6 February 2009
FAQ2 Is Open For Comment
Barry Arrington
FAQ1 has been revised in response to comments. The floor is now open on FAQ2
2] No Real Scientists Take Intelligent Design Seriously
Yes, they do. For simple instance, in telecommunications work, we start by distinguishing the intelligent signal from the naturally occurring noise that tends to garble it. Indeed, simply by reading this web page, you implicitly recognize that a sense-making message is far more likely to be the result of deliberate action, not noise. But, strictly speaking, it is physically possible – though vastly improbable — for this page to be the result of noise garbling and mimicking signals. In short, you are using a simple form of The Explanatory Filter used by Design Theorists to discriminate chance from design.
Such theorists are qualified scientists, and they plainly take ID very seriously indeed. So, even though many other scientists may object to their work, science is not settled by majority vote. (That would be the logical fallacy of making an improper appeal to authority.)
For, in the end, scientific ideas must stand or fall based on their own merits.








1
B L Harville
02/06/2009
2:24 am
Is the “explanatory filter” an actual mathematical filter or is it based on hunches like “CSI”? (ID researcher A: “I think this thingy has high CSI.” ID researcher B: “No, I think it has low CSI.” ID researcher A: “But you missed the secret encoded message – see?” ID researcher B: “Oops, my bad.”)
If you expect intelligent design to be taken seriously as science you need to have actual mathematical models instead of guesswork, or wishful thinking, backing it.
2
Apollos
02/06/2009
2:51 am
uggcaugcuacuugagcuaauugagcuucuucu
3
Upright BiPed
02/06/2009
3:12 am
Harville, if you felt like venting your spleen, then you picked the wrong place to do it.
4
kairosfocus
02/06/2009
6:16 am
BLH:
Can you identify a case of at least 143 ASCII characters in contextually responsive and correct [grammar, spelling, etc] English text that is the result of lucky noise mimicking a message?
If you cannot, you aptly illustrate — by having responded above as though the alleged post is a real message — that you know, understand and routinely use the explanatory filter in intuitive form. (Just as the answer Barry A highlights above mentions.)
So, your objection is self-referentially inconsistent selective hyperskepticism.
Moreover, you appear to be ignorant of the root of the CSI concept, which for instance the glossary linked above and to the right outlines.
By the 1970’s – 1980’s, OOL researchers such as Orgel, Yockey and Wickens were identifying a distinguishing concept that marked the difference between:
The only known, observed source for class 3 is: intelligence.
Thus, ID legitimately sees CSI — per family resemblance to the above — as a reliable sign of intelligence. One that it therefore legitimately studies using the methods and principles of science.
And in so doing, as mentioned in the thread on Qn 1, a table of 35 values of CSI as measured has been published in the peer reviewed literature by KD et al. For instance, for Flu PB2, with 608 amino acid residues [aa], which has 1,692 sequences with 2,628 bits in the null state, these “real scientists” measured and calculated FSC 2,416 Fits, and FSC density 4.0 Fits/aa. (Fits — functional bits — is a valid metric of CSI. [And metrics, while plainly objective, are in general not unique.] )
GEM of TKI
5
Joseph
02/06/2009
7:43 am
No real scientist has ever provided a testable hypothesis for blind, undirected, ie non-telic processes.
Ya see B L Harville, it is the anti-ID position that cannot be supported via scientific methodology.
That is all that has to be done- that is to actually support the non-telic position with actual data and observations.
As for the explanatory filter- it is just a process tat forces the user to consider alternatives to design FIRST. Design is only INFERRED once the alternatives have found wanting AND a specification is met.
And even then it is only an INFERENCE. As with ALL scientific inferences the design inference can be either confirmed or refuted with future research.
So my response to FAQ 2 is that the scientists who do not take ID seriously should put up or shut up…
6
Antwerpenaar
02/06/2009
7:47 am
I’d like to read further on this. You note that FITS is a valid metric of CSI – can you perhaps point me to a literature source where this correlation is established?
Thanks!
7
Lutepisc
02/06/2009
8:15 am
With gratitude and respect for those who are working at developing the FAQs, I stopped reading this one after “For simple instance, in telecommunications work, we…”
The question is whether “real scientists” take ID seriously. So the reader is expecting some “real scientists” to be identified, who take ID seriously. Instead, the author of the FAQ indicates that s/he is a telecommunications worker of some kind. I’m guessing that most readers who actually have the question in mind will consider it answered right there.
The nice, strong start (”Yes, they do.”) needs to be supported straightaway with examples. Instead, it looks to me like you’re still answering FAQ #1: “Is ID science?”
My two cents…
8
JT
02/06/2009
8:26 am
I would say that noise is not an absolute concept. If someone embeds a hidden text message in a graphics file then everything in that file but the message is noise to the person looking for the message. If its a picture of a human being its still noise. If you’re searching in a domain for anything that that has a certain set of properties then everything that doesn’t have those properties is noise to you. I would say that the airwaves are filled with potentially intelligible messages but its all noise to someone looking only for messages only on a particular band. To a skin mite crawling on a human being looking for food, the human being is noise, not an intelligible message. To return to the example of some sort of radio antenna, everything except what its capable of detecting is noise as far as its concerned.
9
JT
02/06/2009
9:00 am
[4]: ATATATATATATAT — periodic, uninformative order
I believe that with the explanatory filter, this would indicate design also, if no mechanism was apparent to have caused it. The conclusion would be that it could not be chance, (as you could not have a series of coin flips like that) and then if you weren’t aware of a mechanism that caused it you would be justified in saying “design”.
10
StephenB
02/06/2009
9:09 am
—-Lutepisc: “The nice, strong start (”Yes, they do.”) needs to be supported straightaway with examples. Instead, it looks to me like you’re still answering FAQ #1: “Is ID science?”
You have a point. When we list the names, the critics simply answer by saying that they are not real scientists because “ID is not science,” which was, indeed, the topic of question #1
Let’s begin with Guillermo Gonzalez, whose groundbreaking work, “The Privileged Planet,” sent shock waves throught the Iowa State lecture halls.
We will continue with Michael Behe, biochemist, trailblazer, and author of the “Edge of Evolution.”
Moving right along, we can discuss Professor Robert Marks, of Baylor fame.
If everyone can agree that these men are “real” scientists, in spite of their institutional heresy, we can be off and running.
11
Adel DiBagno
02/06/2009
9:09 am
This is an important question, so it should be answered as clearly as possible.
This is unclear to me. Please explain how one ‘implicitly’ uses a procedure called The Explanatory Filter, let alone ‘a simple form’ thereof.
In my humble experience, one of the best ways to convey a concept or procedure is by giving one or more good examples. In the case of a procedure, worked-out examples are needed.
12
Barry Arrington
02/06/2009
9:10 am
Lutepisc, I think your points are well taken.
13
Adel DiBagno
02/06/2009
9:15 am
Sorry for the digression, but JT [9]:
For that matter, how about poly(A)?
14
kairosfocus
02/06/2009
9:19 am
Folks:
Following up briefly.
1] Fits:
try here as a start. Previous link goes to the Table 1 of results.
(More generally, most of the time when we use real world bits we are using them in a functional context.)
2] Joseph: As for the explanatory filter- it is just a process that forces the user to consider alternatives to design FIRST. Design is only INFERRED once the alternatives have found wanting AND a specification is met.
Correct.
As is the point that the inference is falsifiable in principle but well supported in fact.
3] Lute: the author of the FAQ indicates that s/he is a telecommunications worker of some kind [and by implication NOT a "true scientist"] . . .
