Uncommon Descent


11 March 2008

Does neo-Darwinian Theory Include the Origin of Life?

Dave S.

Quite often when confronted with the problematic nature of explaining the arrival of the first life capable of supporting descent with modification an evolutionary theorist will say the theory has no bearing on how the first life came into existence - the theory only explains what happened after that.

Is this true?

Well, yes and no. Evolutionary theory doesn’t explain exactly how the first life was created and doesn’t demand any particular modus operandi. However, that’s not to say it doesn’t make any assumptions at all. It assumes that the first life was a simple cell and the mechanism(s) described by the theory made a simple common ancestor (or perhaps a few simple common ancestors) into the complex and diverse spectrum of life we observe today.

If you want to find out if NDE really cares about how life originated just try asserting that life originated as very complex forms that were programmed to diversify in a prescribed manner. Try saying the original form of life on the earth was like a stem cell in that it contained the unexpressed potential in it to diversify into many different forms with chance playing little if any role in the diversification process. Or better yet, for some real shrieking and howling rejection, try proposing that life originated as very complex perfect forms such as described in the Garden of Eden and the story of evolution is really a story of devolution from originally perfect, diverse forms.

In short not every modus operandi for the origin of life is acceptable - only those which don’t involve intelligent design in the origin of life. The problem is that if you admit intelligent design in the origin of life you open the door for it anywhere in the subsequent story of life. As Richard Lewontin said “We can’t let a divine foot in the door”. In actuality it’s the foot of any intelligent agent, divine or not, that isn’t allowed in the door.

It’s relatively easy to pin someone like Richard Dawkins into the uncomfortable position of either exposing his non-scientific presumptions about the origin of life or admitting that life on earth was possibly intelligently designed. All you have to do is get them to agree that intelligent life such as ourselves with the requisite skills in biochemistry to design a simple cell can evolve without intelligent agency. They are forced by their own beliefs to agree. Then you next ask if it’s possible that intelligent life evolved somewhere else in the universe first and that form subsequently designed the life we find on this planet. They must either agree that’s possible or explain why, scientifically, it isn’t possible. At that point they’re stuck between a rock and a hard place. In order to maintain the illusion of being an objective scientist with no ideological presuppositions they must admit that life on earth could be the result of design. Dawkins chose to maintain the illusion by admitting that design is a possibility then tried to weasel out of it by saying that the designer is almost certainly an evolved intelligence. If he doesn’t say almost certainly then again he admits to holding a non-scientific presumption.

SociBook del.icio.us Digg Facebook Google Yahoo Buzz StumbleUpon
105 Responses

1

Gib

03/11/2008

5:29 am

Or better yet, for some real shrieking and howling rejection, try proposing that life originated as very complex perfect forms such as described in the Garden of Eden and the story of evolution is really a story of devolution from originally perfect, diverse forms.

Well, yes. There’s a very good reason for that (although the response would more often be laughter, not shrieking). It’s because we actually have the physical proof that life did not start as complex forms.

Unless of course you’re claiming that it devolved backwards…


2

DaveScot

03/11/2008

7:09 am

gib

It’s because we actually have the physical proof that life did not start as complex forms.

Oh goody. Let’s see it!

Unless of course you’re claiming that it devolved backwards…

Is that not possible?


3

Ahmed Aouin

03/11/2008

7:12 am

A very interestin comment. But In Türkey ,,moderate” islamist goverment makes schools, universtity teach simplicimus creationism, is not science like Inteligen Design or even ration.

If Boss Man say ‘Is work of Allah, no more question please’, how can ID scientist do job?

This is important Problem in Türkey this day.


4

Joseph

03/11/2008

7:38 am

One thing is for sure- If living organisms did NOT arise from non-living matter via non-telic processes there would be no reason to infer its subsequent diversity arose solely via non-telic processes.

