that you will pay attention now. Anyway, here goes.
The law of causality is not something that is proven by evidence; it is a non-negotiable principle of right reason with which to interpret evidence, as is the law of non-contradiction. One cannot prove first principles because first principles are the things used for proof. We don’t reason TO them; we reason FROM them. (Those of us who choose to reason, I should say).
Of course, atheist/materialist/Darwinists do not even know what I am talking about [nor are they typically interested in learning about it] because they have been steeped in and dedicated to materialist ideology. They have been insulated from the principles of right reason by a culture dedicated to anti-intellectualism.
Science, which is a search for causes, depends on the law of causality. Nevertheless, Darwinists, who think that effects can and do occur without causes, want to dialogue with us about tracking down possible causes of the universe. That would be like trying to solve a murder with someone who thinks that murders can occur without murderers.
—”Aleta: “how he [StephenB] knows that life and mind aren’t present in natural causes”….
Natural causes regulate things as laws; unlike minds, they don’t think about things, nor can they be creative and decide to do things differently.
– “with what criteria and evidence does he differentiate between things that obviously are “present in natural causes”, such as solar systems or tornadoes, and those that aren’t.”
I don’t “differentiate.” Anything in the effect was present in the cause.
Still, you had better huddle with your comrades. Although tornados exist potentially in the conditions that give rise to them, Darwinists think that they “emerge” without a cause. Thus, they allude to that as evidence that some effects do not need causes, and, under the circumstances, there is no logical reason why life cannot “emerge” from non-life. See how that works?
Stephen writes, “Anything in the effect was present in the cause.
Still, you had better huddle with your comrades. Although tornados exist potentially in the conditions that give rise to them, Darwinists think that they “emerge” without a cause. Thus, they allude to that as evidence that some effects do not need causes, and, under the circumstances, there is no logical reason why life cannot “emerge” from non-life. See how that works?”
No Stephen, you are dead wrong – no one (except you, it seems) thinks that “emerge” means “happens without cause.” I can’t even imagine where you have gotten that idea. Can you provide some evidence that some scientist thinks that’s what emergence means?
And I’ll agree that “anything in the effect was present in the cause” – what I am pointing out is that you have offered no reason why you think that life was not present in the causal beginning of the universe but tornadoes were. That’s what I asking you to differentiate between because that is a question you have not addressed.
Aleta
I think you are picking and choosing who you respond to. That is a species of strawman.
In 44 above, I pointed out the implications of the known architecture and logico-mathematical requisites of self replicating entities [as is found in cell based life], after von Neumann.
On inference to best explanation, codes, programs, algorithms, data structures and coordinated implementing machines have one known, routinely observed source. In addition, the implied sea of possible configurations is so vast that a universe of the observed scale working by chance + necessity only across its thermodynamically credible lifespan, would search a far less than astronomically small fraction of the space. That is, we have excellent reason to infer that chance processes and mechanically acting laws on their own are such that the configurations we see in cell based life would be empirically implausible, well beyond the implausibility bound.
So, on inference to best explanation, we see intent and intelligence as the best explanation of the systems in life. Beyond that, the cosmos as a whole similarly shows multi- parameter fine-tuning to support C-chemistry cell based life.
Beyond that we may have metaphysical debates in philosophy to our heart’s content on where that mind is located and what is its ontological status. That is all well and interesting but is irrelevant to the scientific inference to design, and to the inference from the sign to the signified.
Tornadoes are vortices reflective of atmospheric conditions under conditions fairly often met with on earth. They are an implication of the mechanical forces and circumstances of terrestrial planets with conditions as we see around us. So, they are written into the implications of those material factors. Codes, programs, algorithms, data structures and coordinated implementing machinery — per implausibility bound — are not.
And so, unless the cause is adequate to initiate and sustain the effect, there will be no effect.
That is the substance in SB’s remark that no effect happens that is not contained in its cause.
If you wish to overthrow that, you need to overthrow causality. And, that is far harder to do than to dismiss.
And, finally, pardon a direct point: if you wish to dismiss causality, the very fact that you infer to an intelligent cause behind the strings of characters appearing next to SB’s handle, shows your selective hyperskepticism, once your worldview is at stake on a point.
GEM of TKI
kf writes, “Aleta: I think you are picking and choosing who you respond to. That is a species of strawman.”
I, and everyone else here, is free to pick and choose who we want to respond to, and what points we want to respond to. Calling the exercise of that freedom a “strawman” doesn’t even make sense.
Aleta @52, kairosfocus,
I agree with Aleta. Some comments have many diverse points which would require a lot of effort to answer completely.
You seem to imply kairosfocus, that you will specifically answer any question asked of you by anyone.
Is that true?
– –Aleta: -“no one (except you, it seems) thinks that “emerge” means “happens without cause.” I can’t even imagine where you have gotten that idea. Can you provide some evidence that some scientist thinks that’s what emergence means?”
Materialists think that mind “emerged” from matter. If mind comes from matter and is also substantially different from matter, then obviously mind appeared without a cause. If “mind” is not different from matter, then why use the word. I hope that you would not want to be like the illogical epiphenominalists, who try to have it both ways by saying that minds are “different from” matter but, nevertheless “grounded in matter.” The law of non-contradiction rules out any such self-contradictory position.
—“And I’ll agree that “anything in the effect was present in the cause” –
That’s half the battle. The other half is in recognizing that the first cause must be a causeless cause.
—“what I am pointing out is that you have offered no reason why you think that life was not present in the causal beginning of the universe but tornadoes were. That’s what I asking you to differentiate between because that is a question you have not addressed.”
I addressed in the first paragraph @47, but I will get at it from another angle.
On the one hand, the tornado and the initial causes for the tornado are all physical. Thus, nothing totally different from the conditions is coming out of those conditions, meaning that law of causality is not violated.
On the other hand, the law of causality would, indeed, be violated, if the physical laws themselves could be their own cause. According to the law of causality, which you now say you accept, [for the first time?] nothing can be its own cause, including physical laws—especially physical laws. Something outside those laws must cause them. If you accept the law of causality, then you must accept the proposition that a law requires a creator to fashion them. Thus, you can have the law of causality or you can have atheism, but you cannot have both. You have a choice to make.
Aleta:
You know or should know why a strawman argument is a fallacy: one sets up and tries to knock over a convenient caricature of an argument, then announce that one has defeated what one has ducked and explicitly or implicitly distorted.
By failing to address the nature of cell based life in light of the digital coded information system embedded therein, you are playing at strawman tactics.
And, you have still failed to address the issue on the merits, i.e your rhetoric is also distractive. (And indeed the strawman is a species of red herring.)
Worse, you have now falsely accused me of namecalling. I have not merely said your argument was strawmannish, I have pointed out why, and on the strength of he case on the merits you have still not addressed.
Could you kindly show us — with empirically credible evidence, not just so stories — how a von Neumann replicator can plausibly originate by chance and blind necessity in some still warm pond somewhere, or you have said nothing. And if instead, you want to imply that atoms etc are intelligent, you need to justify that in the teeth of the evidence of say statistical thermodynamics that heir behaviour can be credibly explained on chance plus mechanical necessity with a large statistical mass to play with. For instance, temperature is a measure of the average random kinetic or potential energy per degree of freedom per molecule or comparable particle. And the diffusion that grounds solid state electronics is based on statistical behaviour of microparticles. Etc etc.
By contrast, the intelligent is seen in its capacity to “reason, to plan, to solve problems, to think abstractly, to comprehend ideas, to use language, and to learn.”
G’day
GEM of TKI
@StephenB
“I hope that you would not want to be like the illogical epiphenominalists, who try to have it both ways by saying that minds are “different from” matter but, nevertheless “grounded in matter.” The law of non-contradiction rules out any such self-contradictory position. ”
What I personally find even more amusing is the epiphenomenalists, who reject that the mind has causal efficacy (i.e. everything being materialistically deterministic), and then expect the rest of us to take their word for it and accept their position as one reached via reasoning.
kf, I have not accused you of name calling – can’t figure out where you got that from.
And I know what a strawman argument is, and choosing to discuss things with Stephen B and not you is not a strawman argument – it is not even an argument.
I’ll respond to Stephen as soon as I have some time.
Aleta:
“… you have offered no reason why you think that life was not present in the causal beginning of the universe but tornadoes were.”
The question is framed incorrectly.
If there exists an intelligence at the causal beginning of the universe, then life most certainly is “present in the causal beginning” of the universe. So, there is no contention on that point.
The question then becomes, “does life contain in it some effect which is not contained in the tornado?” Furthermore, the question continues, “do either the tornado or life exhibit an effect which is not found in a causal structure which is limited to merely law and chance (which could be equated with “the universe” if it is someone’s premise that the universe = only law+chance).” These two questions will help us analyze the ID debate in terms of causal adequacy; where everything that exists in the effect must also exist in the cause as StephenB has explained above.
- So, let’s examine question #1:
“Does life contain in it some effect which is not contained in the tornado?”
This is simply answered by observing that the tornado contains no communication channel and information processing system where a specific sequence of units are transcribed, sent across a communication channel and are converted into a separate functional machine which aids in reproduction and survivability of the system, whereas life does contain that very process (Yockey, “Origin of life on earth and Shannon’s theory of
communication,” 1999.).
- Now, we can move onto question #2:
“Do either the tornado or life exhibit an effect which is not found in a causal structure which is limited to merely law and chance?”
First, let’s examine the tornado. The answer is simply that the tornado contains both regularity (a vortex) as well as chance components such as magnitude, location, and chance arrangement of particles harnessed by the overarching laws of the system [which creates the vortex]. Regularities and periodicity is defined by law and the rest is left to chance. There is no reason to rule out chance and law, since there is no effect which is not defined by both law and chance.
However, the effect that was used as an answer to question number one makes use of sequences which are correlated to a function. Since chance is partially defined as a lack of correlation, then that functional correlation negates chance on one level. Furthermore, the sequences are extremely improbable, especially when looking at longer proteins such as Titin (in which I have calculated a lower limit value of CSI) and multiple protein systems. Kairosfocus has pointed out many times that finding such systems through an unguided search would require vastly more than the number of bit operations which could have been performed given the age and size of the universe. So chance is ruled out on another level — that of improbability.
Next, we observe that the sequence in question is not defined by the category of causation known as law. Further explanation are here and here
So, we see that life contains an effect which is not entailed in the cause *if we only look at law+chance as a cause.* So, those who state that life “emerges” from an interplay, of vast complexity, between law+chance are being literally illogical since they have abandoned one of the main rules of causation — relating that which exists in an effect to that which exists in a cause — upon which the laws of logic are built.
StephenB
Thanks for the Adler essay. I read it and wish it was easier to follow, but did get many of his points.
Maybe too far off topic, but Adler talks of axioms (like 1st principles I suppose) and as an example says ‘the whole is greater than its parts’. I found this surprising to hear an Aristotelian-Thomist philosopher supporting the existence of emergence – as axiomatic, no less. From other blogs, I was under the impression that this is forbidden talk among A-Ters.
Am I right in assuming that ID is receptive to emergence in the sense of, say, consciousness is an emergent outcome of the brain’s operation? (I am a newbie to ID.)
Just Thinking-
I don’t think it would be true that consciousness is “emergent” from the brain’s operations alone. I think that that would be to say that any mental response to something is only a stimulus-response type relationship. That is not what consciousness does. Of course, stimulus is involved. However, I don’t know how you would explain introspection like that. I don’t think that “the whole is greater than its parts” talk is “forbidden” among A-T thinkers. In fact, that was part of the entire debate between Feser and Torley. Their main complaint, at least from what I could tell, was that ID conceived of life being too mechanistic. That is to say, they felt ID was treating life too reductively and not considering the characteristic of the whole being greater than its parts. I would think that such an attribute is a clear indicator of design in that the parts are fitted in such a way to serve a purpose that is higher than its individual parts.