Last time I checked, Information Theory [the foundation of modern T'comms since 1948] is an acknowledged Science. Indeed, there is credibly also a very direct link from Info Theory to Entropy in Statistical Thermodynamics, as Brillouin, Jaynes, Robertson and many others have shown. And Stat ThermoD is at the heart of a lot of Physics.
Physics, being the archetypal science.
Also, (i) information, (ii) signal/message and (iii) noise is a foundational cluster of concepts in that theory.
Indeed, signal-to-noise ratio and related constructs and measurements, derive from precisely the difference between functional signal and garbling noise.
Nor is the challenge of decryptation an answer to the quesiton as to whether (and by what warrant) one may freely dismiss a complex, functional signal as most credibly the result of noise. [That is, there is anomaly between Info Theory and Stat thermodynamics on one hand and the evo mat schools of OOL on DNA on the other. This needs to be resolved, not dismissed by playing the "no true Scotsman" card.]
Information theorists are real scientists doing real science: observations, hypotheses, differential prediction of alt hyps, empirical testing on concrete physical entities, etc. And, they — and their SETI colleagues — take signals and info and noise quite seriously.
Moreover, ID as it addresses biology is in fact an extension of information theory — DNA is a digital data string after all — and qualified, practising scientists of many stripes do take it seriously (even if they may not acknowledge or recognise it).
Unless, you are happy to indulge the “no true Scotsman” fallacy, that is.
4] JT: If someone embeds a hidden text message in a graphics file then everything in that file but the message is noise to the person looking for the message
Not at all, JT: there are usually non-message headers and trailers that play important but non-message roles. Cf the TCP/IP protocol for illustrative example.
Next, the issue is not potential messages that would emerge if we had access to decoding algorithms, but already identified messages, vs noise. To recognise and act on message implies that one has taken it as more plausible that an apparent message is a purposeful, directed contingent artifact, not the mere result of undirected contingency, i.e. chance giving rise to noise. (Even though, strictly, noise can logically and physically mimic any signal.)
ID is a science that addresses the question: how do we make that distinction, and how can we warrant the making of such a distinction?
The answer lies in reliable — as opposed to absolute — signs of intelligence.
5] Examples:
This answer was intentionally brief. So, it started with the closest possible example: what we all do everyday as we work with Internet-linked PCs.
The implication is, that if we then arbitrarily pick and choose which cases of the EF leading to the inference to design we are wiling to accept, then it says a lot about selective hyperskepticism and question-begging.
GEM of TKI
15
JT
02/06/2009
9:21 am
Adel – I don’t see how responding to me is a “digression”. (I was quoting KF from 4).
What is poly(A)?
What in my remarks indicated I might be technically expert in whatever field you’re alluding to?
16
JT
02/06/2009
9:45 am
KF [14]:
The only rigorous way to distnguish randomness from nonrandomness in an I.D. context is by detecting algorithmic compressibility, i.e. an identifiable pattern of any sort whatsoever.
You can never say with certainty something is not compressible, so you can never say with certainty something is random noise. So if you can’t say with certainly something is noise, how can you distinguish non-noise from it? What if nothing is noise?
And even if something is compressible, any kind of compressibility (any “pattern”) is as good as any other, at least in the I.D concept, or rather what has actually been formalized in the ID concept. So a string of all 1’s indicates nonrandomness to the same degree as a string encoding a human being (This is in response to your remarks in [4] regarding the three categories of signals.) There is no formal method in ID to distinguish something caused by a mechanism versus something caused by “design”.
17
StephenB
02/06/2009
9:53 am
I believe that the proper direction for this thread should procede as indicated by Lutepisc @7, myself at @10, and Barry A @12.
While all the technical points are relevant, valid and helpful, we do need to take hold of the main theme implied, which is less about WHAT/HOW and more about WHO!
18
Green
02/06/2009
9:57 am
The nice, strong start (”Yes, they do.”) needs to be supported straightaway with examples. Instead, it looks to me like you’re still answering FAQ #1: “Is ID science?”
I agree with Lutepisc at #7 here.
19
kairosfocus
02/06/2009
9:59 am
Steve
Should we be thinking about giving a list? [Thence, issues of criteria -- which harks back tot he Q1 and onward Qs. In short, part of the issue is that no one Q stands fully by itself. Esp. when the answer is self consciously a quite brief one.]
G
PS:
Mere links don’t work, too: those who most need them seemingly refuse to follow them.
20
kairosfocus
02/06/2009
10:01 am
JT @ 16:
Nope, we are talking biology mostly.
And the obvious thing is by function, function that as seen requires complexity beyond a reasonable threshold.
G
21
Adel DiBagno
02/06/2009
10:02 am
JT [15]:
I am sorry, I meant a possible digression from the thrust of the FAQ2.
And I apologize for incorrectly assuming that you would understand my reference to poly(A).
It is polyadenylic acid. A Google search for ‘poly a’ will elicit a Wikipedia article that reviews the biological significance of this stuff:
I hope that helps. My minor point is that even a homopolymeric sequence that looks meaningless can have meaning in a certain biological context.
22
Lutepisc
02/06/2009
10:08 am
Hi, StephenB. You make a great point.
You wrote:
Was Galileo a real scientist? Was Copernicus? Real scientists are sometimes led by the evidence to espouse unpopular positions. Some have the courage to put their reputations and careers on the line. Such actions do not repeal their credentials as scientists. On the contrary, in hindsight we can acknowledge their integrity with gratitude. “For, in the end, scientific ideas must stand or fall based on their own merits.”
To names like Gonzalez, Behe, and Marks, we can add the more than 700 scientists who have been brave enough to publicly acknowledge their doubts about the received neo-Darwinian orthodoxy. We can also list Axe, Minnich, Meyer, Wells, etc., etc.
(I think answering this question can give us a slam dunk.)
23
kairosfocus
02/06/2009
10:10 am
PS: A thought.
What if we put in a link as follows:
The link of course goes tot he list of peer reviewed and peer edited articles and books etc at DI’s CSC.
So, if we are serious, we can see the qualifications and he professional grade work for ourselves.
Lute, what say you to that?
G
24
StephenB
02/06/2009
10:23 am
—-KF: “Should we be thinking about giving a list? [Thence, issues of criteria -- which harks back tot he Q1 and onward Qs. In short, part of the issue is that no one Q stands fully by itself. Esp. when the answer is self consciously a quite brief one.]”
In my judgment, each question is both distinct and part of the whole. While each depends somewhat on the other for completion, each should also make its own case in its own context.
In any case, the list of ID-friendly scientists is not all that short. From my last reading, over 600 well-trained scientists have publically questioned the neo-Darwinist model and signed a well-publicized testimonial to that effect. For every one of them there are probably ten more who would do so if they had the courage.
Real scientists really do take intelligent design seriously, and I think that point needs to be made with sufficient functional integrity without hearkening back to the argument that ID is really science. The point is not whether we believe it; the point is whether anybody else does. The answer is YES. ID is both [A] legitimate and [B] in the minority. The key point is that [B] does not disconfirm [A]
25
tribune7
02/06/2009
10:50 am
KF, I was going to suggest a link.
Of course, the Discovery Institute will invariably bring accusations of “hidden agenda” “wedge document” yadda yadda.
Can we develop a list of scientists with indisputable achievements — Mims, Damadian and Sanford come to mind off the top of my head — that support or have spoken in defense of ID? If they are not directly affiliated with the DI, that would be a plus.
Note this is not a slam at the DI, which is a great organization. This suggestion is merely to consider being proactive against potential lines of red-herring criticism, to show we are not a narrow movement, and to emphasize we are about science and not politics.
