Musgrave Addendum to “Intelligent Design Challenge”
| February 1, 2008 | Posted by William Dembski under Intelligent Design |
Here’s an addendum, dated 2.1.08, to Ian Musgrave’s challenge (go here for the original challenge):
Dear Dr. Dembski
There has been some confusion about the wording of the original challenge.
I’ve re-written the contest rules slightly as some people were confused as to what designer they were supposed to detect.
A reminder, to win, you have to:
1) Identify which sequences have been produced by a human designer
2) Describe how you identified the sequence as being designed (eg. I used PKZip to compress the sequences and ordered the output according to the following criteria)
3) Describe what the sequence does (eg. “This is the active site of a triose phosphate isomerise engineered into a riboprotein — this due to the catalytic triad signature” real example BTW this is not as difficult as iot sounds one you know what sequences were designed)
Obviously, the groups who produced these sequences are not eligible to enter, and if you walked down the corridor and asked the groups who produced these sequences what they did, you are also not eligible. You need to have done some actual work related to the sequences presented here. Simply looking up all journal references to “designed sequences” in Pubmed doesn’t count (obviously this is all public domain, I’m not going to release the engineered killer mousepox virus sequence am I).
If you are in an emergency ward, trying to discover if the superflu screaming through the population is a bioweapon, you won’t find the answer that way. And you won’t have the luxury of having a full viral sequence to BLAST against known genes [thus discovering that the M2 ion channel had been replaced with the amandatine-insensitive Vpu ion channel, so that your antiviral drugs won't work], but short sequences like the ones above.
Remember, in a real biowarfare situation, everyone will be short of time and resources. A simple, reliable procedure to determine if a sequence has been human-engineered is of the utmost importance.
So, in the spirit of the Robot Soccer Challenge and the NASA Spacecraft Challenge, have a go!
Yours sincerely
Ian Musgrave==================================
Ian F. Musgrave Ph.D, [email protected]
Clinical and Experimental Pharmacology, Room 336S, ext 33905
Si hoc legere scis nimium eruditionis habes
24 Responses to Musgrave Addendum to “Intelligent Design Challenge”
Leave a Reply
You must be logged in to post a comment.
Si Hoc Legere Scis Nimium Eruditionis Habes
“If you can read this you’re over-educated”
MIT Latin phrases (Wonder what that says about he who signs his email thus?)
Regarding Musgrave’s revised challenge, it is a worthy goal to rapidly detect novel pathogens. There are also well funded organizations eager to have such capabilities.
Conversely, there are other groups out there to whom we may not want to provide the details of how such pathogens can be detected!
See DARPA’s Biosurveillance program
Those interested in Musgrave’s challenge may wish to form a consortium and obtain a multi-million dollar grant to pursue it (and file the patents while you are about it. US Govt. provides for allocating patent rights to grantees.)
DHS 2008 budget
Can ID methods provide insights into detecting changes in bacteria or pathogens better than a brute force testing all options? Worth applying for a grant to find out. Might even find applications for some probability theory!
Ian
Regarding your expectations on the genomic viral analysis capabilities, suggest considering:
The 1000 Genomes project
Archon X Prize for Genomics
I recommend you work on refining your challenge and submitting it to the X Prize Foundation. e.g., to rapidly determine if a bacteria or virus has mutated or is a biowarfare agent.
- Or do you wish to up the prize to compete?
In the mean time, I propose that any such challenges plan towards having the capability of obtaining the full genome within 24 hours, and then in 2 hours.
“Identify which sequences have been produced by a human designer” – Musgrave
It seems to me that the simplest way to accomplish that end is to compare the subject sequences with a reasonably complete database of similar “naturally occuring” sequences. If the sequence is functional in some way and not in the database, it has probably been manipulated.
Musgrave seems to be so desperate to garner evidence against the work of Dr. Dembski and his colleagues that he’s forgotten what Intelligent Design is all about. Assuming, of course, that he once actually knew.
Design detection is not always possible. e.g., a single mutation (SNP) can cause a fatal difference. So presumably, a single mutation can change common virus’ into deadly air born pandemics. Determining if that was natural or human caused would require forensics examination of the spread to determine the source etc.
Dr Dembski:
I observe Dr Musgrave’s:
This has two effects:
That, sadly, does not say much in his favour.
Perhaps, he could find it in himself to consult the semi-popular level definition you gave in this article:
Onlookers, pardon the multiple highlights, but sometimes it takes that woefully inadequate print representation of delightfully expressive reading — I just love the way my wife reads out loud (one of her multitude of highly admirable characteristics . . .) — to “see” what you do not “expect” to see.