Aleta:
It seems, alas, I still have to pause to deal with rhetorical issues. You are still not addressing the substantial issue of the von Neumann replicator as the key instantiation of digital, code based, functionally specific complex programming and informaiton in the life of the cell.
In short, you have issues to deal with, not personalities to pick and choose among.
Ducking the material case and pouncing on one facet or phrasing IS a strawman.
And, kindly observe your words in 50 above:
See where you accused me of empty namecalling, now?
And, I must repeat, by latching on to Steve’s phrasing, you failed to address the substance, indeed ended up trying to knock over a caricature.
Worse, all of this is now a distractive side issue, i.e a more generic red herring.
Time to get back on track.
You have a serious issue to address and resolve.
So, let’s call attention back to the original post by professor Torley:
My calling attention to he implications of self replication per the logico-mathematical analysis of von Neumann, as in 44 above, underscores the point and its implications. Implications that ID critics in our experience here at UD are consistently loathe to engage on the merits.
No prizes for guessing why.
Pardon on ruffled feathers (if any), can we get back to the issues?
GEM of TKI
Phaedros:
As someone who has played around with electronics and control systems, I would suggest that the physical instantiation of operations is mechani9cal but5 the architecture and significance of the operations is purposeful and beyond mere mechanics. There is a cybernetic cut in short, and as Leibniz’s mill reminds us, if we spend our time wondering about the forces between gears grinding a way we will miss he architecture and overall informational and purposeful functionality. But, such an architecture can be explored and its wiring diagram with nodes and arcs joined in specific ways, soon implies functional complex specific organisation and information.
This then can be a sign that signifies intelligence without being unduly mechanistic. (And BTW, the Derek Smith model for robots with two tier controllers the i/o control loop and the imaginative supervisory controller that governs the loop in large part on imposing purposeful information to get it to follow a trajectory to a goal, opens up a fresh view. Mechanism does not swallow up the world of the mind, but it can reveal its presence!)
GEM of TKI
kf writes, “You are still not addressing the substantial issue of the von Neumann replicator as the key instantiation of digital, code based, functionally specific complex programming and informaiton in the life of the cell.”
No, that is not a topic I am now, or ever have been, interested in addressing. Just because you wrote about it in a post doesn’t make it a topic that I, or anyone else, is obligated to discuss.
kf writes, “And, kindly observe your words in 50 above:
. . . Calling the exercise of that freedom [to address whomev3r you want] a “strawman” doesn’t even make sense.
See where you accused me of empty namecalling, now?”
Saying you wrote a sentence that doesn’t make sense is not name calling.
—Just Thinking: “Maybe too far off topic, but Adler talks of axioms (like 1st principles I suppose) and as an example says ‘the whole is greater than its parts’.”
Adler’s point is that the whole is greater than ANY ONE of its parts and that fact should be accepted as a first principle of right reasoning. Further, he argues that Kant’s irrational skepticism results from his failure to recognize that obvious first principle. Thus, he is not a good guide on these matters.
It is NOT Adler’s point or a first principle of right reason that the whole is greater that ALL OF THE PARTS. That is something, like emergence, that would have to be argued for.
—”I found this surprising to hear an Aristotelian-Thomist philosopher supporting the existence of emergence – as axiomatic, no less. From other blogs, I was under the impression that this is forbidden talk among A-Ters.”
Adler does not say anything at all about emergence, so I don’t know what you have in mind here. He is certainly not arguing for it, much less is he elevating it to the status of an axiom. I don’t think ID is so scandalized by the word emergence as the fact that people who use the word typically don’t have the slightest idea what they mean by it and, yes, it is often used as a causal substitute for those who would prefer not to acknowledge a first cause.
Stephen writes, “Materialists think that mind “emerged” from matter. If mind comes from matter and is also substantially different from matter, then obviously mind appeared without a cause. If “mind” is not different from matter, then why use the word.”
There are all sorts of things that are “substantially different” than thee context out of which they are arise – that does not mean they are “obviously” uncaused. My guess is that your use of the word “substantially” here contains some circularity that disguises the assertion under discussion: to you, it is “obvious” that mind is “substantially” different than matter and therefore could not arise from matter, and therefore anyone who thinks that mind did arise from matter must believe it happened without cause. But that is just imposing your belief that it couldn’t so arise as a given fact when in fact it is the subject that is at issue.
So really the quote above just again re-asserts your belief that mind (or life ) is not potentially present in the causal history of the universe without offering any arguments as to why that is so – other than it is obvious to you.
And you remark about words is odd. tornadoes arise from storms but are substantially different enough that we have different words for them: this is what words are for – to help us distinguish things that are substantially different. This does not at all mean that one doesn’t causally arise from the other,
—“And I’ll agree that “anything in the effect was present in the cause” –
That’s half the battle. The other half is in recognizing that the first cause must be a causeless cause.
For me, this discussion (which is a continuation of a previous one ) is about what has happened in the universe after it began, and about the idea that the beginning state of the universe contained a great deal of potential things which have causally emerged, including life and consciousness. I’m not interested in mixing this topic with the creation of the universe question.
Aleta:
The cell is at the heart of the issues you raised.
And, I think the astute onlooker will easily see that artfully picking and choosing who you address and what you address, instead of going tot he heart of the issue is precisely a case of strawman tactics. Moreover, you plainly accused me of empty calling of the term strawman, while in fact you were failing to address the real issue on the merits.
In short, sadly, you continue on the course of strawman and red herring tactics.
But, back on the key topic — key since the original post BTW — we have a case where language and code, algorithms, data structures and programs, pre-date not only our form of intelligent life, but the cell itself. For they are embedded in how the cell is built and works and are thus causally prior to it.
So, we have excellent reason on empirically well warranted signs, to infer that life is the product of intelligence.
Going further, the cosmos that is finetuned to support such C chemistry cell based life is also credibly the product of intelligence of awesome power.
All, based on inference to best empirically anchored explanation, not assertion or implication of metaphysically loaded a prioris or assumptions. (And, that is what you were in effect accusing Stephen of.)
GEM of TKI
PS: Onlookers, see why Antony Flew in recent years acknowledged the force of the design inference?
PPS: Also, Adler was in fact describing how we have a class of self evident truths, of which an example is the case of “the axiom or self-evident truth that a finite whole is greater than any of its parts, or that a part is less than the finite whole to which it belongs.” SB is precisely correct to highlight that his is not an advocacy of emergentism. (And besides, as one who has soldered up more than his fair share of circuit boards, the parts, how they are interfaced and linked together give rise to interactions that produce effects that are effects of the whole in action, but that does not either mean that such configurations are likely to emerge by chance, or that the purposeful functionality is not a strong sign of intelligent design, once a rather modest threshold of complexity is passed.
—Toronto: “The Evo position is that we, (and all life forms), are fine-tuned to the universe. You present as ..evidence.. that we are ..not.. fine-tuned to the universe, the ..fact.. that the universe is fine-tuned to us.
That ..is.. the debate between our sides.”
First, let me compliment for stating outright that you are an atheist. You would be surprised how often Darwinists come to this site to tell us what they are not, leaving it to us to discern what they are or could be. So, you get points for transparency.
Now, on to substance. The original question persists: How did the fine tuning of the universe come about? It will not do to say that we fine-tune ourselves to the universe. The question is about the universe, not us.
What does our development or our ability to adapt have to do with the fact that the ratio of electrons to protons in the cosmos will allow for a maximum deviation of one part in ten to the thirty seventh power? Nothing. How could biological evolution influence the expansion rate of the universe, which allows for a maximum deviation of one part in ten to the one-hundred-twentieth power?
And, of course, we still have the law of causality which you seem unwilling to acknowledge, a flaw in first principle reasoning which informs your approach to the fine tuned universe and, in large measure, prompts you to discount the need for a fine-tuner.
Toronto-
“The Evo position is that we, (and all life forms), are fine-tuned to the universe. You present as ..evidence.. that we are ..not.. fine-tuned to the universe, the ..fact.. that the universe is fine-tuned to us.
That ..is.. the debate between our sides.”
You actually mischaracterize a couple of things here I think. The evo position certainly is not that organisms are fine-tuned, but simply that they are minimally tuned to the universe. That would be much more likely given the evolutionary scenario, albeit still incredibly unlikely (impossible almost), than organisms being fine-tuned to the universe as you say. What, instead, we find is that organisms are fine-tuned to their environment and not minimally tuned.
Toronto-
“Imagine a transistor biased to half of VCC. It doesn’t know what the power-supply voltage is but it will always bias itself to half of whatever that value is. Does the power supply fine-tune its voltage so that the emitter can sit exactly at half the voltage?”
Would not the transistor have to be made to be “biased” in such a way? If not, then at least that is just characteristic of it, not something it has adapted itself to do.
Toronto:
You clearly need to look more carefully at the actual finetuning case. (Try here for a simple starter.)
With but slight deviation in any number of parameters, the physical universe would be radically different in ways that would be utterly inhospitable to having enough carbon in the right places for life, or to having carbon at all, or to having galaxies of the right type for us to have galactic habitable zones that balance relative stability and enough “metallicity” to have the heavier elements in enough quantities to have carbon chemistry cell based life. And that is before we get to solar systems and the trouble with off-ecliptic, retrograde orbit hot jupiters that figured prominently in the recent meeting of the RAS. And a lot of other rather special parameters that set up our solar system and make ours a rather privileged planet indeed.
To pick up just one of SB’s examples, the electrostastic force is just as long range as gravity, and is both attractive and repulsive. [Work out the force between two one coulomb charges separated by a kilometer! Remember the nuclear forces are running around at about 10^-14 m or so . . . ] It is also many orders of magnitude stronger. If the numbers of positive and negative particles [P and e] were out of balance by as little as 1 in 10^37, it would wreak havoc with the large scale structure of the cosmos in ways that would hamper formation of the right kind of galaxies that foster solar systems in the zones that would be suitable for c-chemistry life.
So, you have made a mistake. The issue is not our being adapted to the cosmos, but whether c-chemistry cell based life would be possible in a universe with parameters locally close to our own.
GEM of TKI
Phaedros @70,
The point of the analogy is to show that something that is part of an environment is limited in what it can determine about that environment.
The ID side may be right about the existence of an intelligent designer, but an argument like this, the fine-tuning argument, is of no use in trying to prove it since you cannot step outside of the universe to make an objective observation.
A better analogy is someone living in a room with all-steel furniture.
Every day he measures all his furniture with his steel ruler and determines that temperature has no effect on steel as his furniture never seems to shrink or grow.
If someone introduced a wood ruler into his environment, he would see he was wrong.
Also, my comments at 45, 46, and 63 are still in moderation.
PS: Organisms ARE fine-tuned in a different sense, though. We exhibit functionally specific, complex organisation and associated information that creates islands of function in a vast space of possible configurations, which overwhelmingly will be non functional. The requisites for a von Neumann replicator are an excellent illustration of this. And so Denton observes pungently:
__________________
>> To grasp the reality of life as it has been revealed by molecular biology, we must magnify a cell a thousand million times until it is twenty kilometers in diameter [so each atom in it would be “the size of a tennis ball”] and resembles a giant airship large enough to cover a great city like London or New York. What we would then see would be an object of unparalleled complexity and adaptive design. On the surface of the cell we would see millions of openings, like the port holes of a vast space ship, opening and closing to allow a continual stream of materials to flow in and out. If we were to enter one of these openings we would find ourselves in a world of supreme technology and bewildering complexity. We would see endless highly organized corridors and conduits branching in every direction away from the perimeter of the cell, some leading to the central memory bank in the nucleus and others to assembly plants and processing units. The nucleus itself would be a vast spherical chamber more than a kilometer in diameter, resembling a geodesic dome inside of which we would see, all neatly stacked together in ordered arrays, the miles of coiled chains of the DNA molecules. A huge range of products and raw materials would shuttle along all the manifold conduits in a highly ordered fashion to and from all the various assembly plants in the outer regions of the cell.