26
Joseph
02/06/2009
11:09 am
Is ID science?
If by “science” one means is ID based on observation, testable via experimentation and an inference based on deductive reasoning given that data, then yes, ID is science.
However if by “science” one means the universe and life have to be explained solely by non-telic processes, then ID is defined out of “science”.
That said a list of scientists who take ID seriously should be included.
It would also be a good thing if someone could get a survey of the anti-ID scientists- those who do NOT take ID seriously- to find out exactly why they feel that way.
Then the FAQ could also address those points.
That’s a nickel’s worth…
27
bFast
02/06/2009
11:25 am
I think that the defense of the “scientists don’t…” is really weak.
The stated argument, “No Real Scientists Take Intelligent Design [in any field] Seriously” is not the argument that detractors are making. Rather, the accurate complaint is:
As such the formal response totally misses the point.
As far as the list of 600 or so dissenting scientists goes, well, I believe that the counter to that is the list of biologists named “Steve” who support naturalistic evolution.
When you add to this the fact that very few on the list of dissenters are researchers in a biological field, it makes the case even stronger.
In truth, the biological scientific community is (or at least presents as) overwhelmingly unimpressed by the ID position.
While it is true that science should not be a field driven by consensus, it is also true that a very strong consensus exists supporting naturalistic biological origins.
28
R0b
02/06/2009
11:36 am
I would point out that communications theory doesn’t distinguish between intelligent and unintelligent sources. In Shannon’s model, the message is whatever you’re interested in, and everything else is noise. They may both come from unintelligent sources, or both come from intelligent sources, as when two people are talking on the same channel.
I suppose we could argue that error correction encoding necessarily comes from an intelligent source, and such encoding allows us to separate the message from the noise. But we don’t separate the two by recognizing that one is intelligent and the other is not.
29
R0b
02/06/2009
11:44 am
FAQ:
The EF hinges on the premise that intelligence/design is not reducible to necessity and chance. Not everyone assumes that, so apparently not everyone uses the EF.
I suspect that some people reason as follows: This looks like English text, many humans speak English, no known non-human speaks English, so the text probably came from a human. Insofar as humans are intelligent, the text comes from an intelligent source.
Note that this reasoning doesn’t require any metaphysical assumptions regarding the nature of intelligence. Note also that this reasoning differs from the EF in that the EF doesn’t ask the question: Does this look like the stuff that known designers (humans) are known to produce?
30
R0b
02/06/2009
11:50 am
FAQ:
I agree with others on this thread that this claim could be made more concrete by naming these design theorists who are qualified scientists, and providing references that demonstrate them using the EF. I’m curious how many references could be provided.
31
StephenB
02/06/2009
12:15 pm
—-Rob: “I agree with others on this thread that this claim could be made more concrete by naming these design theorists who are qualified scientists, and providing references that demonstrate them using the EF. I’m curious how many references could be provided.”
No, you are trying to justify the irrelevant second clause of your sentence by appealing to the relevant first clause. The EF filter has nothing to do with identifying scientists who support intelligent design.
32
StephenB
02/06/2009
12:19 pm
—-”While it is true that science should not be a field driven by consensus, it is also true that a very strong consensus exists supporting naturalistic biological origins.”
Which clause in that sentence did you mean to emphasize, the first or the second? Either science should be driven by consensus or it should not be driven by consensus. Are you proposing to reconcile the two points?
33
damitall
02/06/2009
12:27 pm
I think the question that is actually asked out in the real world is “why, given that ID is a science, do so proportionately few biological scientists take ID seriously?”
Those who regard it as a science obviously take it very seriously; why not the rest?
34
bFast
02/06/2009
12:30 pm
StephenB, “Either science should be driven by consensus or it should not be driven by consensus.”
Science should not be driven by consensus.
There is consensus.
There is no conflict in this statement.
35
StephenB
02/06/2009
12:32 pm
—-”The stated argument, “No Real Scientists Take Intelligent Design [in any field] Seriously” is not the argument that detractors are making.”
We are responding to a frequently raised objection exactly as it is put to us. Part of the exercise is to point out that many of these objections are irrationally based and rhetorically charged. To reframe the question in a rational way is, in part, to excuse the mindlessness of the charge.
36
SteveB
02/06/2009
12:32 pm
What is meant by “take seriously?” If it means “accept” or “believe in,” then the list includes those already mentioned (ie Behe) and is relatively short.
On the other hand, if it means mobilizing forces to mount a defense, then the list is much longer and certainly includes Dawkins, Orr, Miller, Pinker, Levine, Shermer, Coyne, Meyers… and on and on. In fact, it’d be interesting to see which of the big names associated with evolutionary biology have not written journal articles, blogs, and op-ed pieces denouncing ID.
If it is true that troops and materiel are generally only mobilized when a threat is percieved as real, then it would seem that all these guys take ID seriously.
37
StephenB
02/06/2009
12:39 pm
—-bfast: “Science should not be driven by consensus.”
—-”There is consensus.”
—-”There is no conflict in this statement.”
What, then, is your point in dramatizing this point: In truth, the biological scientific community is (or at least presents as) OVERWHELMINGLY unimpressed by the ID position.
Either that point is decisive or else the point that science cannot be driven by consensus. If you are going to argue for something then pick one. You can’t argue for both at the same time.
38
DaveScot
02/06/2009
12:43 pm
Appeals to authority aren’t fallacies if the authority is legit. In this case many of them are indeed certified authorities in the relevant fields. The fallacy is argumentum ad populum also known as the bandwagon fallacy.
39
R0b
02/06/2009
12:44 pm
StephenB:
When I talked about “providing references that demonstrate them using the EF”, “using the EF” was intended to refer to “them” (the scientists), not the FAQ writers who are identifying these scientists. Sorry for the confusion. In other words, the claim that qualified scientists use the EF can be established by providing references to work in which such scientists actually use the EF.
40
bFast
02/06/2009
12:50 pm
StephenB, “Either that point is decisive or else the point that science cannot be driven by consensus.”
I said “Should not” not “cannot”. Unfortunately there is a vast difference between two statements with this one small change.
That said, my fundimental argument is that there is truth in the general view that there is a scientific consensus in favor of natural origins, and in opposition to ID, however, the fact that this consensus exists is made irrelevant by the fact that science should not be driven by consensus.
Is there an anti-ID consensus amongst biologists, yes. Is that important, not really. Consensus is, or should be, irrelevant.
41
jerry
02/06/2009
12:54 pm
“ATATATATATATAT”
I believe this is just periodic repeating data and as such is common in nature due to law like behavior. Also it is not very complex and for both reasons would be rejected by the EF even if it was designed. But either way it has nothing to do with the topic.
42
R0b
02/06/2009
1:03 pm
Obviously consensus does not logically prove anything (see DaveScot’s reference to argumentum ad populum). But what should drive science? How should we decide who gets funded and what gets taught in academia?
43
gpuccio
02/06/2009
1:09 pm
Well, my personal thoughts on this.
1) I do agree that we could add a short list. To the names already cited, I would add Abel and Trevors for their work on functional information, and Durston and Chiu who, together with Abel and Trevors, have published the paper linked by KF, “Measuring the functional sequence complexity of proteins”, which remains IMO one of the best examples of ID related biological research in the literature, together with the work of Behe and Axe. And I think Berlinski could be added too.