Also-

Can evolution make things less complicated?:

Instead, the data suggest that eukaryote cells with all their bells and whistles are probably as ancient as bacteria and archaea, and may have even appeared first, with bacteria and archaea appearing later as stripped-down versions of eukaryotes, according to David Penny, a molecular biologist at Massey University in New Zealand.

Penny, who worked on the research with Chuck Kurland of Sweden’s Lund University and Massey University’s L.J. Collins, acknowledged that the results might come as a surprise.

“We do think there is a tendency to look at evolution as progressive,” he said. “We prefer to think of evolution as backwards, sideways, and occasionally forward.”


5

SteveB

03/11/2008

9:29 am

“…it’s possible that intelligent life evolved somewhere else in the universe first…”

I’ve never understood how this line of argument makes sense for the ID proponent. On the one hand, ID essentially posits that evolution is not sufficient to explain the existence of complex life in a proximate environment that we can study, observe, measure and actually know a lot about. To claim on the other hand, that such life might have evolved on a distant, hypothetical, unobservable elsewhere that we know nothing about… while this is theoretically possible (just about anything that can be imagined is theoretically possible), there’s nothing about it that is scientific.

Even if we say the argument’s hypothetical, staking out this ground actually provides firmer footing for the naturalist. Let’s say that we are a large and complex science experiment beamed here from Andromeda, and the creatures that did the seeding arose from purely naturalistic processes. In the end, this confirms Dawkins’ world view: the original origin of life did occur by unguided processes; law and chance is sufficient (ultimately) to explain the complex life we observe here; the blind watchmaker is alive and well.


6

Allen_MacNeill

03/11/2008

9:30 am

Th late Stephen J. Gould was very clear on this point: there is absolutely nothing inherently “progressive” about evolution at all. On the contrary, there are good examples of natural selection producing considerably less complex descendants from ancestors (endoparasites are just one example).

However, there is a problem with the hypothesis that eukaryotic cells preceded the evolution of archaea and bacteria. The chief problem is the fact that, with very few exceptions (such a s mammalian red blood cells), virtually all eukaryotic cells have mitochondria. As Lynn Margulis has pointed out, mitochondria are almost certainly the evolutionary descendants of formerly free living aerobic prokaryotes (probably bacteria, not archaea) that were ingested but not digested by the ancestral ur-eukaryotic host cell.

Mitochondria are aerobic, but all of the geological evidence points to the conclusion that the early atmosphere of the Earth contained no free oxygen gas (that is, O2). Hence, if the “eukaryote first” hypothesis is to be maintained, one must assume that endosymbiotic mitochondria were a later addition (as were chloroplasts and other plastids).

However, if one removes mitochondria (and chloroplasts) from eukaryotic cells, what is left looks an awful lot like a “primitive” archaean, and so we are back to the “archaea first” hypothesis currently favored by most evolutionary biologists.

Favored on the basis of accumulating empirical evidence like the foregoing, I might add, not because of a commitment to some pre-existing ideological position. Indeed, the idea that there even was a third domain (i.e. the Archaea) was a hotly debated hypothesis a decade ago, but new discoveries have mostly supported the “Archaea hypothesis”.


7

Allen_MacNeill

03/11/2008

9:33 am

As to DaveScot’s question about the importance of OOL to evolutionary biology, I assume it was stimulated by the discussion in the comments following the Altenberg Sixteen post. As I stated there, it is quite possible that there will never be any convincing empirical evidence to answer this question, given the immense amount of time that has elapsed and the lack of fossilizable evidence. Under such conditions, as a scientist dedicated to the proposition that all valid theories must have empirical support, I would assert that the question of the OOL (like the question of the origin of energy and matter in physics) must remain in the realm of metaphysics, rather than science.


8

Allen_MacNeill

03/11/2008

9:38 am

Joseph wrote:

“If living organisms did NOT arise from non-living matter via non-telic processes there would be no reason to infer its subsequent diversity arose solely via non-telic processes.”

And indeed, the converse would also be the case: there would be no reason to infer its subsequent diversity arose solely via telic processes either.