We would wonder at the level of control implicit in the movement of so many objects down so many seemingly endless conduits, all in perfect unison. We would see all around us, in every direction we looked, all sorts of robot-like machines . . . . We would see that nearly every feature of our own advanced machines had its analogue in the cell: artificial languages and their decoding systems, memory banks for information storage and retrieval, elegant control systems regulating the automated assembly of components, error fail-safe and proof-reading devices used for quality control, assembly processes involving the principle of prefabrication and modular construction . . . . However, it would be a factory which would have one capacity not equaled in any of our own most advanced machines, for it would be capable of replicating its entire structure within a matter of a few hours . . . . Unlike our own pseudo-automated assembly plants, where external controls are being continually applied, the cell’s manufacturing capability is entirely self-regulated . . . . [Denton, Michael, Evolution: A Theory in Crisis, Adler, 1986, pp. 327 – 331. ] >>
____________________
And that carries us right back to the issue at the core of this thread: accounting fr the programs at the heart of the cell, and thus of cell based life.
kairosfocus-
They are also fine tuned in the sense that machines like the flagellum are nearly optimal according physical limits.
—Aleta; “For me, this discussion (which is a continuation of a previous one ) is about what has happened in the universe after it began, and about the idea that the beginning state of the universe contained a great deal of potential things which have causally emerged, including life and consciousness. I’m not interested in mixing this topic with the creation of the universe question.”
The two questions are inseparable. If a tornado emerges out of an ecological situation, someone had to create the conditions for that to happen. If conditions could create themselves, the law of causality would be meaningless. Again, even if human minds could emerge from matter, it could not be the matter that is responsible for the change but rather the agent who set up those conditions. The word “emerge” is a weasel word which seeks to avoid causation while attempting to assume causation’s role. Everything that comes into existence and everything that moves has been caused; the law of causality does not stop at nature’s edge, however much you may wish that it did.
Any physical conditions that allow things to change must also be caused, and all causes hearken back to a first cause that is itself uncaused. Further, anything that undergoes change, must be changed from the outside. If coffee changes from cold to hot, it is becuase the heat from a flame on the outside caused it to change. Nothing can change itself nor can the conditions for change explain themselves.
If you accept the law of causality, then you must acknowledge all those points. But, like most materialists, you affirm causality when it suits you and negate it when it doesn’t.
If the universe is finely-tuned for life, someone had to fine tune it. If matter came into existence at a moment in time, then someone had to create it. Even the atheist scientists who reacted angrily to the discovery of the “big bang” and the beginning of the universe understood this. These are not my “claims,” but points that are easily understood by all rational people. This discussion began when I explained to Toronto that atheism is irrational, and so it is. It is in that context that you intervened, and it is in that context that the discussion continues.
@kairosfocus #59
In the article you linked, In the concluding section you mentioned 4 alleged attempts by materialists to deal with the problem of consciousness. I am specifically interested in hearing your evaluation of the third option of:
” [3] the view that in effect consciousness emerges from but is not reducible to neurological activity [a comparison is made to how heat as a concept may be explained as tracing physically to thermal agitation of molecules, but is conceptually different]”
So basically I am interested to hear your opinion on the validity of that statement. Is the analogy even accurate?
to Stephen: For the sake of discussion, I will accept (because it is indeed a possibility) that the universe was created by a creator who set both the initial conditions and the properties of the original constituent parts of the universe (and by “parts” I mean particles, energies and forces which we now know intermingle to form what we call the physical universe.) I will also accept (because I believe it is true) that from that moment of creation each moment has followed causally from the moment before it.* (* with the proviso that the causal nature of certain phenomena at the quantum level is unknown – I don’t think we should let this distract us.)
Given that, I maintain that life has arisen or emerged as a product of the causal history starting from that original configuration is just the same way that tornadoes have emerged. Each was “present” in the original state of the universe, and each has emerged as the consequences of that original state has unfolded. Emergence is just a word that describes an effect that has new properties because of the interplay, both lawful and contingent, of the contextual state which preceded it.
So, if you want so say that the original creator is responsible for life you must also say the original creator is responsible for tornadoes. However such a statement about the ultimate cause is not very valuable scientifically – it is the chain of proximate, natural causes that we wish to study scientifically.
You say, “If the universe is finely-tuned for life, someone had to fine tune it. If matter came into existence at a moment in time, then someone had to create it.”
OK, if the universe is fine-tuned for life, why do you then declare that life was not “present in the cause.” If the universe is fine-tuned for life, why not accept that life is a natural consequence of the beginning state?
Hello Aleta,
Re: your question about the difference between a tornado and life as it pertains to “an effect not containing something that wasn’t present in its cause,” I have already provided an answer in my comment # 58.
Hi CJ. I skipped over that post earlier because I was focusing on my response to Stephen – I have to find little holes in my day to have time to do this at all. I noticed some interesting points in your post, and will try to find time to respond.
in response to CJYman at 50:
CJ does address with some specificity the issues that Stephen merely makes assertions about, so I will comment on points being made by both.
CJ outlines the standard ID position: that mere law and chance can account for tornadoes but that law and chance cannot account for life, and therefore presumably there is some other type of cause (design) that is active in the universe, at least periodically, and perhaps some other type of non-material “stuff”.
However the arguments CJ makes for this point are points that are quite under contention, and ones which I and many others have pointed out as flawed.
So when Stephen says “emerged” means the same as “uncaused” he really is saying that he doesn’t believe that natural causes are sufficient to explain the phenomena in question. However it is an inaccurate, and intellectually unfair, characterization of those that believe that life has emerged from natural causes to claim that we think life is uncaused. We believe that there are causes for the phenomena in question, and just because Stephen doesn’t agree doesn’t justify claiming that we are invoking an effect without a cause.
As to the specific arguments offered by CJ as to why one would think “law and chance”, that is the natural processes of the physical world, are insufficient to account for life, counter-arguments as to why those arguments are flawed have been made widely, and often.
The two most basic counter-arguments are:
1. All calculations of how improbable certain things are, such as strings of base pairs, are based on the “pure-chance” hypothesis that the component parts came to together simultaneously and entirely by chance. Since no scientist believes this is what happened, such improbability calculations are irrelevant: they just show that life didn’t arise by pure chance, and we all agree on that.
The common response to this point is “then show us life did arise.” My answer is that we don’t know (that we do know some things about parts of the puzzle), and chance are high we will never have a satisfyingly complete explanation. That, however, doesn’t make the ID arguments any stronger.
2. CJ then writes, “Next, we observe that the sequence in question is not defined by the category of causation known as law.”
The mistake here is to think there is some one law that explains the pattern under question (DNA, proteins, or whatever), but again there is no scientist who believes that such a thing would need to exist to explain life, any more than there is a law that explains tornadoes.
However life arose, it arose in the context of many laws manifesting themselves through the behavior of vast numbers of particles and forces over long periods of time with very many contingent (chance) interactions, and through the creation of intermediate steps which, once formed, tended to persist. This same general description of how complex things form applies equally well to tornadoes.
So dismissing the emergence of life or its components by showing that it couldn’t have arisen by pure chance, or that there is no law that explains it, are flawed arguments because they are based on unrealistically simplistic models of causation.
Interesting, CJ concludes by returning to Stephen’s mistake.
CJ writes, “So, we see that life contains an effect which is not entailed in the cause *if we only look at law+chance as a cause.* So, those who state that life “emerges” from an interplay, of vast complexity, between law+chance are being literally illogical since they have abandoned one of the main rules of causation — relating that which exists in an effect to that which exists in a cause — upon which the laws of logic are built.”
No, “we” do not “see that life contains an effect which is not entailed in the cause *if we only look at law+chance as a cause*”, and therefore I, as one who is claiming that life emerges from natural process, am not being illogical. The arguments that life must have some cause other than natural processes are flawed – based on unrealistic and simplistic models of causality in the physical world, and thus the conclusion that life contains an effect not present in natural causes is unfounded.
Aleta-
“The mistake here is to think there is some one law that explains the pattern under question (DNA, proteins, or whatever), but again there is no scientist who believes that such a thing would need to exist to explain life, any more than there is a law that explains tornadoes.”
That is, in fact, what they do believe. I fear you may be misinformed or ignorant of the state of affairs concerning this issue.
I don’t believe that “that is, in fact, what they do believe”, and I am fairly well informed. Can you offer a source – an article or book, etc., and a quote from some scientist who thinks that there is some one law that would explain DNa, proteins, or whatever rather than those things being the product of a long interplay of laws?
—Aleta: “The arguments that life must have some cause other than natural processes are flawed – based on unrealistic and simplistic models of causality in the physical world, and thus the conclusion that life contains an effect not present in natural causes is unfounded.”
It is not unfounded for several reasons. I will just list three:
{a} The first cause cannot be a “potential” anything; it must already be. If cannot be life on the way to becoming, it can only be life itself.
{b} Second, the first cause could not be a set of conditions, because a set of conditions cannot choose to create or not create. Conditions or impersonal laws can only do what they do. They cannot choose to do anything else. The first cause, as life, must be able to choose to create life.
{c}, the first cause would have to be a causeless cause. A condition or a set of circumstances cannot be a causeless cause. The causeless cause must contain the powers of life, intellect, and will, which means that it must be an intelligent agent. An intelligent agent cannot be a set of conditions.
Above:
Re, 76: “I am interested to hear your opinion on the validity of that statement. Is the analogy even accurate? ”
Heat and temperature are indeed physical effects of molecular level behaviour, based on chance circumstances and the mechanical forces of collisions etc. But this is far removed from our experience of ourselves as freely choosing and logically reasoning.
If our thoughts, decisions, reasoning etc are to be vie3wed as produced and controlled by underlying basically physical forces, it undermines the world of thought decisively. In other words, we see here materialistic reductionism and the absurdities that stem from it.
The analogy is utterly inappropriate, cf here in the same section.
Similarly, I have pointed out from 44 on — observe how in 80 Aleta again studiously and strawmannishly avoids discussing the implications of the von Neuman self replicator and codes, programming and coordinated execution in the cell — trhat the evidence is that to have self replicating life based on c chemistry cells, we have language, algorithms and organised coordinated entities that execute such meaningful programs. So, we have direct and observable evidence that we see in the foundation of life itself phenomena that have only one known, indeed routinely observed cause.
Namely, intelligent agents. That is, the mind in action.
GEM of TKI
StephenB said:
=================================
“Materialists think that mind “emerged” from matter. If mind comes from matter and is also substantially different from matter, then obviously mind appeared without a cause. If “mind” is not different from matter, then why use the word. I hope that you would not want to be like the illogical epiphenominalists, who try to have it both ways by saying that minds are “different from” matter but, nevertheless “grounded in matter.” The law of non-contradiction rules out any such self-contradictory position.”
==================================
I counter:
Materialists think that traffic “emerged” from vehicles. If traffic comes from vehicles and is also substantially different from vehicles, then obviously traffic appeared without a cause. If “traffic” is not different from vehicles, then why use the word. I hope that you would not want to be like the illogical epiphenominalists, who try to have it both ways by saying that traffic is “different from” vehicles but, nevertheless “grounded in vehicles.” The law of non-contradiction rules out any such self-contradictory position.
Hmm….
StephenB also said:
==========================
First, let me compliment for stating outright that you are an atheist. You would be surprised how often Darwinists come to this site to tell us what they are not, leaving it to us to discern what they are or could be. So, you get points for transparency.
=========================
I had to chuckle at this. StephenB, what do you think the word ‘atheist’ means? Hint: the clue is in the ‘a’.
fG
StephenB said “Kant made a serious error that disqualifies him as a dependable consultant on these matters. Google “Little Errors In The Beginning,” by Mortimer J. Adler.”