2) About consensus: nobody is denying that there is some scientific consensus at each specific moment of history on different scientific theories. We are only denying that such a consensus means the the theory receiving it is necessarily right. That’s not true. And that’s why minority theories, which are not supported by the general consensus, are extremely important, and thet must always exists and be respected. What is a minority theory today could be a consensus theory tomorrow, and yet that would not mean that it is the best available theory. In a sense, we can never be absolutely certain that a scientific theory is the best, or that it is correct. But I believe that, if we have some faith in the general progress of knowledge (which is a purely personal choice), we could assume that, in the long range, the general consensus will be nearer to a good interpretation of scientific knowledge. We in ID, obviously, are convinced that the general consensus given today to bad theories like darwinian evolution (and, I would add, strong AI) is not a good sign of the present status of scientific attitude.
So, in brief, my point is: consensus has to exist, but science should not be driven by it.
3) Regarding other topics which have been touched here, but which are not strictly pertinent to FAQ2, some brief comments:
a) Again, confusion arises about different forms of specification. JT states:
“I believe that with the explanatory filter, this would indicate design also, if no mechanism was apparent to have caused it. The conclusion would be that it could not be chance, (as you could not have a series of coin flips like that) and then if you weren’t aware of a mechanism that caused it you would be justified in saying “design”.”
and then:
“The only rigorous way to distnguish randomness from nonrandomness in an I.D. context is by detecting algorithmic compressibility, i.e. an identifiable pattern of any sort whatsoever.”
But compressibility is not the only form of specification And it is of no importance in biology.
I can agree that, in Dembski’s scenario about CSI, a highly compressible sequence, like repeated ATATATATATATAT or poly(A), can be interpreted as design if no necessity mechanism can explain it. That is, IMO, true, but I would never spend a word about it (I leave it to Dembski), because, being interested, like most of us, to the biological aspect of ID, that kind of specification is not relevant. In biology, information is not specially compressible. But it is functionally specified.
So, the sequence of a protein coding gene is specified not because it expresses some strange internal structure which could be generated by an intelligent algorithm, but because it corresponds symbolically to the aminoacid sequence of a functional protein. In the same way, this post is functionally specified not because it is compressible (though, in some measure, it probably is), but it conveys a specific message to those who understand english. That is functional specification. That is the kind of specification we find in biology. It is functional, digital, symbolic specification. It is clear, simple to understand, easy to deal with. Please, let us stay tuned on this concept.
Even if Dembski has been speaking of other kinds of specification, I really don’t believe that, when he speaks of proteins, or of biochemical machines like the flagellum, he is asserting anything different from functional specification.
So, to be brief: I don’t know if poly(A) exhibits CSI or not: if we are absolutely sure that the sequence cannot have arisen in the system by necessity (ie, by an enzyme which can only create poly(A) sequences), it can be interpreted as designed, but we will have to ask ourselves why a designer wanted to create a poly(A) sequence. In itself, a poly(A) sequence is not functional. But anything can be functional if it exists in the right context: for instance, any sequence of letters can be functional if it is the password for something, but in that case it’s the structured environment which codes it as a password which is at the origin of its functionality.
Proteins are different: even if they need a context, the biological environment (I strongly believe that no function can be defined out of some context), their functionality does not depend “only” on the context, but is strongly related to objective laws of biochemistry. A protein is not a password: it is not functional only because somebody has conventionally assigned to it a role. A protein is functional because its sequence exploits the laws of biochemistry to fold orderly in some specific way, and to interact very specifically with other molecules to bring about some useful and extremely unlikely result. In other words, it is a structured machine, not a conventional symbol.
But the DNA sequence which encodes the protein, that is really a symbolic object: its function is to encode a function, but in itself the DNA molecule is non functional, except for that symbolic storage of information. It can be only “read”, not “used”.
So, I recommend that we stay tuned to this restricted subset of CSI in the following discussion, because that is the only relevant one for our purposes.
And I would suggest that those who are interested in CSI and its measurement in biology stay tuned not only to the discussion about our FAQ, but also to the parallel thread where Kirk Durston is trying to develop an orderly treatment of the subject. After all, he is a good example of a scientist who takes ID very seriously.
44
gpuccio
02/06/2009
1:13 pm
R0b:
“Obviously consensus does not logically prove anything (see DaveScot’s reference to argumentum ad populum). But what should drive science? How should we decide who gets funded and what gets taught in academia?”
It’s rather simple, IMO. Consensus theories will obviously be taught, and will receive most funds. But minority theories, if they are seriously based, should be taught too, for what they are: minority theories. And they should be allowed to received minority funds.
Have you ever heard of the concept of democracy and pluralism? That should work in science too.
45
StephenB
02/06/2009
1:14 pm
—-bfast: “That said, my fundimental argument is that there is truth in the general view that there is a scientific consensus in favor of natural origins, and in opposition to ID, however, the fact that this consensus exists is made irrelevant by the fact that science should not be driven by consensus.”
I’ll buy that.
46
R0b
02/06/2009
1:14 pm
jerry:
According to Dembski’s usage of the term “complex”, whether this pattern is complex or not depends on which null hypothesis you choose.
47
R0b
02/06/2009
1:29 pm
gpuccio, your answer in [42] was excellent. My only caveat would be in regards to teaching minority theories. There are an awful lot of minority theories out there, and their adherents inevitably consider them to be “seriously based”. So it seems that a theory should meet a threshold, in terms of how many credentialed scientists buy into it, in order to be taught in public schools. We’re then left with deciding what that threshold should be and whether ID meets it.
48
bFast
02/06/2009
2:03 pm
ROb:
I beg to dissagree. It seems to me that the standard of whether a minority theory is discussed should be based upon students’ awareness of the theory.
Consider astrology. Why should a science teacher avoid a serious discussion of astrology in a science class if the students are so inclined? Let the students explore the scientific evidence for and against astrology. Let ‘em write a paper. Let the teacher present some research that puts astrology in an honest scientific light. Let the students discover not the conclusion that scientists come to, but the evidence that drives them to that conclusion. If the evidence is good enough, if it is presented clearly enough, no-one in the class will believe that astrology is scientifically valid. However, they will not have astrology removed as an hypotheis by “authority”, they will have it removed by evidence.
If the evidence opposing an hypothesis is good, and if it is presented clearly, then the theory will not hold up in the minds of the students. If the evidence is not so good, well, then some of those students may make it their life’s mission to strengthen/weaken the evidence. Let science happen.
49
gpuccio
02/06/2009
2:13 pm
R0b:
“We’re then left with deciding what that threshold should be and whether ID meets it.”
I agree with that. And I am in no hurry that ID be taught in schools. I just wanted to make the point that important minority theories should be taught, even if they oppose the majority theory.
50
R0b
02/06/2009
2:14 pm
bFast[46], that’s an interesting pedagogical approach. I honestly don’t know how well it would work in practice. I wonder if there are any science teachers on this board who would like to comment on it.
51
gpuccio
02/06/2009
2:20 pm
bFast:
I don’t think you are saying anything really different. My point is that important minority theories should be taught as scientific theories, even if mynority ones. Other kind of theories, which are not in general considered scientific, can be taught as “non scientific” theories, just so that the students be aware of their existence.
If the scientific status of a theory is controversial (ID could be a good example), it is always possible to teach, realistically, that it is controversial. My only idea about education is that it should inform and especially stimulate active knowledge, but never indoctrinate.
52
Laminar
02/06/2009
2:32 pm
“So it seems that a theory should meet a threshold, in terms of how many credentialed scientists buy into it, in order to be taught in public schools.”
That’s an interesting point but should it be important to hold the right credentials?