The point to my continued assertion that this a non-issue in evolutionary biology is that there is no empirical evidence either way, nor is it likely that such evidence will eventually be forthcoming. Under such conditions, I would prefer not to argue over metaphysical positions, but rather discuss those processes for which we do have abundant empirical evidence. That is, the pattern of macroevolutionary changes as reflected in the fossil and genomic records and the processes by which such patterns have come about: phenotypic variation, inheritance, fecundity, and differential survival and reproduction; evolution, in a word.


9

Telic-meme

03/11/2008

9:40 am

Joseph,

Have you read the article by Kurland et al. (2006)?
Kurland CG, Collins LJ, Penny D. Genomics and the irreducible nature of eukaryote cells. Science. 2006 May 19;312(5776):1011-4.

Interesting read, even the Garden of Eden (no unicellular raptors in that garden apparently) is mentioned.


10

DaveScot

03/11/2008

10:04 am

Allen

Imprints in rocks don’t tell us much about the mechanisms underlying the origin and diversification of life either. But what it does tell us, taken at face value with no claims of hopeless incompleteness, is a story of saltation which doesn’t square with any gradual theory of evolution but squares very well with design theoretic views as designers can make arbitrarily large leaps in complexity without transiting through innumerable functional intermediate states. I’m all for modern biology, the study of living tissue, and just writing off how it all came to be the way it is as an unsolved mystery. What we have learned from observation of living tissue is that the creation of new cell types, tissue types, organs, and body plans is something no one has ever observed so how that happened in the past remains a mystery too even though that lack of observation is handily explained by design theoretic views. If there are going to be narrative historical accounts told about these things then ID has as much standing as anything else, if not more, because intelligent agency is the ONLY mechanism that has EVER been OBSERVED creating complex systems that would otherwise have a probability closely approximating zero of coming into existence by law and chance alone. It’s past time to either demonstrate conclusively that a non-telic mechanism can create complex machinery de novo or step aside and let the only conclusively demonstrated mechanism have its day in the sun. As my momma used to say “Either sh*t or get off the pot.”


11

jerry

03/11/2008

10:08 am

Several OOL researchers assert Darwinian processes in the procession from small molecules to life. There is constant mention of limited resources and the more efficient processes stealing the resources from the less efficient. And the constant upward movement to the first cell. So there is a definite progression in their theories as an inevitable characteristic of nature primarily based on the Darwinian paradigm.

Why, if this progressive process if accurate, should it stop when the first cell came into being. That is nonsense. So it will be hard to get away from progression as that is a basic characteristic of life as we have seen it. But what caused the progression? We are learning that Darwinian processes are very limited.

Of course there is never any details but only assertions by the OOL people just as it is with the evolutionary biologist who are great at creating models but short on empirical verification.

Empirical verification will come soon for the evolutionary biologists as more and more genomes are sequenced and there will be information if anything of consequence happened when species separated.


12

DaveScot

03/11/2008

10:20 am

SteveB

The important thing is getting an admission that life on this planet could be the result of design. The nature of the designing intelligence, naturally evolved or otherwise, is irrelevant to the question of whether life on earth was designed or not. Saying it must be an evolved intelligence is a statement of faith in philosophical naturalism just as much as saying it is the Judeo-Christian God is a statement of faith in biblical revelation.


13

johnnyb

03/11/2008

10:48 am

Allen –

“I would assert that the question of the OOL (like the question of the origin of energy and matter in physics) must remain in the realm of metaphysics, rather than science.”

The problem as I see it is that large portions of evolutionary theory are founded on assumptions about the origin of life. Tracing decent through homologies only works if you assume that the biochemical network was not there at the beginning of life, and it had to develop. If that assumption is not there, then a lot of current evolutionary theory, even for the fossils we do have, goes into the realm of metaphysics as well.

However, I don’t think we need to go into metaphysics to decide the origin-of-life questions. The answer to the question “where _can_ a self-replicating code come from” is one that is fully answerable, even in the absence of fossil evidence.