I am watching another Kant vid. http://fora.tv/2008/03/13/Keit.....ullprogram
I highly recomment it to you and all IDers (especially Part 10 if pressed for time).
With an ally like this, why would anyone prefer Adler?
Stephen, all your comments were about the first cause, by which I presume you mean the creator of the universe itself. That’s not relevent because I’m talking about what has happened after the universe began.
With all sorts of things “conditions” transition from a state of non-A to A. Gases condense into planets (non-planet becomes planet), storms transition into tornadoes, and chemical processes transition into life. The gases don’t choose to become planets, and non-life didn’t choose to become life.
So none of your three points in 83 pertain to the comments I made about simplistic and unrealistic models of causality.
Re Aleta, 80:
1 –> This is again unfortunately strawmannish,by picking and choosing what phrases and persons are responded to, as opposed to addressing he issue squarely on the merits.
2 –> As a physicist, I can assure onlookers that known physical forces and chance circumstances do account for tornado dynamics. But, as a philosphical thinker, and as linked earlier this morning, trying to reduce mind and intelligence to law plus chance notoriously ends in self-referential absurdity.
3 –> Now, too, as I have repeatedly pointed out since 44 and as has been just as consistently ducked, cell bas3ed life manifests the von Neumann self replicator pattern, thus functional, specific, complex information in the form of digital [symbolic] codes, programs, algorithms, data structures etc.
4 –> I have also pointed out that such entities have one known, routinely observed source: intelligent design.
5 –> Further to this, we can show why chance circumstances and blind mechanical necessity are not credible sources for such FSCI, on the gamut of our observed cosmos across its thermodynamically credible lifespan [about 50 mn times the usual estimated time since the big band, 13.7 BY]. Namely, the number of discrete operations possible in such a cosmos are something like 1 in 10^150 of the configs specified by just 125 bytes, which is utterly too small for a self replicator. [Cells,as known replicators, start out at 300 - 500,000 4-state elements, i.e. 600 - 1,000 kilo bits; orders of magnitude beyond the threshold just discussed.]
6 –> Now, design is not a mere possibility, for intentionally directed purposeful contingency or organisation of components towards a goal or function is a routine fact of life, as common as posts in this thread that exhibit contextually responsive text in English. So, we have yet another strawman in the above here.
7 –> Notice yet another strawman — one laced with appeals to anti-supernaturalist prejudice — at no stage in the discussion to this point have we assumed or asserted a metaphysical a priori non-physical entity.
8 –> Instead, so far we are doing a classically scientific exercise: observing empirically grounded patterns of cause-effect and typical causal factors, chance, necessity and intelligence, towards identifying signs of each and towards inference to best explanation on empirical evidence. (Cf remarks and diagram here.)
9 –> On observing the cell, we see that it shows what we may conveniently abbreviate as FSCI, which is indisputably routinely — and in our massive observation [now up to Zettabytes], only — produced by intelligence. (Notice that for all the triumphalistic dismissals on “flaws” objectors are consistently unable to show a reliable empirical case of FSCI occuring by blind mechanical forces and chance circumstances, i.e. by lucky noise.)
10 –> So, we need t6o ask WHY the inference form FSCI as empirically reliable sign to intelligent design of a system embedding complex, functionally specific digital codes, algorithms, data structures and programs, is being objected to and under contention, and just what “flaws” are in it, beyond the inevitable provisionality and openness to correction of empirically based scientific inference.
10 –> And, the answer is, as the above thread plainly sho0ws, that it does not fit with a dominant school of thought that too often rests on a priori materialism.
11 –> Let us therefore remember, Lewontin’s candid remarks:
______________
But, plainly imposed materialistic metaphysical a priorism on the part of the evolutionary materialists does not constitute real flaws on our part, Aleta. And, picking and choosing phrasings and persons for rhetorical convenience on your part does not constitute a proper cogent addressing of major issues on the merits that shows flaws on our part.
GEM of TKI
PS: JT — h’mm is this the former Junkyard Tornado? — to cite Adler on a case where he is manifestly right is not to infer that he is right on all things he has said. Instead ofg addressing personalities, why not address the siiue of self evident first principles of reasoning and knowing? For instance, is it fair to point out from Royce et al that “”error exists” is undeniably trrue on pain of self referential absuridity? If so, we have demonstrasted the existence of the class of self evident truths of understanding. And, that there is truth in the sense of what says of that which is tat it is and of what is not that it is not. Similarly, as WCT 1 is credibly warranted, we have knowable and undeniable truths that are self-evident. Such is more than adequate to break up Kant’s dichotomy, as Adler pointed out in tghe previously linked essay.
Aleta if I may ask, what is the known cause now in operation sufficient to give rise to the information we find in life?
The DNA Enigma – Where Did The Information Come From? – Stephen C. Meyer
http://www.metacafe.com/watch/4125886
StephenB @75,
If however, the universe is NOT finely-tuned for life, no one had to fine tune it.
Bornagain, read the part beginning “The two most basic counter-arguments are:” in my post 80 above for answers to your question.
Aleta, if you believe material processes can create information though no one has ever observed this happening, and you believe you are being rational in holding such a position, do you “mind” falsifying Abel’s null hypothesis:
The Capabilities of Chaos and Complexity: David L. Abel – Null Hypothesis For Information Generation – 2009
To focus the scientific community’s attention on its own tendencies toward overzealous metaphysical imagination bordering on “wish-fulfillment,” we propose the following readily falsifiable null hypothesis, and invite rigorous experimental attempts to falsify it: “Physicodynamics cannot spontaneously traverse The Cybernetic Cut: physicodynamics alone cannot organize itself into formally functional systems requiring algorithmic optimization, computational halting, and circuit integration.” A single exception of non trivial, unaided spontaneous optimization of formal function by truly natural process would falsify this null hypothesis.
http://www.mdpi.com/1422-0067/10/1/247/pdf
http://mdpi.com/1422-0067/10/1/247/ag
As far as me demonstrating that a mind can generate information, I have given you a clear demonstration of 100% certainty that a mind can and does generate information simply by writing this post. Though many would probably question the quality of the information generated by my mind at least I can take pride in the fact that I have exceeded what is possible for the material universe over the entire history of the universe:
notes:
This “universal limit” for functional information generation is generously set at 140 Functional Information Bits (Fits) by Kirk Durston whereas a single page of a letter exceeds 700 function bits.
Functional information and the emergence of bio-complexity:
Robert M. Hazen, Patrick L. Griffin, James M. Carothers, and Jack W. Szostak:
Abstract: Complex emergent systems of many interacting components, including complex biological systems, have the potential to perform quantifiable functions. Accordingly, we define ‘functional information,’ I(Ex), as a measure of system complexity. For a given system and function, x (e.g., a folded RNA sequence that binds to GTP), and degree of function, Ex (e.g., the RNA-GTP binding energy), I(Ex)= -log2 [F(Ex)], where F(Ex) is the fraction of all possible configurations of the system that possess a degree of function > Ex. Functional information, which we illustrate with letter sequences, artificial life, and biopolymers, thus represents the probability that an arbitrary configuration of a system will achieve a specific function to a specified degree. In each case we observe evidence for several distinct solutions with different maximum degrees of function, features that lead to steps in plots of information versus degree of functions.http://genetics.mgh.harvard.ed.....S_2007.pdf
Evolution vs. Functional Proteins – Doug Axe – Video
http://www.metacafe.com/watch/4018222
The Case Against a Darwinian Origin of Protein Folds – Douglas Axe – 2010
Excerpt Pg. 11: “Based on analysis of the genomes of 447 bacterial species, the projected number of different domain structures per species averages 991. Comparing this to the number of pathways by which metabolic processes are carried out, which is around 263 for E. coli, provides a rough figure of three or four new domain folds being needed, on average, for every new metabolic pathway. In order to accomplish this successfully, an evolutionary search would need to be capable of locating sequences that amount to anything from one in 10^159 to one in 10^308 possibilities, something the neo-Darwinian model falls short of by a very wide margin.”
http://bio-complexity.org/ojs/.....O-C.2010.1
Mathematically Defining Functional Information In Molecular Biology – Kirk Durston – short video
http://www.metacafe.com/watch/3995236
Intelligent Design: Required by Biological Life? February 19, 2008
K.D. Kalinsky
Excerpt: It is estimated that the simplest life form would require at least 382 protein-coding genes. Using our estimate in Case Four of 700 bits of functional information required for the average protein, we obtain an estimate of about 267,000 bits for the simplest life form. Again, this is well above Inat and it is about 1080,000 times more likely that ID could produce the minimal genome than mindless natural processes. Again, if one wishes to explain the origin of the simplest life form by natural selection, a fitness function will be required that is capable of generating 267,000 bits of functional information, well into the area that requires intelligent design.
http://www.newscholars.com/pap.....rticle.pdf
The Universal Plausibility Metric (UPM) & Principle (UPP) – Abel – Dec. 2009
Excerpt: Mere possibility is not an adequate basis for asserting scientific plausibility. A precisely defined universal bound is needed beyond which the assertion of plausibility, particularly in life-origin models, can be considered operationally falsified. But can something so seemingly relative and subjective as plausibility ever be quantified? Amazingly, the answer is, “Yes.”,,,
c?u = Universe = 10^13 reactions/sec X 10^17 secs X 10^78 atoms = 10^108
c?g = Galaxy = 10^13 X 10^17 X 10^66 atoms = 10^96
c?s = Solar System = 10^13 X 10^17 X 10^55 atoms = 10^85
c?e = Earth = 10^13 X 10^17 X 10^40 atoms = 10^70
—————-
Information – What it is really? – video
http://www.youtube.com/watch?v=WytNkw1xOIc
Aleta:
Now that my emergency with a client is paused for the moment, let me take up your two main objections in 80:
>> 1. All calculations of how improbable certain things are, such as strings of base pairs, are based on the “pure-chance” hypothesis that the component parts came to together simultaneously and entirely by chance.>>
You simply have not read the discussion above or in the linked or in the weak argument correctives. For you will see that no probability calculations have been offered — never mind that there are excellent statistical thermodynamics reasons to start from the hypothesis of equiprobability of individual microstates of a given macrostate — but instead an assessment of degree of searchability of a configuration space. Once we are past about 500 – 1,000 bits or the equivalent of information storage, the universe does not have the configurational resources to scan a fraction of the accessible configurations that is materially different from zero.
If you cannot have enough time and resources and fast enough action steps to search the haystack [and we are using Planck-time steps, of order 10_44s, where the fastest chemical processes (not relevant to organic chemistry which is much slower) are of order 10^-15 s!], the needle is effectively lost beyond recall, unless you are willing to appeal to blind luck beyond all plausibility, thousands of times over, to get to the origin of life and major body plans.
In short, you are appealing to the materialist equivalent of miracles [and without a credible causal force for said miracles], and are using a distractive strawman to help you in rejecting the empirically well established inference that functionally specific complex organisation and associated information are reliable signs of intelligent causal action.
What has been discussed — in slightly more details [cf linked discussion here on in the UD weak argument correctives . . . ] — is that the whole observed universe, acting on chance + necessity only, is not capable of searching out as much as 1 in 10^150 of the configurations of just 125 bytes of information. But, we routinely and reliably observe such FSCI being created by intelligent agents, tot he point where — absent evolutionary materialism not being at stake — it is utterly uncontroversial that we infer from FSCI [e.g. posts in this thread] to intelligent causation.
125 bytes is uttrerly too small for a von Neumann rpelicator, but the threshold suffices to show that the notion of hill-climbing from initial functionality to optimal funciton through random variation and environmental culling is question-begging.
In particular neither at the origin of life nor the origin of major body plans do you have a credible mechanism for the spontaneous origin of a c-chemistry von Neumann replicator of a given general type.
As was shown from 44 on, such a VNR is irreducibly complex, as without the organised components fully integrated and coordinated, it cannot work. So, your all at once objection is a disguised admission of failure.