Just to illustrate, if no scientists working in a certain field bought into a theory within their field, but lots of other scientists working in an unrelated field (as far as that is possible) did then should the theory be taught? My instinct would be to say no, at least not without conditions…
53
Khan
02/06/2009
3:10 pm
bfast[46),
that might be appropriate in a philosophy of science class, but in a science class where you barely even have enough time to cover the basics? in an intro chemistry class, for example, would you really want to spend a lecture covering alchemy at the expense of one covering, say, redox reactions?
54
Upright BiPed
02/06/2009
4:49 pm
In a thread that is to consider the sentence:
…there have been 12 references to the word “taught” and 6 references to the word “teach” and another 5 to the word “school”.
Typically these things can be tracked back to our friends from across the divide who love to visit here and sidetrack these threads. I am not so sure that isn’t the case again, but I don’t care to track it, and it doesn’t matter anyway.
Just a reminder: teach, taught, and school have very little (or nothing) to do with scientists taking ID seriously. Personally I don’t think UD managers have to go much further than the observations of Lute, GP, and others already on this thread.
Having said that, I would just add the answer to the question at hand is: Of course scientists take ID seriously”
Some scientist work on it directly (we know their names), others treat with an intellectual interest (we know their names). Some come to this very site and argue over it’s merits (we know their names) while others are so threatened by it, they actually set up websites with no intent whatsoever but to attack it in every way possible (we know their names as well).
It would be hard to conclude that scientist don’t take ID seriously. How many websites has the NCSE set up to attack alchemy?
The real issue is here IMHO is: It’s not about “scientists” or “consensus.” It’s all about the evidence. It always has been, and always will be.
The evidence is the only reason there is ID at all.
55
Lord Timothy
02/06/2009
5:27 pm
I think it is demonstratable that Behe’s arguments have been taken very seriously.
Otherwise what would be the point of this smokescreen?
http://waddle.uoregon.edu/?id=482
To demonstrate that we are taken seriously I it would be beneficial to list serious peer-reveiw attacks and scientific critiques made, (and our responses of course).
56
R0b
02/06/2009
5:45 pm
Upright BiPed:
Of course, falsifying the above claims requires only one scientist who takes ID seriously. That’s a bar that’s low enough to be cleared by all kinds of fringe ideas, including alchemy.
57
gleaner63
02/06/2009
5:56 pm
In my opinion, the statement “No real scientists take inteligent design seriously”, is odd all by itself. What, after all, is a “real” scientist as opposed to a “not real” scientist? If you could point to a real scientist who takes ID seriously, the response would then be, “okay, show me two scientists who take ID seriously”. There are real scientists who take the study of UFOs seriously and there are plenty of scientists who are creationists and it matters not one bit to those on the other side of the fence.
58
Upright BiPed
02/06/2009
5:57 pm
R0b,
I think there were some comments made earlier about your observation.
In any case, I am not aware of a institutional assualt on alchemy, perhaps you can point me to it.
59
bFast
02/06/2009
6:54 pm
Upright BiPed, “The evidence is the only reason there is ID at all.”
That’s quoteable. Its absolutely correct! And as long as it is correct, ID is true science whether the scientific community likes it or not.
60
Lutepisc
02/06/2009
8:19 pm
Wow. What Upright Bipod said @54!
How much do we hafta pay him to write the FAQ?
61
StephenB
02/06/2009
10:11 pm
—–ROb: “When I talked about “providing references that demonstrate them using the EF”, “using the EF” was intended to refer to “them” (the scientists), not the FAQ writers who are identifying these scientists. Sorry for the confusion. In other words, the claim that qualified scientists use the EF can be established by providing references to work in which such scientists actually use the EF.”
Actually, your original comment was perfectly relevant to the answer as given. I apologize for not reading it more carefully and thoughtfully.
62
jerry
02/07/2009
12:22 am
If we describe research or science that we believe is ID research and then find several scientists conducting the exact type of research that we designate as ID research does that count as scientists taking ID seriously. Even if they deny they are doing ID research.
For example, Kirk Durston cites a paper by Robert Hazen that is the basis for his work and that he, Durston, might be contributing to the same field. And if Hazen who is one of the premier researchers in abiogenesis does not think he is doing ID research but Kirk is doing almost the same thing and thinks he is then is Hazen not taking ID seriously? Suppose Hazen ends up discovering the final nail in the coffin.
If Hazen designs experiment after experiment that fails to get very far in moving abiogenesis along and then concludes that each failure adds a little bit more to the credibility of the ID proposition that an intelligence is behind the origin of life but still believes in a natural origin, is he taking ID seriously. Suppose another scientist is a committed Christian who also accepts that OOL could have natural origins and there are lots of those, then says that he still thinks it is possible that abiogenesis is possible but it is getting harder and harder to believe it. Is that a person who does not take ID seriously.
What I am getting at is that we do not need the overt backing of ID to make the conclusion that scientists are taking ID seriously. By the constant search for ways that will eliminate ID as an explanation they are tacitly admitting that they are taking ID seriously.
63
Seversky
02/07/2009
12:35 am
1) Has that position been stated as such by opponents of Intelligent Design or is it commenting on a strawman?
2) If anyone does believe that then the first and most obvious retort is that it is a clear example of the No True Scotsman fallacy.
3) That scientists in various fields make the presumption of intelligent design, in the sense of known human agency, is uncontroversial – the example of forensic science is one example is one that is often quoted – but that is not the same as implying those same scientists endorse Intelligent Design as proposed on this site, for example. The danger here is equivocation over the usage of the phrase “intelligent design”‘.
4) This is true, although you could point out that proposed The Explanatory Filter has yet to be fully ‘road-tested’.
5) While it is generally agreed that questions in science are not settled by majority vote, it should be noted that the fallacy is more accurately stated as an appeal to inappropriate authority.
On a question in the field of biology, for example, it is perfectly proper to cite the opinions of professional biologists and argue that they carry greater weight than those of non-biologists, even if they are professional scientists other fields such as quantum mechanics. By the same argument, we would take Barry Arrington’s opinion on a question of law as being more authoritative than that of Joe the Plumber, for example.
Exactly.
64
jerry
02/07/2009
12:40 am
I also fail to see the difference between faq1 and faq2. If we can establish that scientists are doing research that we would consider ID research it means they are actually doing ID research even if they do not admit it and they are taking ID seriously. Also if they are actively trying to falsify ID and failing, is that not also ID science and thus they are taking ID seriously? Thus, isn’t faq1 and faq2 really the same thing.
65
kairosfocus
02/07/2009
2:18 am
Folks:
Following up.
There is a clear desire for more fleshing out than was presented initially,a nd so the below is suggested for further consideration.
I should note that in Wk Arg 1, the focus was on teh SCIENCE of ID. In Wk Arg 2, the rhetorical fire shifts tot he scientists involved in ID (which is why the rebutting note that the objector — who is communicfat6ing using telecomms equipment and systems founded on info theory principles as well — is also using ID principles is cogent, as it exposes selective hyperskepticism and self referential inconsistency).
Suggested expansions, for comment (some links are of course not in this, given the posting limit):
_______________
2] No Real Scientists Take Intelligent Design Seriously
Yes, they do. For simple instance, as an initial analytical step in information theory and associated telecommunications work, we distinguish the intelligent signal from the naturally occurring noise that tends to garble it. (Otherwise, there would be no reason to have an Information Theory.)
Indeed, simply by reading this web page, you implicitly recognize that a sense-making message is far more likely to be the result of deliberate action, not noise. But, strictly speaking, it is logically and physically possible – though vastly improbable — for this page to be the result of noise garbling and mimicking signals. In short, you are already routinely using a simple, common-sense, intuitive form of The Explanatory Filter and other techniques used by Design Theorists to recognize and distinguish chance from design. (That is, you intuitively accept that function-specifying complex information is much more likely to be the result of intelligent action than of chance + necessity only.)