Here is the ID side of that case:

http://www.idnet.com.au/files/.....atural.pdf

Jon


14

DaveScot

03/11/2008

10:55 am

Allen

Actually, I was too quick to say no one has ever observed the creation of new cell types, tissue types, organs, and body plans. We’ve observed it a billion times in the process of ontogenesis. But ontogenesis is a front-loaded process. A chicken egg doesn’t produce anything other than cell types, tissue types, organs, and a body plan characteristic of chickens. Chance plays little if any role in ontogenesis (other than to derail the process) and the environment likewise serves at most to provide trigger points (or an inappropriate environment derailing the process) for when to move along to the next stage in the pre-programmed diversification of the starting cell. So if there’s any observation at all of cells diversifying into different cell types, tissue types, organs, and body plans it’s a pre-programmed evolution. That’s primarily why I find the front-loaded ID hypothesis as the leading candidate in phylogenesis. Front-loaded cells unfolding during ontogenesis are the only ones we’ve actually observed diversifying in the ways required by phylogenetic diversification. Phylogenesis, in other words works the same way as ontogenesis except over a much longer timescale. I might also point out that ontogenesis is a self-terminating process and for all anyone can demonstrate phylogenesis has self-terminated with the production of rational man. Nothing demonstrable remains of ongoing phylogenesis except the generation of variants or sub-species.


15

DaveScot

03/11/2008

10:55 am

Allen

Actually, I was too quick to say no one has ever observed the creation of new cell types, tissue types, organs, and body plans. We’ve observed it a billion times in the process of ontogenesis. But ontogenesis is a front-loaded process. A chicken egg doesn’t produce anything other than cell types, tissue types, organs, and a body plan characteristic of chickens. Chance plays little if any role in ontogenesis (other than to derail the process) and the environment likewise serves at most to provide trigger points (or an inappropriate environment derailing the process) for when to move along to the next stage in the pre-programmed diversification of the starting cell. So if there’s any observation at all of cells diversifying into different cell types, tissue types, organs, and body plans it’s a pre-programmed evolution. That’s primarily why I find the front-loaded ID hypothesis as the leading candidate in phylogenesis. Front-loaded cells unfolding during ontogenesis are the only ones we’ve actually observed diversifying in the ways required by phylogenetic diversification. Phylogenesis, in other words works the same way as ontogenesis except over a much longer timescale. I might also point out that ontogenesis is a self-terminating process and for all anyone can demonstrate phylogenesis has self-terminated with the production of rational man. Nothing demonstrable remains of ongoing phylogenesis except the generation of variants or sub-species. The period of great fecundity in phylogeny appears to be in the very distant past and it’s done nothing but decelerate since then. All we have observe in historical times is extinctions and plenty of them with nothing but minor variants of existing species to replace those gone extinct. Any claim that the minor variants are incipient species is a baseless claim.


16

jerry

03/11/2008

11:09 am

I have a question about early uni cellular fossils. We see pictures of black like streaks in ancient rocks and are told that these are the fossils. I assume that these streaks have been analyzed for chemical content. Would the chemical content differentiate between the type of cell it might have been. Would we expect to find different proportions of elements in a pro karyote than a eukaryote?

I am sure this was done but have never seen anything published on this nor what are the chemical differences between the two types of cells in terms of proportion of elements.


17

Joseph

03/11/2008

12:18 pm

As Lynn Margulis has pointed out, mitochondria are almost certainly the evolutionary descendants of formerly free living aerobic prokaryotes (probably bacteria, not archaea) that were ingested but not digested by the ancestral ur-eukaryotic host cell.-Allen_MacNeill

Sure if you only assume that euks evolved from proks.

How is her testing coming?

If living organisms did NOT arise from non-living matter via non-telic processes there would be no reason to infer its subsequent diversity arose solely via non-telic processes.”

And indeed, the converse would also be the case: there would be no reason to infer its subsequent diversity arose solely via telic processes either.

If living organisms arose via telic processes it would be very safe to infer the subsequent diversity had something to do with telic processes.