And if there is a law of nature and associated forces and circumstances — or a cluster of such laws, forces and circumstances [what "dynamics" is about] — that in effect “spontaneously” triggers emergence of such vNRs in still warm ponds once conditions are right, that would imply a degree of finetuning of our cosmos that points straight to design.
That is, it would be a proof that nature is PROGRAMMED.
>>2. CJ then writes, “Next, we observe that the sequence in question is not defined by the category of causation known as law.”
The mistake here is to think there is some one law that explains the pattern under question (DNA, proteins, or whatever), but again there is no scientist who believes that such a thing would need to exist to explain life, any more than there is a law that explains tornadoes. >>
Strawman.
Notice, CJY is discussing law in general, i.e he is taking in the gamut of dynamics on initial circumstances of physical entities, forces and associated laws of necessity or statistical behaviour that would generate a dynamical process. So, he is not at all speaking of any one law, or even a cluster of laws, but the whole category of necessity and chance jointly considered in a dynamical situation. In that context, he is correctly observing that for instance functional programs using digital codes and expressing data structures and algorithms are not within the empirically credible reach of such chance plus blind necessity; on the gamut of our observed cosmos.
That is, CJY, SB, myself and others have been discussing dynamics, where we observe that situations are credibly explained on causal factors tracing to combination of chance, mechanical necessity and agency. The number of particular laws, forces, and circumstantial conditions at initiation are irrelevant to and distractive from the actual issue: chance plus necessity are insufficient to credibly account for FSCI on the gamut of our observed cosmos. And in the case of vNRs, that is doubly so as they are irreducibly complex.
Moreover, codes, algorithms and data structures are inherently cognitive and linguistic elements. They may be impressed on information bearers such as voltages, magnetisation states, etc, but they are using these as we use paper to carry inked in glyphs.
Paper and ink and quill feathers do not explain Shakespeare’s sonnets, and DNA chemistry does not explain the code based, algorithmic, data structure using coordinated structures and systems exposed by microbiologists and biochemists, etc. in recent decades.
G’day
GEM of TKI
Shoot Aleta, if you refuse to falsify Abel’s null hypothesis because you find it “beneath your dignity”, how about just proving your materialistic philosophy, upon which all your evolutionary conjectures are based, is true in the first place. i.e. please show the formal proof why materialism should be considered true from a investigative starting point.
Uncertainty Principle – The “Non-Particle” Basis Of Reality – video and article
http://www.metacafe.com/watch/4109172
http://plato.stanford.edu/entries/qt-uncertainty/
“Atoms are not things”
Werner Heisenberg
Why Quantum Theory Does Not Support Materialism – By Bruce L Gordon:
Excerpt: Because quantum theory is thought to provide the bedrock for our scientific understanding of physical reality, it is to this theory that the materialist inevitably appeals in support of his worldview. But having fled to science in search of a safe haven for his doctrines, the materialist instead finds that quantum theory in fact dissolves and defeats his materialist understanding of the world.
http://www.4truth.net/site/c.h.....ialism.htm
shoot aleta we can’t even find over 95% of the universe:
Dark Energy 72.1%
Exotic Dark Matter 23.3%
Ordinary Dark Matter 4.35%
Ordinary Bright Matter (Stars) 0.27%
Planets 0.0001%
of note: The inventory of the universe is updated to the second and third releases of the Wilkinson Microwave Anisotropy Probe’s (WMAP) results in 2006 & 2008; (Why The Universe Is The Way It Is; Hugh Ross; pg. 37)
REPORT OF THE DARK ENERGY TASK FORCE
The abstract of the September 2006 Report of the Dark Energy Task Force says: “Dark energy appears to be the dominant component of the physical Universe, yet there is no persuasive theoretical explanation for its existence or magnitude. The acceleration of the Universe is, along with dark matter, the observed phenomenon that most directly demonstrates that our (materialistic) theories of fundamental particles and gravity are either incorrect or incomplete. Most experts believe that nothing short of a revolution in our understanding of fundamental physics will be required to achieve a full understanding of the cosmic acceleration. For these reasons, the nature of dark energy ranks among the very most compelling of all outstanding problems in physical science. These circumstances demand an ambitious observational program to determine the dark energy properties as well as possible.”
http://jdem.gsfc.nasa.gov/docs.....report.pdf
Whereas Aleta I can show that “non-material”, and conscious, infinite information inhabits the “primary reality” that can be inhabited:
i.e. —
hypothetically traveling at the speed of light in this universe would be instantaneous travel for the person going at the speed of light. This is because time does not pass for them, but, and this is a big but; this “timeless” travel is still not instantaneous and transcendent to our temporal framework/dimension of time, i.e. Speed of light travel, to our temporal frame of reference, is still not completely transcendent of our framework since light appears to take time to travel from our perspective. In information teleportation though the “time not passing”, eternal, framework is not only achieved in the speed of light framework/dimension, but also in our temporal framework/dimension. That is to say, the instantaneous teleportation/travel of information is instantaneous to both the temporal and speed of light frameworks/dimensions, not just the speed of light framework. Information teleportation/travel is not limited by time, nor space, in any way, shape or form, in any frame of reference, as light is seemingly limited to us. Thus “pure information” is shown to be timeless (eternal) and completely transcendent of all material frameworks/dimensions. Moreover, concluding from all lines of evidence we have now examined; transcendent, eternal, infinite information is indeed real and the framework in which It resides is the primary reality (highest dimension) that can exist, (in so far as our limited perception of a primary reality, highest dimension, can be discerned).
etc.. etc.. etc..
ba, I have no idea why you presumed that my lack of response to you is because I found it “beneath my dignity”, and I don’t know why you found it necessary and/or useful to make such a statement.
You write, “how about just proving your materialistic philosophy, upon which all your evolutionary conjectures are based, is true in the first place. i.e. please show the formal proof why materialism should be considered true from a investigative starting point.”
There is no formal proof that materialism is true any more than there is a formal proof that any other metaphysical belief system is true. My support of materialism is based on experience and evidence – I see that examining physical causes and finding explanations for how the world works in terms of those causes has been successful in many ways, and I find that metaphysical explanations are quite varied without there being any way to investigate which of them are truer than others. This latter fact makes me think that beliefs about things other than the material world are stories people have invented to try to deal with the fact that there is much we cannot know. I respect highly this aspect of humanity, but I don’t think it is about truth in the same way material explanations are.
Keith Ward – same theologian as I linked to on Kant – says consciousness IS emergent from nature. http://www.youtube.com/watch?v.....&NR=1
P S
If you listen to all six parts, you see Ward defends DesCartes and says Rene is not a dualist, but a monist as was Spinoza.
Aleta
Actually there is credible reason to hold that evolutionary materialism is necessarily false on self referential incoherence. Cf here for one simple summary of why.
GEM of TKI
Aleta:
I see your:
This is simply false and ill informed.
Worse, once we climb up to the research programme level, as Lakatos pointed out, scientific research programmes, att heir core become worldview — i.e. metaphysically — deeply and inextricably embedded. So, learning to use comparative difficulties across factual adequacy, coherence and explanatory power is a challenge that serious scientists cannot responsibly duck.
I suggest you start here and here, to see that we all have worldviews and that we have means of assessing which are more/less credible relative to canons of reasonable warrant.
GEM of TKI
Aleta, as has been exhaustively pointed out to you in this thread, it does not follow logically for you to claim integrity of causal adequacy, for your reasoning, if you only choose what you prefer to be true from a a-priori metaphysical commitment to materialism. You must prove your metaphysical claim first! That you would claim proof for materialism, from what you “observe”, though you have offered ZERO “observations” of purely material processes ever generating functional information, and all the while generating functional information with your mind in your response to me, should be the very definition of absurd we find in dictionaries. As to see that this has been gone through with you with a fine tooth comb by many UDers and have you still refuse to relinquish your blindness to the matter, gives me no hope to make you “see” otherwise. I will leave that to others with more patience than I.
Keith Ward saying evolutionary theory originated with Hegel as progressivist idealistic theism which was accepted by Darwin’s father or grandfather.
http://vimeo.com/10285289
Aleta, There is a formal proof that the metaphysical claims of Theism are true IF you demand causal adequacy for your explanations. Yet you do not demand as such. In fact you demand that materialism be exempt from causal adequacy, within the scientific method, just so as to protect it from falsification. Thus it is pointless to present a formal proof of Theism to one, such as you, who sees no problem with allowing such a personal philosophical biases to overrule reason.
Of course we all have worldviews. All worldviews contain beliefs that are not confirmable in the same way that empirically-based beliefs about the material world are, but are chosen by us to meet other needs. Having such affirmed beliefs is an important, and inescapable part of being human.
However, the sheer variety of such beliefs is powerful evidence that such beliefs are not of the same kind as beliefs about the physical world.
Given that I have quite a bit of education in religion and belief systems, I don’t think I am ill informed about this.
Aleta:
You need to get5 back to the point. Above, you affirmed that “I find that metaphysical explanations are quite varied without there being any way to investigate which of them are truer than others.”
This is a global, radically relativist claim. And it is manifestly and obviously wrong to anyone who has taken time to think seriously about the significance of comparative difficulties analysis on worldviews, and especially so to those of us who have taken time to look at the issue of self evident truths and first principles of right reason.
There are definite ways and means for seeing which core worldview claims are more or less reasonable by virtue of factual adequacy coherence and explanatory power.
As a rule, on much experience, those who, on claiming to have been educated in relevant subjects, refuse to use those tools, show that they are for whatever reason trying to stick with views that have less warrant. Indeed, radical relativism is exactly one of the views that is self referentially incoherent. And that has been well known since Socrates, Plato and Aristotle.
Why not start with the exchange in The Laws, Bk X, as that is the first major record of a philosophical discussion on the serious design inference, and of evolutionary materialism and radical relativism and of amorality. Notice the context of comparative difficulties analysis, starting with how Plato sets aside the mythological paganism of Athens [thus ruling out many strawmen], then gets tot he real issues
Let me get the ball rolling, with an excerpt:
_____________________
>>Ath. At Athens there are tales preserved in writing which the virtue of your state, as I am informed, refuses to admit. They speak of the Gods in prose as well as verse, and the oldest of them tell of the origin of the heavens and of the world, and not far from the beginning of their story they proceed to narrate the birth of the Gods, and how after they were born they behaved to one another. Whether these stories have in other ways a good or a bad influence, I should not like to be severe upon them, because they are ancient; but, looking at them with reference to the duties of children to their parents, I cannot praise them, or think that they are useful, or at all true. [[Notice Plato's own carefully stated skepticisms and moral concerns regarding classical paganism.] Of the words of the ancients I have nothing more to say; and I should wish to say of them only what is pleasing to the Gods. But as to our younger generation and their wisdom, I cannot let them off when they do mischief. For do but mark the effect of their words: when you and I argue for the existence of the Gods, and produce the sun, moon, stars, and earth, claiming for them a divine being, if we would listen to the aforesaid philosophers we should say that they are earth and stones only, which can have no care at all of human affairs, and that all religion is a cooking up of words and a make-believe . . . .
[[The avant garde philosophers, teachers and artists c. 400 BC] say that the greatest and fairest things are the work of nature and of chance, the lesser of art [[ i.e. techne], which, receiving from nature the greater and primeval creations, moulds and fashions all those lesser works which are generally termed artificial . . . They say that fire and water, and earth and air [[i.e the classical "material" elements of the cosmos], all exist by nature and chance, and none of them by art, and that as to the bodies which come next in order-earth, and sun, and moon, and stars-they have been created by means of these absolutely inanimate existences. The elements are severally moved by chance and some inherent force according to certain affinities among them-of hot with cold, or of dry with moist, or of soft with hard, and according to all the other accidental admixtures of opposites which have been formed by necessity. After this fashion and in this manner the whole heaven has been created, and all that is in the heaven, as well as animals and all plants, and all the seasons come from these elements, not by the action of mind, as they say, or of any God, or from art, but as I was saying, by nature and chance only . . . . these people would say that the Gods exist not by nature, but by art, and by the laws of states, which are different in different places, according to the agreement of those who make them; and that the honourable is one thing by nature and another thing by law, and that the principles of justice have no existence at all in nature, but that mankind are always disputing about them and altering them . . . These, my friends, are the sayings of wise men, poets and prose writers, which find a way into the minds of youth. They are told by them that the highest right is might, and in this way the young fall into impieties, under the idea that the Gods are not such as the law bids them imagine; and hence arise factions, these philosophers inviting them to lead a true life according to nature, that is, to live in real dominion over others [[here, Plato hints at the career of Alcibiades], and not in legal subjection to them . . . .