ID theorists have built on that powerful intuition (which traces back as far as Cicero, ~ 50 BC), in light of the well-established methods and principles of science and related mathematics.
Such theorists are qualified scientists, and they plainly take ID very seriously indeed, as may be seen from this list of peer reviewed and peer-edited papers — i.e., duly published in the relevant professional literatures. So initial ID theorists like Michael Behe, William Dembski, Charles Thaxton, Walter Bradley and Roger Olsen have been joined by a wave of other relevant professional level practitioners: e.g. Douglas Axe, Guillermo Gonzalez, Albert Voie, John A. Davison, D.W. Snoke, David Berlinski, Scott Minnich, Stephen Meyer, Jonathan Wells, Wolf-Ekkehard Lönnig, H. Saedler, Granville Sewell, David L Abel, Jack T Trevors, Richard Marks, David KY Chiu and (representing a yet newer generation) Kirk Durston. However, when we reflect on names like Gonzalez, Caroline Crocker and even the sympathetic [as opposed to supportive] journal Editor Richard von Sterrnberg, we also see that ID faces an extraordinary and unprecedented hostility within much of the scientific community; a hostility that is driven in significant part by an attitude that was revealingly stated by Richard Lewontin:
In short, a major reason that a “consensus” of scientists in Biology etc rejects or dismisses or tries to refute or even sometimes resorts to “expelling” ID and its practitioners, is the ongoing ever deepening institutionalization of the philosophy of materialism in recent decades within major science disciplines. But, as was already pointed out, such “a priori” imposition of materialism “does not allow the facts to speak for themselves,” so that “the search for truth is artificially narrowed and constrained,” resulting in massive question-begging.
As a direct result, the frequently encountered dismissal of ID practitioners is not so much driven by a fair assessment of the actual quality of their work in light of the best practice methods and principles of science, but is instead — sadly — a manifestation of the “No true Scotsman” fallacy; too often leading to strawman misrepresentations, ad hominem attacks, name-calling and the abuse of institutional power. So, even though many other scientists may object to their work, science is not settled by majority vote. (That would be the logical fallacy of making an improper appeal to (collective) authority and conventional wisdom. [Plainly, no authority or group of authorities is better than their facts, assumptions and reasoning.] )
For, the history of science makes it abundantly clear that today’s consensus is often tomorrow’s exploded theory. In the end, scientific ideas must stand or fall based on their own merits.
And, that’s all ID asks for.
________________
Now, does that capture the majority of concerns, within the constraint of being relatively concise and focussed on one aspect of a complex whole?
GEM of TKI
66
kairosfocus
02/07/2009
2:56 am
PS: I have not incorporated the Dissent from Darwin list as it seems to me that dissent from Darwin is not the same as addressing the focus of ID: the proposition that finite arrangements of matter in our observed cosmos can be reliable signs of intelligence.
67
gpuccio
02/07/2009
3:06 am
jerry (#62):
You make a very important point: scientists who take ID seriously are not only those who try to support it by new research, be it theoretical or empirical, but also those who try to falsify it by new research, indeed accepting at least part of its theoretical premises in the process. Hazen and Szostak are a very good example of that. Szostak, while being with Hazen one of the authors of the paper quoted by Durston on the other thread, is also the author of a very important (although IMO biased) reasearch about the functional space ofn proteins. So, these authors are doing serious ID research, even if with the hope of overturning ID.
Even Matzke or Miller or all those darwinists who have focused on the flagellum as never before seem to take ID very seriously, even if the interest of their extremely biased work is certainly much more questionable.
So, Jerry, you are perfectly right: ID is taken very seriously both from scientists who work for it and from scientists who work against it. Those who go on just stating that it is not science and that it should only be ignored, or at most fought by name calling and explicit persecution, are luckily an outdated bunch.
68
StephenB
02/07/2009
7:01 am
kairosfocus, I think your answer @65 captures the spirit of the question beautifully and trumps all previous attempts to improve on the answer.
As far as I am concerned nothing more needs to be said on the matter.
—–Seversky:
—–”Has that position been stated as such by opponents of Intelligent Design or is it commenting on a strawman?”
Yes, we are dealing with the objections exactly as they have been posed, which is one of the main challenges in answering them. The questions themselves have not been well thought out, and, in any case, are meant to muddy the debate waters.
69
tribune7
02/07/2009
8:58 am
KF, that’s a big improvement.
GP @ 67, you make a great point. One of the great ironies is the loud claims ID opponents make with regard to how it’s not science because it can’t be falsified, and the great steps they take to try to falsify it.
I think a lot of the problems come from the stuff that occurs outside science. Frankly, I have a lot more respect for a dissenter who says “what you are doing is interesting but I can’t buy it because of this and this and this” than someone who might agree perfectly with the evidence supporting a particular line of our reasoning but because he rejects our conclusion works behind our backs to keep ID papers from being published and ID proponents from having jobs.
70
jerry
02/07/2009
9:42 am
Everyone continues to miss my point in both faq1 and faq2. And I will continue to make it. Everyone focuses on the Dembski side of ID and ignores the Behe side which I think is more powerful. We constantly use the Edge of Evolution argument here to justify ID and yet we ignore it in these two faqs. And I think it is the stronger of the two areas for ID. Though the work of Durston seems intriguing and can be thought of as a bridge between Dembski and Behe.
Dembski’s work has been a millstone for ID not because it is not relevant and not because it is illogical but because it is too general to be proved mathematically. The concept of CSI is an attempt to assess all intelligent activity, not just biology. Because of this grand ambition we have gotten bogged down over just what is CSI and how to conclusively measure it and relate it from one phenomena to another.
When CSI is restricted to biology in the instance of DNA, the very intuitive and obvious subset falls out,FSCI. On the Durston thread he says that DNA, human language and computer software are the only examples known that fall into his functional complexity scenario. Yet with CSI we have to defend Mt. Rushmore, coin flips, bridge hands etc with the same precision. Which is the reason I suggested we abandon CSI in the first FAQ.
We continue to forget Behe though there was a little lip service after I became a nuisance and kept bringing it up.
I have two examples, one short and one long which I will post in another comment. The first is Behe’s own words and we can thank one or our nitwit antagonists, Jason Rosenhouse, for it.
Rosenhouse watched an interview on CSPAN of Behe shortly after his book was published in 2007. Behe was asked what type of research could be done to further his ideas in the Edge of Evolution. Behe said the type of work Lenski was doing with bacteria at Michigan State was appropriate research. Rosenhouse called Behe an idiot as these morons tend to do without even attempting to understand what Behe was getting at. But it was Rosenhouse who was making the moronic comments. He did not understand the implications of Behe’s comment.
Behe is saying that any researcher who is examining the reproductive events of an organism and cataloging them is doing ID research. Even Lenski who is an ID antagonist and would be offended to know that he is doing ID research. But Lenski is also cataloging the edge of evolution. So too is any other researcher that is cataloging the edge of evolution.
So in FAQ1 I would add Lenski as one who is doing ID research. And all like him. And obviously one who is taking his research seriously. And use Durston’s ideas that the functional proteins are so far apart and so rare in protein sequence space to justify both Behe’s work and Dembski’s but only the latter when it is restricted to biology and DNA.
71
jerry
02/07/2009
9:44 am
This continues my theme that investigating edge of evolution ideas is ID research.