If living organisms arose from non-living matter via non-telic processes then ID is a false concept. No teleology required.

The point to my continued assertion that this a non-issue in evolutionary biology is that there is no empirical evidence either way, nor is it likely that such evidence will eventually be forthcoming.

Umm, transcription, translation= molecules building molecules to build molecular machines.

Right we see that in a test tube by just adding the right chemicals.

Under such conditions, I would prefer not to argue over metaphysical positions, but rather discuss those processes for which we do have abundant empirical evidence.-Allen

The processes that demonstrate a wobbling stability? That is populations oscillate but that is about it.

It matters to an investigation whether or not that which is being investigated arose via agency involvement or nature, operating freely.

Have you yet to even demonstrate that the transformations required are even achievable via any known process?

It’s all magical mystery mutations plus father time.

Not quite what one would expect from a science.


18

Joseph

03/11/2008

12:29 pm

Have you read the article by Kurland et al. (2006)?-Telic Meme

Not yet.

I will look into it. Thanks


19

JPCollado

03/11/2008

1:52 pm

The gulf between inanimate matter and life is far greater than that between unicellular and multicellular organisms. To me, the process that sparked the first living entity has far more consequence……a pivotal event that would serve as a key to understanding the emergence and proliferation of subsequent and ever more complex life forms, and not the other way around (i.e., taking observed processes and extending it backwards to the first simple entity).


20

vjtorley

03/11/2008

1:54 pm

Allen McNeill:

I think you are entirely correct to insist on empirical evidence for intelligent design in the origin of life debate. So here are two predictions I’d like your comments on.

(1) An intelligent agent that wished to seed the Earth with life would have no reason to hang back, once Earth became habitable. From what I’ve read, this would have occurred around 3.9 billion years ago, when massive asteroid bombardments (which repeatedly sterilized the Earth) finally eased off. If fossil life-forms were found dating back 3.9 billion years, this would lend support to the hypothesis that life was designed. From what I have read, Carbon-12/Carbon-13 ratios might be one way to test for the presence of life in rocks of this age. If, on the other hand, these ratios consistently pointed to an absence of organic material in the oldest rocks, then that would count against a designer. What are your thoughts on this test?

(2) The DNA code should itself be optimal, if it was designed by an agent. As I wrote in an earlier post (14 January 2008), “If anything in nature was designed by a Higher Intelligence, DNA was. If something is intelligently designed for some purpose, then it should be optimal for that purpose… [O]ne simple prediction that ID would make is that NO biologist will ever be able to build a genetic code which can do a BETTER job than DNA for ALL of the following purposes: regulating the development and functioning of organisms; transmitting genetic information faithfully from one generation to the next; and making minor adjustments (mutations) in response to environmental changes. If someone can design a molecule that excels DNA in one of these areas and equals it in the others, then ID is falsified.”

In my earlier post (14 January 2008), I drew attention to an an article in “Science Daily” (Feb. 9, 2007) at http://www.sciencedaily.com/re…..230116.htm refers to DNA as “nearly optimal for encoding signals of any length in parallel to sequences that code for proteins.” It reports that Dr. Uri Alon and his doctoral student Shalev Itzkovitz “showed that the real genetic code was superior to the vast majority of alternative genetic codes in terms of its ability to encode other information in protein-coding genes.” Additionally, the researchers “demonstrated that the real genetic code provides for the quickest incorporation of a stop signal–compared to most of the alternative genetic codes–in cases where protein synthesis has gone amiss.” The vital question here is: can any alternative genetic code outdo DNA in overall efficiency? (I say “overall” efficiency because when an entity is designed for many different purposes which have conflicting requirements, some sort of engineering compromise is required, which means that in certain respects, the entity’s design may be sub-optimal.) My prediction regarding DNA is that IF some alternative genetic code turns out to be better than DNA at BOTH of the tasks mentioned in the article (encoding other information as well as incorporating a stop signal) then there should definitely be some other function of DNA (e.g. long-term transmission of genetic information) for which the alternative genetic code does not perform as well as the code which we find in DNA.