In effect, ID as science is an empirically anchored investigation of signs of intelligence manifested in objects; i.e. it refines the sort of investigatory process that is seen in the classical Fisherian hypothesis testing and the like [especially in the explanatory filter on complex specified information form].
Of the signs of intelligence, the major ones are CSI as just mentioned and irreducible complexity. The inference to either is predicated on considering that intelligent agents routinely — using creative intuition and insightful understanding — generate functional configurations that are:
Dr Musgrave has in effect now plainly lost the challenge on the merits; while refusing to graciously acknowledge it.
On the human design detection side, was it Patrick who did some useful detective work over in the first thread, using contextual cues to infer to motive- means- opportunity, thence identified watermarks from a known lab, which use the technique of writing in English code [adjusted for missing letters] based on the abbreviations for the proteins coded for by three letter codons?
In short, precisely the sort of creative, insightful manifestation of intelligence that we just described. [Apply this to the far more clever nanotechnology of life as observed in the cell, Dr Musgrave. Then, explain to us, on the gamut of the observed cosmos, we can achieve such by either mechanical necessity or chance-based processes in pre-biotic environments for which you have serious empirical evidence.]
Thus, I conclude that [1] the original challenge has been batted across the boundary for six; [2] the “revised” challenge — which implies bur does not acknowledge [1] — was beaten before it was issued.
No-ball, Dr Musgrave; 4 byes, that’s 10 “runs” aggregate off the first ball of the over. [And yes I know that technically byes don't count towards one's personal score.] At this rate, somebody is going to beat Sir Gary Sobers’ famous 36 runs in one over!
GEM of TKI
PS: If Poles can be cricket fans . . .
PPS: I see DLH’s:
In short, by widening the context we see a wider configuration that now allows us to infer to agency, thence perhaps isolation of which agent has motive- means- opportunity. This upgrades the score — the no-ball was batted for six, so it is 12 runs off one ball in the over, with five more to go.
I think Evo Mat team Captain Dawkins is getting worried about this bowler!
kairosfocus, I too believe he has maybe not followed the ‘Laws of Cricket’ when he has “re-written the contest rules” … and created his own sticky wicket.
I got 42 off an over once: it was, though, in indoor cricket from an eight ball over. 7 sixes and out!
Pah! I say, to Mr Sobers. Pah!
Dawkins, I’m sure, would be a leggie, always working on his spin.
I would add, besides the already designed point, in which Musgrave most assuredly did not overlook, but insisted upon his assumptions as correct, that if a “human designer” wanted to create bio-terror microbes, viruses, etc., they might be clever enough to think ahead and limit their “human design” imprint as well within actual limits of known observations with the Edge of Evolution. Do not make to large of genetic leaps another words that forensic DNA scientist would see as a red flag.
Unless of course, the bioterrorist aim is pure terror to the masses, sent with a big message that is undeniable, or a big ego. Imagine Al Qaeda in the future watermarking with messages from bin Laden. Or even illegal drug marketers who want to protect their turf in the future for designed LSD.
Also, of interest, since this blog has talked about Venter. It is not the first “human design” with such obvious intent. Prior to Musgraves challenge, I read of German scientist first inserting a line from Virgil and it made me suspicious.
from NYT:
hattip
David Coppedge:
“No doubt Venter would be quite upset if children were taught in school that these messages evolved by random mutation and natural selection over millions of years.”
The purpose for patents, id, safety regulations, etc., will eventually be put in place by demands on all sides, to reduce lawsuits and protect “human designers” property, as well as inform farmers of unwanted “human design” encroaching on their land of other designed life.
As a result, rogue biogen thiefs will look to hide their patent infringing “human designs.”
This has been discussed here often.
Thus the need for ID will only continue to grow in this Post-Darwinist age.
correction: “al Qaeda sympathizers”
and important additional NYT quote:
“Dr. Venter is not the first to think of burying messages in DNA, which is, after all, an information code.”
This is just some parlor game/trick.
It would be a good challenge for Ian to show that any nucleotide sequence can arise from scratch outside of a living organism and without agency involvement.
Ah Aussie . ..
Is Dawkins a leftie too?
If he is, then he would be truly, truly dangerous: a left-handed leg spinner — the kind of bowler who if he is really on form can take out your team in two overs. (For the uninitiated, this is the cricket version of: “beware the left handed swordsman.”)
H’mm: That seems about right for that crafty one indeed!
Speaking of, they still play eight-ball overs down in Oz?
(And of course, a great over indoors doesn’t match up to Sir Gary’s 36 in first class cricket. I remember seeing it on TV the night — one of those sixes, as I recall from my vivid memory of the TV run, went into the parking lot! (I guess equivalent to the same with an out-of the park home run in baseball.))