Suppose:
Make believe I am a scientist. Call me Professor Per. I secretly support ID. I do work mapping the genomes of bovid mammals because many of these animals are domesticated and I get support for this from the government. I find a lot of similarities between them and with the aid of a lot of colleagues who do not know my ID leanings, determine that nearly all members of the group could have descended from a population of bovids that existed 10-15 million years ago. In other words there is fairly conclusive proof that this family has descended from a population with a gene pool much larger than any of the genera gene pools through micro evolution processes. And in this time period of 10-15 million years they did not develop any new functional systems or any proteins that could not be reasonably be due to small changes to a proceeding protein that was in the original population. In other words all 130+ species developed by simple Darwinian processes that could be replicated much quicker artificially if the scientists had access to the original gene pool and with an occasional mutation or two.
In other words while the work supported basic Darwinian processes, it also supported Behe’s edge of evolution concept. And while my colleagues are celebrating our achievement as scientific proof of the power of natural selection, I know that this achievement has basically undermined the power of naturalistic evolution as expressed in the latest synthesis. It is another nail in the coffin of naturalistic evolution because in all these opportunities no novel complex capabilities arose. Oh there were some interesting morphological changes but no new systems. The environment, separation of sub populations, genetic processes and natural selection just narrowed the original gene pool and produced a bunch of new species.
So did I do ID science? Yes, Did I contribute to the ID agenda? Yes, Did I use CSI anywhere? Maybe, I found the lack of new FCSI in all these reproductive opportunities but I do not express it that way. Our team list all the changes and they are many that took place but none exceed that boundary that Behe hypothesized several years earlier. I know a modern Michael Behe will pounce on the data and come to the right conclusions. But my career is now in high gear and I am off to supervise a similar but much larger project on aves, a class and with much higher number of species. And I expect to find the same thing even if it takes 20 years. I am a hero to the evolutionary biology crowd but smile inwardly as they are really celebrating their down fall. I love many of these people who are very decent but have often wondered why there is so much hostility to something that to me seems so obvious.
Not one person in the science community would say I wasn’t doing science. And yet we should all agree that I was doing ID science too. My point of view just leads me to occasionally conclude different things. After all I believe Darwinian processes do work to a limited degree. The reality is that if they ever suspected my motives or leanings I would have been fired or ostracized or not given the opportunities. The point I am making here is that even if the person I am describing did not believe in ID or had any leanings that way and did not have to suppress their inner leanings because they didn’t have any, they were doing ID research.
But what if they find not only the gradual appearance of complex novel capabilities and the likely cause is some natural process but that there were several instances and that these examples are compelling. Well that is the risk or the opportunity that is taken and how the argument will be evaluated 30-50 years from now. Will Behe’s Edge of Evolution be supported or undermined?
So there is no question that ID is scientific in at least this area and the difference between this and other science is small and is really only in the conclusions that one makes based on the data. And who knows if ID leanings may have led this person as a scientist to pursue different areas that an a non ID scientist would have never thought of.
72
StephenB
02/07/2009
10:22 am
—-Jerry: “Everyone continues to miss my point in both faq1 and faq2.” point.
This was the same point I made at #10.
73
StephenB
02/07/2009
10:41 am
—-Jerry: “So in FAQ1 I would add Lenski as one who is doing ID research.”
FAQ1, it seems to me, is about definitions more than people; FAQ1 is, or should have been, more about people that definitions.
If, as you suggest, we pose a safer question by discounting CSI and saying, for example, that “no real scientist believes in Irreducible Complexity,” we can, to be sure, more easily refute the point. At that point, however, we are writing our own questions as if a Darwinist had done it, an activity that seversky thought we were engaging in anyway. We weren’t.
74
jerry
02/07/2009
11:07 am
StephenB,
I am saying that faq1 and faq2 are the same. We just need to broaden our horizons and they will collapse inward to make one faq.
I continually chide people here who say there is no ID research by saying that anyone mapping a genome is doing ID research and they quietly go away. But not one person on this site, anti ID has disputed the claim or pro ID has defended the claim except me.
So it is obvious that the claim is not taken seriously. Otherwise it would have been a no brainer to include it in faq1 and faq2 and it was not and only appears because I bring it up. And there is no movement to include it.
I believe we are sitting on great answer for both faq1 and faq2 and yet it is continually ignored. Thus, I claim that those who support ID here really don’t understand the implications of the edge of evolution and what supports it and where it can go. Behe obviously understands it by his comment about Lenski. DaveScot is the only other person here who has taken up this idea in some of his comments.
I think Dembski’s approach will gradually fade away and the field will concentrate on Durston’s area on one end and Behe’s approach on the other end and eventually squeeze out everything in between. In the mean time we spend our efforts here trying to defend the more generalized approach of intelligence which is well and good but because it is still very nebulous when it gets operationalized and thus, ID gets caught up in its knickers trying to defend it.
75
Lutepisc
02/07/2009
11:22 am
Hi, KF. You asked, “Now, does that capture the majority of concerns, within the constraint of being relatively concise and focussed on one aspect of a complex whole?”
I probably won’t endear myself to my comrades here by saying this…but, well, no.
Instead of making a slam dunk, the answer dribbles all around the court. Yes, it eventually makes the basket, but by then the viewer has long since surfed to another channel. And in this game, the basket counts only if the viewer sees it being made.
Your reader does not bring an interest in telecommunications work to the question. Expecting him to bear with you as you move into that area, in the hope that you will eventually get around to answering his question, will not work. You will lose the audience you are targeting.
There are lots of excellent construction materials in the answer you have given, KF, but the structure needs to be torn down and rebuilt. I suppose it is unrealistic of me to expect the original builder to be able to do that.
I also think that the answer would benefit from Upright BiPed’s insightful ideas about how seriously nearly every scientist takes ID:
(And this gives me a chance to apologize for getting your handle wrong, UB!)
Finally, into that framework you could also incorporate Jerry’s and StephenB’s ideas about biologists advancing ID whether they realize it or not.
I know that assembling a FAQ by committee will probably end up disappointing everyone, including me. But not to worry! I can handle it!
76
kairosfocus
02/07/2009
11:51 am
Jerry:
Do you accept that Information theory is Science?
Do you accept that it is the intersection of Info Th and molecular bio that is much of how ID speaks into biology?
Do you accept that those who use PCs and recognise posts as messages are thereby inferring that lucky noise did not mimic signals — though it is strictly logically and physically possible?
Do you accept that to so act is to imply acceptance of a simple, intuitive version of the explanatory filter?
Do you accept the implications of the above?
Especially, in light of:
Why/why not?
GEM of TKI
77
StephenB
02/07/2009
12:15 pm
—–”Lutepisc: Wow. What Upright Bipod said @54!
—–”How much do we hafta pay him to write the FAQ?”
The back-handed insult is not necessary. This is going to be a long grind and you will find that many of the points that our critics want us to include are made elsewhere. We are just getting started.
78
StephenB
02/07/2009
12:25 pm
—-Lutepisc: “I also think that the answer would benefit from Upright BiPed’s insightful ideas about how seriously nearly every scientist takes ID:”
I, too, like his point, and it has been duly noted. Still, each question deals with a theme, and the theme for FAQ2 is that ID does not have enough going for it to capture the imagination of anything other than a psuedo scientist. The main thrust of the question is about ID’s alleged insufficiency, not its potential threat to Darwinists. If we do both themes, we will not do justice to the main them. Check out Kairosfocus revision at 65.
79
Lutepisc
02/07/2009
1:26 pm
“The back-handed insult is not necessary.”
Excuse me?? What back-handed insult, please?
80
tribune7
02/07/2009
1:32 pm
StephenB
You, KF and GP have done superb work.