Ath. Then, by Heaven, we have discovered the source of this vain opinion of all those physical investigators; and I would have you examine their arguments with the utmost care, for their impiety is a very serious matter; they not only make a bad and mistaken use of argument, but they lead away the minds of others: that is my opinion of them.
Cle. You are right; but I should like to know how this happens.
Ath. I fear that the argument may seem singular.
Cle. Do not hesitate, Stranger; I see that you are afraid of such a discussion carrying you beyond the limits of legislation. But if there be no other way of showing our agreement in the belief that there are Gods, of whom the law is said now to approve, let us take this way, my good sir.
Ath. Then I suppose that I must repeat the singular argument of those who manufacture the soul according to their own impious notions; they affirm that which is the first cause of the generation and destruction of all things, to be not first, but last, and that which is last to be first, and hence they have fallen into error about the true nature of the Gods.
Cle. Still I do not understand you.
Ath. Nearly all of them, my friends, seem to be ignorant of the nature and power of the soul [[ = psuche], especially in what relates to her origin: they do not know that she is among the first of things, and before all bodies, and is the chief author of their changes and transpositions. And if this is true, and if the soul is older than the body, must not the things which are of the soul’s kindred be of necessity prior to those which appertain to the body?
Cle. Certainly.
Ath. Then thought and attention and mind and art and law will be prior to that which is hard and soft and heavy and light; and the great and primitive works and actions will be works of art; they will be the first, and after them will come nature and works of nature, which however is a wrong term for men to apply to them; these will follow, and will be under the government of art and mind.
Cle. But why is the word “nature” wrong?
Ath. Because those who use the term mean to say that nature is the first creative power; but if the soul turn out to be the primeval element, and not fire or air, then in the truest sense and beyond other things the soul may be said to exist by nature; and this would be true if you proved that the soul is older than the body, but not otherwise.
[[ . . . .]
Ath. . . . when one thing changes another, and that another, of such will there be any primary changing element? How can a thing which is moved by another ever be the beginning of change? Impossible. But when the self-moved changes other, and that again other, and thus thousands upon tens of thousands of bodies are set in motion, must not the beginning of all this motion be the change of the self-moving principle? . . . . self-motion being the origin of all motions, and the first which arises among things at rest as well as among things in motion, is the eldest and mightiest principle of change, and that which is changed by another and yet moves other is second.
[[ . . . .]
Ath. If we were to see this power existing in any earthy, watery, or fiery substance, simple or compound-how should we describe it?
Cle. You mean to ask whether we should call such a self-moving power life?
Ath. I do.
Cle. Certainly we should.
Ath. And when we see soul in anything, must we not do the same-must we not admit that this is life?
[[ . . . . ]
Cle. You mean to say that the essence which is defined as the self-moved is the same with that which has the name soul?
Ath. Yes; and if this is true, do we still maintain that there is anything wanting in the proof that the soul is the first origin and moving power of all that is, or has become, or will be, and their contraries, when she has been clearly shown to be the source of change and motion in all things?
Cle. Certainly not; the soul as being the source of motion, has been most satisfactorily shown to be the oldest of all things.
Ath. And is not that motion which is produced in another, by reason of another, but never has any self-moving power at all, being in truth the change of an inanimate body, to be reckoned second, or by any lower number which you may prefer?
Cle. Exactly.
Ath. Then we are right, and speak the most perfect and absolute truth, when we say that the soul is prior to the body, and that the body is second and comes afterwards, and is born to obey the soul, which is the ruler?
[[ . . . . ]
Ath. If, my friend, we say that the whole path and movement of heaven, and of all that is therein, is by nature akin to the movement and revolution and calculation of mind, and proceeds by kindred laws, then, as is plain, we must say that the best soul takes care of the world and guides it along the good path. [[Plato here explicitly sets up an inference to design (by a good soul) from the intelligible order of the cosmos.] >>
__________________________
Come now, let us reason together.
GEM of TKI
—Aleta: “Stephen, all your comments were about the first cause, by which I presume you mean the creator of the universe itself. That’s not relevent because I’m talking about what has happened after the universe began.”
Yes, of course they were. That is an important part of the subject matter that I have been covering, and the same subject matter that you studiously avoid, as you acknolwedge.
As I have stated many times on this site, atheist materialists, like yourself, reject causality and by extension, first causes. This flaw renders them, and you, incapable of evaluting evidence in a reasonable way.
I am well aware that it is NOT what you are talking about because what you are talking about is an attempt to evade what I am talking about. Like all materialist Darwinists, you reject causality and reason, which is why I don’t typically discuss science with those in your camp. It is a total waste of time to discuss science, which is a search for causes, with anyone who doesn’t accept the law of causality.
Stephen, in 77 I wrote, “to Stephen: For the sake of discussion, I will accept (because it is indeed a possibility) that the universe was created by a creator who set both the initial conditions and the properties of the original constituent parts of the universe (and by “parts” I mean particles, energies and forces which we now know intermingle to form what we call the physical universe.) I will also accept (because I believe it is true) that from that moment of creation each moment has followed causally from the moment before it”
Is that enough to move the discussion forward, past the issue of first cause and on to some of the other points I made to you?
Off topic music video:
Do You Believe In God?
“Cassie” -By Flyleaf
http://www.youtube.com/watch?v=xwJIW-6bTt0
Aleta, I hope the point of the Cassie, Do You Believe In God, video is not lost on you. i.e. What you casually admit to be true as “adequate” so as to move the discussion forward. Is a belief that has cost millions of people there lives for holding onto that belief.
Atheist Atrocities Frightening Stats About Atheists
http://www.youtube.com/watch?v=tP1KpNEeRYU
Aleta:
I trust you will take some time to address the already linked warranted credible truths approach to assessing and comparing worldviews on their degree of accuracy to reality; i.e. on truth.
A key part of that is the issue that what exists has a good and sufficient reason or explanation. If contingent, it is caused — i.e things that begin to exist do not begin out of nothing, for no reason.
(This of course raises the issue of necessary beings that would include the first cause of a cosmos that credibly had a beginning.)
And, causal factors will be sufficient, or necessary or both.
Coming back to focus, what is the known adequate causal explanation of:
Can you provide an empirically observed, rationally credible alternative explanation?
Especially given the highlighted?
GEM of TKI
—Aleta: “Stephen, in 77 I wrote, “to Stephen: For the sake of discussion, I will accept (because it is indeed a possibility) that the universe was created by a creator who set both the initial conditions and the properties of the original constituent parts of the universe (and by “parts” I mean particles, energies and forces which we now know intermingle to form what we call the physical universe.) I will also accept (because I believe it is true) that from that moment of creation each moment has followed causally from the moment before it”
We would have to agree that the law of causation logically requires a first cause. To say that a first cause is a “possibility” would not suffice. That would be like saying, ["lets talk biology. I agree that some events may be caused." or let’s talk forensics. “I agree that some murders require a murderer.”] That is what Darwinists do. They accept causality when the please and reject it when they please.
—”Is that enough to move the discussion forward, past the issue of first cause and on to some of the other points I made to you?”
No, it’s not enough, but that doesn’t stop me from answering questions. Is this the question you had in mind?
—”OK, if the universe is fine-tuned for life, why do you then declare that life was not “present in the cause. ‘If the universe is fine-tuned for life, why not accept that life is a natural consequence of the beginning state?”
Life was certainly present “as” a cause in the sense that the first cause is life itself, [the uncaused cause (God)] and, to be sure, that same uncaused cause could, if He chose, program “into” a secondary cause a potential for life built into matter that could later unfold into actual life. On the other hand, that secondary cause, as a process, cannot, on its own, be the sole cause for the life that unfolds because the first cause had to once establish and must continually sustain that same process. Processes, conditions, and laws cannot be their own cause, as I have pointed out many times. Further, the primary cause, [the conceiver and sustaining force] is always nobler than the secondary cause and its derivative effects [the proposed process out of which life is said to “emerge.”] Further still, the first cause cannot itself be an impersonal process, condition, or law, because it must, through an act of the will, choose to create.
So, if some groups want to corrupt science and hypothesize that the life “emerged” from the material process ALONE, without reference to the logically necessary program and sustaining power required for its development and final maturation, or to even deny that it is a maturation process at all, as Darwinists [and some TEs] do, such an initiative cannot be a rational scientific enterprise because it denies and even forbids the application of the law of causality [life can only come from life], [processes unfold according to a plan], [plans cannot create themselves]. If they try to take it one step further, as Darwinists [and some TEs] do, and restrict science to their one irrational hypothesis, forbidding any investigation into the program that informs the ways in which matter [allegedly] achieved its end, or the power that sustains the program, or any design patterns imbedded in the mix, or any possibility that information was front loaded, that is intellectual tyranny. Oh yes, and did I forget to say that it is also irrational.
ba, I did not, and do not, watch the videos you link to. And raising the subject of atrocities by atheists really poisons the well in the discussion.
And the subject in this thread, for me, isn’t atheism – as I’ve twice posted I’m accepting for the sake of this discussion that the universe was created with the fine-turned properties and original conditions that it has.
The issue of interest to me is the idea of emergence – that new things arise as times passes, and that there is nothing in life that was not “present” in the original state of the universe. As I asked Stephen, one question is if the universe was fine-tuned for life, why have a problem with the idea of life arising out of that fine-tuned universe?
Note: I wrote my last response before I saw Stephen’s post in which he did respond to the question I asked. I will, at some point, consider Stephen’s response.
Aleta, I don’t think it to be poisoning the well at all to point out the price millions have paid for a belief you are apparently so cavalier about so as to admit its “plausibility” just for convenience sake so to “move the discussion forward”. I find it highly ironic as a matter of fact.
ba, the atrocities committed in the name of religion are legion, and continue to this day. Why you would want to bring this topic into the discussion is beyond me. The topic that I am involved in discussing here has to to do with the philosophy of causality in the natural world, and in fact many theists would agree with the points I’m making. If this is your idea of how to participate in a discussion, then you can count me out.
That was a very interesting video on Kant’s ideas about design.
I have read some of his work bu I never seem to be able to decide whether he was a believer in God or not. I seem to be getting different interpretations from different sources. Anyone care to shed some light on that? I’m just curious.
Aleta, All I can say is thank God, with the capital G, that we live in America where such freedom of discussions about God have been a right since our founding in that it does not get you sent to “reeducation camp”. For example This is from O’Leary’s current thread:
“In the communist country, where I grew up, State would often diagnose Christian parents with dementia or some other cognitive dysfunction. They would be put in asylum and their children taken into State’s custody. I must add that this treatment would be temporary, lasting few weeks or so. I was ten years old.
Oh, I am sorry… forgot that communism is not the same as atheism. My bad.
All I am saying is that you should not take statement “Ignorant, stupid, insane or wicked” lightly.”
http://www.uncommondescent.com.....ent-353614
We always hear about the atrocities of religion. It seems to me, however, that the atrocities stem from not following the moral guidelines of religion, at least most. It seems to me, then, that religion is not the cause. A more detailed analysis is needed, of course.