Judging by Michaels 7 at no 8, the score is now 18 off the first two legal balls and counting. [We's on track to 42 for this -- six ball thank you -- over, Prof Musgrave; you have Capt Dawkins real worried. You are a very, very expensive bowler.]
Oh yes, it is worth this one on ball no 3:
Cicero, that notorious backwoods Christian Fundy, swinging from 50 BC hits ball number three for six too.
24 and counting, Prof Musgrave.
Dawkins is cringing: No more no-balls — pleeeeze . . . .
GEM of TKI
My point is that in some biological warfare emergency the scientists would have the whole infecting organism to work with.
And in biowarfare the real emergency would be to find a way to stop the infection NOT to determine whether or not it was designed.
However by trying to find a way to stop it we may be able to make such a determination.
PS: ball no 4, with NYT making a surprise appearance on the ID team, SIX. That’s 30 off four balls:
PPS: Joseph makes it 36 off five balls:
OVER TO YOU DR MUSGRAVE — WILL YOU MAKE IT 42 RUNS FOR THIS OVER?
PPPS: And, on the last ball of the over — it’s a mere 4.
So it’s 40 off the over.
Capt Dawkins is visibly relieved — and takes up the ball himself.
I can’t say that I have read very widely on the subject of specified information (that’s a deficiency I intend to correct over the coming year). However, it seems to me that there is a significant disanalogy between the messages inserted by scientists into DNA which they have patented, and the “message” contained in DNA itself. In the former case, there is a message which is meant to be deciphered and understod by an intelligent recipient; in the latter case, there is a set of instructions (for making proteins) which is meant to be “read” and “deciphered” by the machinery of the cell – mRNA and so on. But this machinery is quite blind; it understands nothing. It simply processes some very densely and efficiently packed information.
Does this difference matter? I think it does. Consider the following example. Suppose a scientist encodes the following message within a stretch of DNA: “You can make a cake by: (a) mixing two cups of self-raising flour with half a teaspoon of salt in one bowl; (b) whisking two eggs and a cup of milk in another bowl; (c) pouring the egg mix into the bowl of flour and stirring the mixture until it has a light, fluffy consistency; (d) greasing a cake tin and pouring in the cake mix; (e) placing the cake tin in an oven pre-heated to 350 degrees Fahrenheit or 180 degrees Celsius; and (f) leaving the cake in the oven for about 25 to 30 minutes, and then turning the oven off to let the cake cool slowly, after testing the cake with a straw to verify that the interior is properly cooked.” (OK, some of you are probably splitting your sides laughing at my terrible cake recipe, but that’s how I used to make cakes as a teenager, back in the seventies. I have no idea how they make them these days.)
Now compare that with the “recipe” for making a protein that could be said to be encoded within a section of DNA. My contention is that the recipe encoded by the scientist has a very different kind of “aboutness” (intentionality is the technical philosophical term for it) from the instructions for making proteins, contained within our DNA. It is only in a much weaker, Pickwickian sense that we can say these instructions are “about” anything at all. The first message refers to things like eggs and cake tins; but the second “message” cannot properly be said to refer to anything.
Another way of looking at this might be to ask in what sense either receipe could be said to contain an error. In the first case, there is an error if the message fails to communicate clearly what the sender intended to transmit – possibly because of a careless typo, or the omission or duplication of a line of text. Even if, despite the error, someone used the recipe to make a cake that tasted OK, that would not make the recipe right. It would still be in error, because it would not be what the sender originally intended it to be. And if the message contained no transmission errors, but the cake turned out to taste terrible, that would not make the message wrong.
In the second case, however, the criterion for error is purely functional: do the instructions work? Here, the standard of “right” or “wrong” is purely a practical one: how well the cell flourishes.
Another significant difference between the two cases is that in the first case, the message carries an intrinsic meaning, whereas in the second case, the letters in the DNA do not really mean anything; they just function in a certain set way, when the machinery of the cell is working properly. We say that their regular function is what they “mean,” but this is an anthropomorphisation of nature.
The case for DNA being intelligently designed rests on two pillars, as I see it: first, the notion that DNA carries a specific message, the occurrence of which is vanishingly improbable, if we limit ourselves to purely natural processes; and second, the argument that since DNA seems to have an optimal design from a biochemical point of view, and since it encodes information far more efficiently (and with a greater degree of “richness”, thanks to tricks such as dual coding) than any machine designed by intelligent agents, and since there is no known natural process that can build information-rich molecules from simple constituents like amino acids, then we must take seriously the notion that DNA was designed by a Super-Intelligence.