It’s a lot easier to be the customer than the cook
81
gpuccio
02/07/2009
1:33 pm
Jerry:
I have always said that anybody doing serious biological research is doing ID research, because good data belong to all. But there is a difference between doing generic research which can always clarify important points for origin science, and doing specific research which is targeted to specific ID assumptions, like the functional space of proteins and so on. That is ID research in a more restricted sense, either it is done to support ID or to falsify it. That is, IMO, the kind of research, and of researchers, which should be mentioned in FAQ2. And I think we have made the relevant names here.
And, as you can see. all of us are focusing on FSCI here, so don’t be worried for Mount Rushmore and similar.
Finally, nobody is denying the importance of Behe’s work. If you read the whole FAQ, you will see that long answers are dedicated to him, like the absolute defense of his arguments about the flagellum and the plsmodium falciparum. Behe’s work is absolutely essential for ID, but I deny with all my strength that it is in any way antagonistic to Dembski’s concepts. The two things are absolutely complementary.
82
gpuccio
02/07/2009
1:35 pm
trib:
thank you. You are a great help here!
83
Lutepisc
02/07/2009
3:29 pm
StephenB, reviewing this and reflecting on it, perhaps you meant that I was insulting to KF. That hadn’t been on my mind when I made the comment, but I do see the possibility, and apologize to you, KF.
I appreciate the time and expertise the authors are putting into the FAQs!
84
StephenB
02/07/2009
4:36 pm
Lutepisc: @83 Thanks! I appreciate your input as well. Your comments were indispensable, and have provided us with a new and better direction. Keep it up.
85
StephenB
02/07/2009
4:55 pm
Lutepisc: @83. Also, it appears that I read something into your comments that wasn’t there. Sorry about that.
86
Patrick
02/07/2009
5:29 pm
I have only one comment for the FAQ so far: it does not acknowledge the contribution that DaveScot and myself made toward it. This FAQ originally started as a series of one-liners that Dave wrote for a page he called Put a Sock In It. His focus in writing it was very narrow since it was targeted at trolls.
Over the years I expanded it greatly to include arguments that kept popping up again every couple weeks, since I was getting tired of rehashing the same subject matter with new visitors. So I’m glad to see my efforts are not wasted. And I like many of the changes and additions that have been made…and the fact that the current editors are much more qualified to write such a FAQ than I am, so I don’t have to worry about embarrassing UD with a silly mistake or misconception made by myself.
Also, the negative aspect to this history to the FAQ is that it does not read like a standard FAQ per se since it was intended more as a “FRA” (Frequently Refuted Arguments). So if you do not like the way many of the questions (or assertions) read then blame me. Or blame the Darwinist that I copied from or paraphrased. Whatever works. I don’t mind being a target for your irritation.
On a side note, I was planning on writing a page called “The UD Standing Challenge” which summarized the major points related to the flagellum debate that ended with the simple challenge “name the indirect pathway and its functional intermediates”. Or maybe this should be called the “Most-Ignored Challenge”…
Now the FAQ does go over the flagellum from an IC perspective but does not explain the informational challenge.
87
Patrick
02/07/2009
5:44 pm
As for the “Behe vs Dembski” discussion I recently said my piece on that here:
As noted my copy of the book is in storage somewhere, so my statement related to 30 proteins and IC might not be correct since I cannot remember exactly why Dembski calculated based upon 30. Whatever. The rest of my points remain. Speaking of which, the FAQ should probably summarize how Dembski did his calculations for the flagellum since it’s apparently become recently trendy on UD to claim that no one has attempted to do such calculations for a biological object.
I also think that there should be a list of links leading to UD debates that get into detail on specific topics. There’s a ton of great comments buried in UD’s archives that should be highlighted.
88
StephenB
02/07/2009
6:28 pm
Patrick, several events caught us off guard. First, we (at least I) did not know that you and Dave wrote the previous document. Perhaps we should have, but we didn’t. Also, we did not know about the circumstances or the timing that would determine when the report would be released. In any case, we could have accomplished very little without standing on the shoulders of the previous authors.
In keeping with that point, we felt that we should pay tribute to our forbears, which is why you find the following statement at the end: “We jointly express appreciation to the developers of an earlier form of this page on responding to weak anti-ID arguments.”
Now that we have more information, we can improve on that. Thanks for bringing it to our attention, because we have been thinking about the point, but we just didn’t know how to approach it. My understanding was that this was an update, and I gather that many things have happened since the first report came out. That is why we tried to keep most of the same questions and attempt to answer them based on recent developments.
For my part, I hope that you and Dave will help us shape it just as others are trying to do. Both of you know things that few other people know and you have been around here a lot longer than I have. Again, I don’t decide these things, but I would like to include your contribution and anything Dave Scot deems as relevant with due attribution.
89
jerry
02/07/2009
7:09 pm
kairosfocus,
I will try to answer some of your questions. But I don’t think they are very relevant to the point.
“Do you accept that Information theory is Science?”
I am sure it is but I know little if anything about it and I have not seen anyone provide an easily to understand description of it and how it applies to ID. I am interested in the evolution debate and not the general ID debate so if it applies there I will have little interest in pursuing it.
“Do you accept that it is the intersection of Info Th and molecular bio that is much of how ID speaks into biology?”
I have no idea what you mean but doubt that it is what you claim. DNA in parts specifies RNA and protein molecules. That is all I know and haven’t got a clue how that relates to information theory. Nor have I seen anyone who makes a clear case for it. Don’t ask me to read anything you have written because I find your style sometimes too rambling. You are a good thinker but a lot of it gets wasted because of your style of prose.
“Do you accept that those who use PCs and recognise posts as messages are thereby inferring that lucky noise did not mimic signals — though it is strictly logically and physically possible?”
I haven’t a clue what you are talking about. If you want to say that people understand each other’s language, then I understand that and if you want to make an analogy to DNA, then so be it. I have made that claim about 500 times here and several in the last few days and also on this thread. So what is your point?
“Do you accept that to so act is to imply acceptance of a simple, intuitive version of the explanatory filter?”
No one said the EF was not useful in some cases. And I probably accept the process in general. But I have said no one and I mean no one has explained just what CSI is so that it can be conveniently used in the filter or any place else. And I pointed out in the past when we were on one of the endless discussions of just what CSI was that bfast was the one to point out that specified means when one set of data specifies something else that has function. When he said that and I never saw anyone before him say it, the issue became clear. And that was over two years ago and was the first time that anyone I saw make that connection. Since that time especially in the last year it has become more common to limit any discussion of CSI to FSCI.
“Do you accept the implications of the above”
It sounds like I am being indoctrinated into some society and asked to make a pledge of allegiance. So I will answer that as long we use the term CSI here we are inviting problems. That is why I said get rid or CSI.
Now Behe’s work is different from CSI no matter how one spins it. I didn’t say he objects to it. He does not use the concept in his work and does not need to. I believe it would only confuse people if he did.
And last but not least, Behe’s work has been much more valuable to ID. Durston’s work seems to be up there too but it depends primarily upon ideas such that the proteins are very, very isolated in protein space and thus explains why Behe’s edge of evolution is so insightful. I do not know for sure if that is Durston’s work. Durston’s other conclusion is closer to Dembski’s work in that the construction of these long proteins are beyond the resources of the universe. But it is the rareness of the proteins that to me is key but wiser heads may think otherwise.
So Durston is contributing in two areas and each is very important and is new. I hope it all stands up because it could be devastating to the anti ID folks. Our weapons are expanding while the Darwinists are getting thiner.
90
Barry Arrington
02/07/2009
7:43 pm
Thanks you for all of the comments, many of which have been excellent indeed. Comment on FAQ2 is now closed.