Stephen wrote,
It seems like what Stephen is saying that any explanation of what has happened in the physical world must also include reference to God, both because he created it all in the first place and because without his sustaining effort the plans and designs that he embedded into nature would not develop. To deny this, and to not include it in one’s explanations, is irrational and is in fact intellectual tyranny.
I remember once where Stephen pointed out that for him theology comes first, philosophy next, and empirical study last (something like that.) This is here quite obvious. Since I don’t believe in God – certainly not the one Stephen is invoking here, I can’t even discuss causality with him. I find this all pretty weird that the conversation has gotten to this point, but at least now I understand better the issue about emergence that I have been puzzled about: according to Stephen, things emerge only because they are part of God’s plan, not because the natural world in and of itself is capable of doing the emerging.
I find this worldview foreign, puzzling, and not useful, but by persevering I at least understand more deeply what people like Stephen believe, and that is one of the main reasons I get involved in discussions like this.
aleta, Do you, as a atheistic materialist, believe consciousness emerged from a 3 dimensional material basis?
This is interesting to note-
From Josh McDowell, Evidence for Christianity, in giving examples of the influence of Jesus Christ cites many examples. Here are just a few:
1. Hospitals
2. Universities
3. Literacy and education for the masses
4. Representative government
5. Separation of political powers
6. Civil liberties
7. Abolition of slavery
8. Modern science
9. The elevation of the common man
10. High regard for human life
—-Aleta: “It seems like what Stephen is saying that any explanation of what has happened in the physical world must also include reference to God, both because he created it all in the first place and because without his sustaining effort the plans and designs that he embedded into nature would not develop. To deny this, and to not include it in one’s explanations, is irrational and is in fact intellectual tyranny.”
So, according to you, I said that those who deny first principles or refuse to include them in one’s explanations commit “tyranny.” Let’s look at what I wrote with the critical terms in capital letters:
“If they try to take it one step further, as Darwinists [and some TEs] do, and RESTRICT SCIENCE to their one irrational hypothesis, FORBIDDING ANY INTESTIGATION into program that informs the ways in which matter [allegedly] achieved its end, or the power that sustains the program, or any design patterns imbedded in the mix, or any possibility that information was front loaded, that is intellectual tyranny.”
Obviously, I am talking about institutional bullies who set arbitrary rules for scientists, and not people who disagree with me. Do you always read your own biases and prejudices into others’ comments this outrageously, or was this an exception?
—- “I remember once where Stephen pointed out that for him theology comes first, philosophy next, and empirical study last (something like that.) This is here quite obvious.”
Let me try to reduce it to its simplest essence. Theology informs metaphysics, which, in turn, illuminates science. What that means is that, among other things, metaphysical principles, such as the law of causality, the law of non-contradiction, the correspondence of the rational intellect to the ordered universe, provide the logical foundations for science. Thus, it is not possible to divorce those principles from science and remain reasonable.
—“Since I don’t believe in God – certainly not the one Stephen is invoking here, I can’t even discuss causality with him.
The God I am alluding to is the first cause or the uncaused cause. Which God did you have in mind? Earlier, you stated that, for the sake of argument, you accept a first cause–at least you did when I pressed the issue. But that is old history now, isn’t it? Now you say that you don’t believe in this first cause.
—“I find this all pretty weird that the conversation has gotten to this point, but at least now I understand better the issue about emergence that I have been puzzled about: according to Stephen, things emerge only because they are part of God’s plan, not because the natural world in and of itself is capable of doing the emerging.”
First of all, I don’t think life “emerged” at all, at least by your apparent definition. Life comes from life. On the other hand, if it happened by means of “secondary causes,” and if that is what you mean by emerge, those secondary causes require a first cause. If you think that life can emerge without a first cause, then you might well want to explain the origins of the process. Or do you think the process “emerged” as well. I am just pointing out your tendency to assume that something can come from nothing. The weird part is that, like all atheists, you change arguments to meet the needs of the moment, alternating between the acceptance of a first cause and then reverting to the opposite view, claiming “laws” and conditions can do the work of the first cause.
—“I find this worldview foreign, puzzling, and not useful, but by persevering I at least understand more deeply what people like Stephen believe, and that is one of the main reasons I get involved in discussions like this”
Based on your proclivity to read into my messages that which you hoped I had said, as opposed to that which I did say, I don’t think you even remotely understand what I believe. That is odd, since I am not known for being vague. Could it be that your dedication to materialism has rendered you impervious to reason? Things like that do happen.
I think I understand a lot, and some things you don’t. But I also understand that we have different, and fairly irreconcilable, points of view.
I think I’m ready to quit exploring your belief system – I’ve gotten all I’m going to get out the experience, and I’m ready to move on to other things.
StephenB, I have to say I am mighty impressed with your ability to cut through the bull.
Phaedros, The impact Christianity has had on civilization for the greater good is indeed very profound and is indeed undeniable from historical record. But apparently many professors never teach that impact in college anymore because they are to busy bashing “evil” Christianity and brainwashing pseudo-scientific evolution into young minds. At least that is the impression I get from all these young people nowadays who always claim Christianity is one of the greatest evils in the world. Just who in the world is teaching this rubbish to our young adults if not these professors of so called higher learning??
Here is a dose of reality for all those who think the world would be a better place without Christ followers:
The Black Book of Communism: Crimes, Terror, Repression:
Excerpt: Essentially a body count of communism’s victims in the 20th century, the book draws heavily from recently opened Soviet archives. The verdict: communism was responsible for between 85 million and 100 million, non-war related, deaths in the century. (of note: this estimate is viewed as very conservative by many, with some more realistic estimates passing 200 million dead) (Of Note: Atheistic Communism is defined as Dialectic Materialism)
http://www.amazon.com/Black-Bo.....0674076087
Atheism and Its Scientific Pretensions By David Berlinski – list of genocides by atheists
http://books.google.com/books?.....38;f=false
From Darwin To Hitler – Richard Weikart – video
http://www.youtube.com/watch?v=w_5EwYpLD6A
Stalin’s Brutal Faith
http://www.icr.org/index.php?m.....038;ID=276
Phaedros, On top of what you listed for the good Christianity has wrought, I have this one article:
Lives Saved By Christianity
Excerpt: here is an article, detailing how Christianity improved the status of women and saved millions of people in ancient Rome from death by female infanticide and from the plagues which periodically swept the Roman Empire:
http://www.uncommondescent.com.....ent-337994
Phaedros, Dr. Weikart is really a top notch scholar who really does his home work. From Darwin to Hitler was absolutely devastating for those who denied evolution had any role in the holocaust. Here is a fairly recent article of his:
How Darwin’s Theory Changed the World
Rejection of Judeo-Christian values
Excerpt: Weikart explains how accepting Darwinist dogma shifted society’s thinking on human life: “Before Darwinism burst onto the scene in the mid-nineteenth century, the idea of the sanctity of human life was dominant in European thought and law (though, as with all ethical principles, not always followed in practice). Judeo-Christian ethics proscribed the killing of innocent human life, and the Christian churches explicitly forbade murder, infanticide, abortion, and even suicide.
“The sanctity of human life became enshrined in classical liberal human rights ideology as ‘the right to life,’ which according to John Locke and the United States Declaration of Independence, was one of the supreme rights of every individual” (p. 75).
Only in the late nineteenth and especially the early twentieth century did significant debate erupt over issues relating to the sanctity of human life, especially infanticide, euthanasia, abortion, and suicide. It was no mere coincidence that these contentious issues emerged at the same time that Darwinism was gaining in influence. Darwinism played an important role in this debate, for it altered many people’s conceptions of the importance and value of human life, as well as the significance of death” (ibid.).
http://www.gnmagazine.org/issu.....-world.htm
@StephenB,
“Let me try to reduce it to its simplest essence. Theology informs metaphysics, which, in turn, illuminates science. What that means is that, among other things, metaphysical principles, such as the law of causality, the law of non-contradiction, the correspondence of the rational intellect to the ordered universe, provide the logical foundations for science. Thus, it is not possible to divorce those principles from science and remain reasonable. ”
You see Stephen, by now, you’d think with the collapse of logical positivism and all the literature written on the matter – in fact, 50 years after Popper (among others) exposed their myth – they would have figured that out by now. But alas, they prefer to pretend that they can do science in suspended animation.
Not to mention the Incompleteness Theorem!
Bornagain-
Holy crap I didn’t realize Watson promoted not labeling a child alive until 3 days after birth. Good God.
Onlookers (and participants, esp Aleta and StephenB):
First, let us notice how Aleta has plainly been utterly unable to address the key issue of programs and associated codes, algorithms, language, plans and evident intent in the design of the cell, as was cited from Koshland, 2002, in the original post, and as I cited in 109, inviting Aleta to “provide an empirically observed, rationally credible alternative explanation”:
Now, it is effectively uncontested that we know but one observed, indeed routine, source of complex codes, plans, programs etc: intelligence. So, the induction that such functionally specific complex organisation and associated information are empirically reliable signs of intelligence is well supported, now tot he level of Zettabytes of evidence in hand.
That is, the core design inference form signs of intelligence tothe action and presence of relevant intelligence is empirically well warranted and reasonable on inference to best explanation.
However, this cuts across the aggressive evolutionary materialism that now stalks our civilisation, loudly braying that it is science and that only those who are ignorant, stupid, insane or wicked dare beg to differ. A stinking, hell-envenomed lie and slander. One that — as was cited above — inunison identified as leading to he false incarceration of Christian parents in officially atrheisticaland evolutionary materialistic societies as demented.
And that was the “kinder, gentler” treatment.
Millions of Christians were murdered by those atheistical states, and by states that were strongly influenced by the underlying evolutionary materialism. [Read Bk 1 Ch X of Mein Kampf to see what I mean and why Weikart has a serious point on the sadly well documented links from Darwin to Hitler. (That is why I go ballistic when I see attempts to distract attention form that sorry record in living memory,and to impugn a faith that through the struggles and sufferings of the martyrs, confessors and reformers across the ages, has provided the reforming, prophetic voice and conscience of a civilisation as one of the worst evils ever. And when I see the persistent refusal to address the ethical core of that faith in the haste to try to find proof texts and examples to indict it, that tells me that we are here seeing the devils quoting and wrenching scripture through their dupes; as Shakespeare so aptly said. So, if you are a praying person, pray that eyes will be opened and hearts warmed to the truth in love. Before it is too late for our civilisation. For, the hour is late; desperately late.)]
[ . . . ]
But, gentle reader, more must be said, if we are to correctly diagnose and correct the rot.
For, by virtue of what was put up as correction, but ever since 44 above, has been uncontested but studiously ignored, we know the fatal flaw at the heart of the evolutionary materialist claim to provide an adequate account for origins though imposing so called methodological naturalism on science.
Indeed, the saddening pattern of the above thread is by now quite plain: evolutionary materialist ad hominem laced strawmanism as rhetorical strategy and filter that distorts ability to perceive accurately and fairly, then respond reasonably and responsibly.
Sorry to use such plainly painfully sharp words, but the poisonous cyst must be lanced; ere it poison the blood fatally.
Let us therefore observe how, repeatedly, relevant correction and material facts and reasoning have been ignored or distorted and dismissed by those advocating evolutionary materialism and flying the colours of “Science.”
And, when it got to correcting the round declaration by A in 95 above that . . .
. . . we must observe how the warranted credible truths approach to comparing and assessing which worldviews are best warranted as accurate to reality — i.e. well warranted as truthful and trustworthy — has been studiously ignored.
In short, Stephen has been shown correct on his concern that evolutionary materialist advocates have sacrificed reason for agenda, and have hijacked science in service to a longstanding a priori, anti rational amoral [all shown above or in the linked but studiously ignored] philosophy programme of evolutionary materialism that ever since Plato first exposed it in the 360 BC The Laws Bk X as linked and excerpted above [cf e.g. 104], has been notorious for teaching destructive and patent error in the name of avant garde progress:
In short, the arrogant, question-begging, willfully blind and irrational philosophical a prioris and amorality of evolutionary materialism, and its tendency to radical relativism of values and morality, to form agenda driven power hungry factions, thus leading to chaos and tyranny have been on record since 2,300 years and more ago.