To my mind, the first “pillar” rests upon a questionable analogy between human messages and chemical “messages.” I think we should not use this argument. The second “pillar” seems to be a perfectly good vehicle for making our case.
Returning to Dr. Ian Musgrave’s challenge: in the real world, probability is the only weapon we have to identify bio-terrorists, and as some readers have noted above, clever ones might figure out a way to operate under the threshold of detection, anyway. But even to catch stupid bio-terrorists, we’d need to know: (a) the default or “normal” value of each letter in the DNA sequence of that species of organism; and (b) the probability of each and every change in the “normal” sequence arising naturally (through mutation), in that particular species of organism, in order to identify which sequences were extremely unlikely and hence probably due to human interference. Without that knowledge, I really don’t see how you could get past square one. It seems to me Dr. Musgrave has not supplied that information, so that appears to render his challenge rather unfair.
Did I miss the application of the explanatory filter? I wanted to see the math being worked out.
ellazimm – apparently it’s not appropriate to use it in this case.
Bob
vjtorley
Distinguish between primary and secondary intelligent causes. NASA’ Mars rovers show evidence of intelligent design of the secondary type. It is still shows evidence of though it just processes preprogrammed commands.
In the other thread P. Noyola put it best:”This is just a case of Darwinists trying to paint us into a “have you beaten your wife lately” corner, and any response will be laughed at — with no response being considered a victory.
This is a phony “challenge” for several reasons. Musgrave ignores the often repeated fact that ID is about design detection where identification of the designer is specifically excluded as beyond its scope. ID is about detection of design, not design plus the identity of the designer.
But more fundamentally, Musgrave seems to think that ID has to show it can distinguish between RV + NS and human-designed sequences. ID denies in the first place that the non-human originated sequences were entirely the result of RV + NS, so discrimination of the human-designed sequences is not required of ID. To say ID must distinguish the human-designed sequences from the others assumes the others came about by RV + NS, so this “challenge” is a massive begging of the question, of assuming what is in dispute.
Other problems with the “challenge” that have been pointed out include that the organism involved is not identified and therefore it can’t be examined to determine what function (specification) the sequence might have. As Patrick remarked, “design detection does NOT happen in a void; thus the spurious set of directions to determine ‘what the designed sequence does’ based upon the sequences alone” is an unreasonable constraint.” Also, each sequence is too short for reliable design detection in the first place.
CRAIGVENTER
TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA
VENTERINSTITVTE
TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAGTTAACTAGCTAA
HAMSMITH
TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA
CINDIANDCLYDE
TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTAGCTAATGGGTCGAT
GTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATG
GLASSANDCLYDE
TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA
Do I win?
(P.S. Previous message from:
http://www.telegraph.co.uk/ear.....ome101.xml
The math is quite simple. I did it but briefly in the previous thread, but only noted the result.
Whenever prior uncertainty of recipient can be expressed as a number of equiprobable alternatives N, the information content of a message which narrows those alternatives down to one is log2^N (the power to which 2 must be raised in order to yield the number of alternatives N). If you pick a card from a normal pack (52 cards), a statement of the identity of the card carries log2^52, or 5.7 bits of information. In other words, given a large number of guessing games, it would take 5.7 yes/no questions on average to guess the card.
Computer information is held in a sequence of noughts and ones. There are only two possibilities, so only 1 informational bit is required to represent this information. DNA carries information in a very computer-like way, and we can measure the genome’s capacity in informational bits. DNA doesn’t use a binary code, but a quaternary code. The unit of information in DNA can be T, A, C or G so it takes 2 informational bits to represent it.
The total capacity of a genome that is actually used is still not the same thing as the true information content when compression is taken into account. RNA code is read in triplets. There is a frame which moves along the RNA sequence, reading off three letters at a time. Frame-shifted reading can allow two messages for the price of one (supposedly, you could even get three messages), by having a completely different message embedded in the very same series of letters when read frame-shifted. The ENCODE results noted on UD a while back looked into this complex, interwoven network. But for the particular case of Musgrave’s challenge I could not take information compression into account since I only had partial genome sequences to work with. Never mind what Dave noted, that “none of the six sequences begin with a start codon which means we aren’t given enough information to even frame the sequence into codons”.
Anyway…with that out of the way (and thanks to Dawkins) it’s a simple matter to count the number of characters in each of the 6 sequences. It’s 240, so 240*2=480 informational bits at a minimum per sequence.
I also asked “did Musgrave purposely pull these sequences from the Venter sequences, an instance of design?” Given that 4 exact sequences were copied and pasted from the genome I said, “A minimum of 1920 informational bits seems to say so.” 480*4=1920. Simple. I also briefly noted other hypothetical scenarios where the EF could be used.
vjtorley (#15):
you make some interesting points, and I would like to comment a little about them.
With your example of the cake recipe you make a distinction, as far as I can understand, between a “symbolic”, that is linguistic, message, and a purely functional specification. In general, I agree with you: although both are specifications, either the linguistic or the functional one, and therefore both can point to a designer if there is a sufficient level of complexity, I agree with you that we don’t expect to find linguistic specifications in DNA. DNA specifications are purely functional.
But, probably, it’s not as simple as that.
First of all, we have at least one fundamental kind of linguistic specification in the genome, and that is the DNA code itself. We must acknowledge that the DNA code, which gives to each triplet a meaning, is a purely symbolic code. As far as I know, there is no biochemical reason why a triplet should code for an aminoacid or for another one: the “meaning” of the triplets is purely symbolic, and it is based on the correspondence between the triplets in the messenger RNA and the corresponding triplets in transfer RNA. Or, for start and stop signals, on other correspondences built in the transcriprion mechanism itself.
So, the code in DNA is highly symbolic. It is, indeed, a “code”, and codes are a typical creation of intelligent beings.
But there is more. Many of the activities of proteins in cells and organisms are purely symbolic. It is true that some proteins have real primary biochemical goals, in other words they are real “effectors”. Consider, for instance, DNA synthase, or any enzyme in fundamental metabolic pathways. Such proteins are needed because what they do is essential for basic cellular activities.
But consider, instead, the proteins involved in messaging: for instance, hormones and cytochines, which have the task of carrying specific messages to distant cells, or the proteins in transmission pathways, which carry messages from the membrane to the nucleus. In these cases, the proteins involved have nothing to do with the real, final result. The final effectors are, usually, those magical proteins whose general name is “transcription factors”, and whose regulation and mechanisms of action are still very poorly understood.
But cytochines and the proteins of cellular transmission pathways, instead, have a purely symbolic function. They, literally, transmit messages. They are part of an abstract communication network. They are, in a sense, linguistic.
Finally, even the basic example of how DNA codes for proteins is not completely different from a linguistic structure. Indeed, proteins “are” linguistic structure, whose meaning is completely dependent on the context. Let’s consider, for instance, an enzyme. In itself, it is not functional. An enzyme can accomplish a specific function “only” if it is in the right context: it must be in the right solution medium, with the right pH, at the right concentration, and its substrate has to be present. Otherwise, an enzyme would be totally inert, and its precious structure, so painfully built out of an immense search space of possibilities, would be completely void of meaning. So, protein function is dependent of context. It is, again, a meaning in relation to other meanings.
But there is more: any enzymatic function, even if accomplished in the right biochemical context, is of no utility, unless it is part of multiple meta-contexts of meaning. Of what utility would glicolisis be, if it were not coupled to ATP formation? And you can think for yoursef billions of other examples.
An there is still more. We have considered, here, only immediate functions. Even message-carrying proteins, in a sense, are contributing to a specific response, an immediate event. But we have to remember that, in cellular life, everything is controlled at many interacting levels, and control is much more than immediate function. A control network is able to coordinate, modify, measure, choose between different behavirous, and in general implement “abstract” principles, whose mathematical understanding is often elusive even to us. To me, that is language. Mathematics is, in a sense, a very high language, although very different from common verbal languages. Computer programming is a language, but if you express it as a “low level” code, it is difficult to recognize the synthax, and you get the impression of a purely “functional”, mechanic information.
So, to go back to your point: yes, the specification in the genome is functional, and not verbal in the usual sense; but it is a kind of function which, for its same alphabet, complexity, structure, elegance, efficiency and form, is extremely linguistic in nature. It speaks of design, of intelligence and of creativity with a strength and power and beauty which no specious materialistic denial can ever cancel.
#23 gpuccio
Computer programming is a language, but if you express it as a “low level” code, it is difficult to recognize the synthax, and you get the impression of a purely “functional”, mechanic information.
I strongly agree with your argument. DNA information has all the characteristics of symbolic and linguistic languages, and it’s COMPLETELY independent on the supporting media (aa sequence) in the same manner as the symbolic and linguistic information of a text is independent on the chemical constraints put on the arrangement of ink molecules on the sheet. And, as does occur in ALL symbolic and linguistic messages, the main problem i to know the syntax and semantics of the language. And this is the reason why Musgrave’s challenge is pretty ridiculous, It’s like a linguistic ignorant person would have challenged linguists in the XVIII century to find any syntax and semantics meanings in the Egyptian signs.