So, if we allow it to triumph in our time, that is because we have yet again ignored, or refused to learn, or even suppressed the painful lessons of history.
100 million ghosts from the sad century just past moan in warning to us.
But, will we listen?
Or, will we succumb to the enchanting drumbeats of the always ever so tempting march of folly?
G’day.
GEM of TKI
kairosfocus, bornagain77,
If evolution is NOT true, then the Intelligent designer was responsible for designing Hitler, NOT Darwin.
kairosfocus,
I’ve been thinking about your fitness search and I’ve managed to get it down to an n-bit wide counter that returns true if the target bit-map and the counter matches.
Am I correct?
Born again 77: thanks for the kind words.
Kairosfocus: Isn’t it interesting that, according to Plato, those who argue that inanimate entities have the power to create are also the same ones who propose that “might makes right.” It is NATURAL for atheism to prefer tyranny because it can tolerate neither free expression or unfettered investigations, both of which foster an environment for discovering truth, atheism’s intellectual [and personal] enemy.
Above: Pseudo intellectuals love to call on the name of Popper to justify their worship of science, as if the highest form of wisdom could be found in data.
@Stephen
-”Pseudo intellectuals love to call on the name of Popper to justify their worship of science, as if the highest form of wisdom could be found in data”
But Stephen, what I am proposing is even worse. They voluntarily ignore his critical analysis of naturalism. It’s the whole vicious cycle of selective hyper-skepticism all over again. Here is a direct quote from Popper:
“Thus I reject the naturalistic view: It is uncritical. Its upholders fail to notice that whenever they believe to have discovered a fact, they have only proposed a convention. Hence the convention is liable to turn into a dogma. This criticism of the naturalistic view applies not only to its criterion of meaning, but also to its idea of science, and consequently to its idea of empirical method.”
toronto writes this without thinking:
If evolution is NOT true, then the Intelligent designer was responsible for designing Hitler, NOT Darwin.
Is it a greater feat for God to create a being who can freely choose to love Him or not, and to freely choose to do His good and perfect will or not, or is it a greater feat of creative power for God to create a puppet who mindlessly tell Him how great He is, and how much they love Him?
Toronto:
Inference to design is about functionally specific complex information in cells, and in entities such as the finetuning of the cosmos.
From empirical evidence to inferred causally adequate force. Namely, mind — but onlookers, observe the “next objection” selectively hyperskeptical style.
Now that it seems abundantly clear that the design inference is solid and solid science, you want to play at [anti-]theology. So, let us mark a key distinction: the designer of life on earth, the designer of the cosmos etc are just that designing intelligences. Design theory goes no farther than that qua empirically grounded scientific theory.
But that’s no problem, as we have a whole discipline of worldviews analysis out there: philosophy, which grounds science as a relatively minor part of that project.
Next, if you want to raise “blame God” games, as you plainly are doing, then you need to take time to address Plantinga’s free will defense [and not strawman caricatures], then you need to addres the nature of virtue. For, a real mind and a real moral decision both require the power of choice, so a world in which love is possible requires freely deciding thus responsible creatures. And, a world in which love is possible and sufficiently common, is a world in which there is a lot more good and greatness than a robotic mechanical one.
If decision to love is possible so are decisions to hate or be indifferent and callous. But, the one responsible for a decision is: the decision-maker.
The person to blame for Hitler’s misbehaviour and evil is: Hitler.
Now, too, by objecting to evil, even implicitly, you open up a whole agenda of issues for your self-confessed atheism:
1 –> On evolutionary materialist worldviews, there is no is that is sufficiently capable to ground ought. [Only a Creator God who is good as to essential being is an IS capable of grounding Ought.]
2 –> So, evolutionary materialists appealing to the problem of evil are either playing rhetorical policics, manipulating emotions, or are insufficiently aware of the gaps in their worldview to realise that heir view as Plato pointed out is essentially amoral, and morally absurd.
3 –> When you can provide an ISW within your worldview capable of grounding ought in more than the monstrous “might makes right,” come back to us with the problem of evil.
4 –> But, in any case, you did raise the problem, and acknowledge the validity of the intuition that evil is real and objectionable. That intuition is sound, and it is telling you that something is very wrong with your materialistic worldview.
5 –> So, let us call up an expert, Koukl, on the significance of the reality of evil:
7 –> So, which is it: will you hold on to the reality of evil, or will you cling tot he worldview that the acknowledged reality of evil exposes as patently absurd?
8 –> If the former,to make objection to the God of Judaeo-Christian theism, then you have to address the free will defense and the implications of a world in which love — the foundation of virtue — is possible. On comparative difficulties, redemptive theism makes far better sense!
9 –> if instead you cling to materialism, then you have to face the amorality, and you have to face the contradiction between your acknowledged reality of evil and your worldview. Reductio ad absurdum.
10 –> And worse, you have a worldview that is dangerous: if it has no is capable of grounding ought, we are at Plato’s Alcibiades world in which might makes right. Which is precisely where Hitler stood. (And, on evolutionary grounds too: his remarks on cats having no friendly views of mice makes for chilling reading when you substitute: Cats = german aryan supermen, and mice = poles, Jews, gypsies and other evolutionary degenerate subhumans. I won’t even bother to cite Darwin’s predictions in Descent of Man ch 6, and H G Well’s novellistic warnings in the opening of War of the Worlds and in Time Machine . . . at least just now.)
_____________
Toronto, if you want to play at philosophy and theology, there is more tot he story than you probably have met hitherto.
Especially, when your side is not allowed a free pass to fire off barrages of skeptical objections, but instead has to step up to the bar of comparative difficulties analysis in light of warranted credible truths.
G’day
GEM of TKI
@bornagain
I am actually amused by the insinuation of the possibility that darwin himself actually ‘designed’ hitler.
I know it’s probably a rushed statement he made without thinking it over, but it’s interesting to see how this type of expression is creeping up into people’s daily language.
PS: Toronto, here — in my always linked — is how I looked at genome space, and the implications of islands of function and the prevalence of stop codons. Think 700 gigabase loops, with 5 states [a don't care/blank state], and then move from zero effective length to 700 Gbase, in a funnel; making room for frame shifts, diverse direcitons of read, etc..
Above; in a philosophical sense, “liberated from the shackles” of Judeo-Christian ethics, Darwin’s theory enabled the “scientific justification” for the already inherent racism of Germans against “inferiors” to be born out in the holocaust, i.e. in a philosophical sense, Darwin really DID design Hitler:
“At some future period, not very distant as measured by centuries, the civilized races of man will almost certainly exterminate, and replace, the savage races throughout the world,” (Darwin 1887:156).
@bornagain
If phrased as such, then we need to also take into consideration the nonsensical ideas of nihilists like nietzche, the rise of nationalism (a by-product of materialistic “ideals”) as well as the darwinian principles like you mentioned. Put them all together and you have a recipe for hundreds of millions of deaths…
above, actually someone has taken all sides into consideration:
From Darwin To Hitler – Richard Weikart – video
http://www.youtube.com/watch?v=w_5EwYpLD6A
StephenB, et al
Have the philosophy-minded IDers taken notice of Dr. Keith Ward’s thoughts on nature – and his understanding of Kant that I pointed out to Stephen.
Ward, more than any others I’ve come across of late (except VJ Torley, who is a scientifically enlightened Thomist, sounds full-bore ID.
Just Thinking, for what it is worth, my assessment of Keith Ward, or for that matter, Imannuel Kant, has not changed.
Ward holds that the evolutionary process was designed but also contends that design patterns in nature cannot be detected. He is no friend of the science of design detection.
Further, Ward’s historical account of Kant is, in my judgment misguided and, in some cases, irretrievably skewed. To hear Ward tell the story, all of Western Cililizaion misunderstood Kant when it charcterized him as a skeptic and subjectivist. In fact, Kant was exactly that, criticzing Aquinas’ proofs for the existence on subjectivist grounds. Since he couldn’t counter the arguments rationally, he simply declared that we can’t know anything about the real world.
Originally, Kant had gone out of his way to solve a problem that did not even exist, failing to realize that Hume’s challenges against causality were badly conceived. He created an intellectual mess from which Western Civilization has not recovered and may never recover. Hegel rather than see through his errors, made things worse, leaving it to Schopenhauer and Nietzsche to complete the journey to intellectual madness. I, for one, am not buying what Ward is selling.
That should read: In fact, Kant was exactly that, criticzing Aquinas’ proofs for the existence [of God] on subjectivist grounds.
PS. To be fair, I will say something positive about Kant. Against the materialsits, he insisted, as an idealist, that “genius” cannot be a derivative of mechanical forces, which makes him congenial with much of the ID project.
@Stephen
-”Originally, Kant had gone out of his way to solve a problem that did not even exist, failing to realize that Hume’s challenges against causality were badly conceived. He created an intellectual mess from which Western Civilization has not recovered and may never recover. Hegel rather than see through his errors, made things worse, leaving it to Schopenhauer and Nietzsche to complete the journey to intellectual madness.”
I think the latter needs to bear the most responsibility out of all in my opinion.
He practically attempted to legitimize anti-intellectualism and irrationality. The unfortunate thing is that he actually did influence western thought, regardless of the fact that he openly stated that he was not being reasonable and merely was attempting to seduce the minds of others via his extremities.
The fact that there are people out there, and so called “philosophers” nonetheless, that take him seriously is beyond me.
Onlookers:
We need to pause a moment to see what has gone on above.
Especially, how, once scientific objections were answered, the underlying materialistic philosophy surfaced. And, when the objection on evil was trotted out, and answered; notice the silence and subject switching. [Toronto went over to another trhead where he tried to deny the reality of the DNA codon table for the genetic code, or how it is used in a step by step code based procedure for creating the proteins that do so much of the detailed work of cell based life.]
In short, we are at reductio ad absurdum for evolutionary materialism. That is, we are back, full circle to what Plato spotted and corrected 2,300+ years ago.
And as for Nietzsche, the reason he has to be taken seriously is that he is the one who most blatantly brought out the absurdities.
And, on the Darwin-Hitler link, it is time to expand BA’s cite from Ch 6 of Darwin’s Descent of Man [in a passage that is repeated word for word AFTER the letters to an American in which Darwin acknowledges the intellect and human capacity of Afro-American soldiers in the US Civil War]:
Darwin was indeed the father of the social darwinists, and the eugenicists.
Weikart has documented the specific steps in the chain from the former to the latter, but the implications were clearly laid out in 1871.
Fact.
And all the raging and ad hominems in the world against Weikart and others who have documented the fact cannot change that reality.
G’day
GEM of TKI
PS: Nor can the rhetoric of distraction, distortion and polarisation erase the further fact — cf 129 and 104 above — that Plato diagnosed the problem of evolutionary materialism and its consequence in amorality, might makes right agendas and factions, tending to tyranny, and identified the remedy long ago: correcting the error of dismissing the foundational role of art in creating our world.
PPS: Let us also not forget a key point from the original post, by way of returning the thread to its proper focus:
That central reality, by which we see that codes, plans, programs, algorithms and data structures based on strings predate and are causally prior to carbon chemistry, cell based life, refocuses all the issues of origins science. For –unwelcome though theis plainly is to committed a priori materialists — there is but one empirically (and routinely) observed and probabilistically credible source of such functionally specific complex organisation and information: intelligence.
bornagain77 @134,
I wouldn’t write something like this even if I was allowed to.
vjtorley, don’t know if you can edit this, but I find the links in your article, such as to The Smithy, didn’t work because they were enclosed in quotation marks, leaving a trailing quotation mark in the interpreted URL.
In other respects, thank you for a find article.