You are a biologist. I’m not. So my question to you is: is there any sense in which the DNA molecule can be said to be optimal?


21

JPCollado

03/11/2008

2:10 pm

If a theory is to be hailed as the cornerstone of a particular field of study it should at least fruitfully address the origin of the very thing that it purports to explain.

Life is the all-encompassing theme permeating the study of biology, and if Darwinism cannot even come close to giving a worthy account of how it came into being, then it has no business dealing with origins.


22

PannenbergOmega

03/11/2008

2:12 pm

Joseph. What are your credentials?


23

Allen_MacNeill

03/11/2008

3:08 pm

JPCollado:

By your criteria, then, physics has no business studying gravity, since it proposes no origin for it, and chemistry has no business studying atoms, as it proposes no origin for subatomic particles.

Furthermore, as I have repeated multiple times, evolutionary biologists do not speculate on the origin of life. Darwin didn’t, nor do virtually all of my colleagues in the field. Speculating about the origin of life is mostly an avocation of geochemists, physicists, and philosophers. More power to them, if that’s what they want to do, but it isn’t evolutionary biology, which presupposes the existence of life in the same way that gravitational physics presupposes the existence of gravitational force.


24

Allen_MacNeill

03/11/2008

3:11 pm

JPCollado wrote:

“…a pivotal event that would serve as a key to understanding the emergence and proliferation of subsequent and ever more complex life forms.”

This is an assertion, not a conclusion based on empirical evidence. Do you have any evidence to back it up, or is it simply your opinion? If so, you are certainly entitled to it, but please don’t call it science.

To be blunt, there is no empirical evidence at all for how the transition from non-living to living material came about. Hence, any discussions about the process are pure metaphysical speculation, nothing more, and nothing less.


25

Allen_MacNeill

03/11/2008

3:15 pm

Joseph asked (about Lynn Margulis):

“How is her testing coming?”

Just fine, thank you. She’s been working hard in the field and in the laboratory, collecting empirical evidence that has convinced virtually every scientist in the world that her serial endosymbiotic theory of the origin of eukaryotes is the best supported theory for that process. Some of this is summarized in Symbiosis in Cell Evolution (for which she has been repeatedly nominated for a Nobel Prize). Have you read it?

And, while we’re at it, what field and laboratory research have you done to collect empirical evidence for an alternate theory, and where has it been published?


26

Allen_MacNeill

03/11/2008

3:17 pm

Jerry asked:

“Would the chemical content differentiate between the type of cell it might have been. Would we expect to find different proportions of elements in a pro karyote than a eukaryote?”

Lynn Margulis (among others) has published extensively on precisely this question. I recommend you start with her book, Early Life and then follow up on the references she cites in the bibliography and references cited.


27

Allen_MacNeill

03/11/2008

3:29 pm

johnnyb wrote:

“The problem as I see it is that large portions of evolutionary theory are founded on assumptions about the origin of life. ”

Name one.

I teach evolutionary biology at Cornell and have never mentioned it except in passing, for the reasons I have repeatedly discussed in this and other threads. Furthermore, it’s not my field, and I hesitate to discuss subjects about which I have not done extensive reading and study.

If you’re interested in how the subject is addressed by people working in the field, I recommend chapter 16 of Scott Freeman and Jon C. Herron’s book, Evolutionary Analysis, 3rd ed, published by Pearson/Prentice Hall. In particular, following up on some of the references listed on pages 659 to 662 will give you a much better idea of the state of understanding of this subject than I can, especially given the constraints of this format.


28

Allen_MacNeill

03/11/2008

3:36 pm

DaveScot wrote:

“Phylogenesis, in other words works the same way as ontogenesis except over a much longer timescale. ”

And your evidence for this assertion is…?

Yes, there seem to be some analogies between the two processes. It was such similarities that prompted Ernst Haeckel to formulate his “ontogenetic law” that “otogeny recapitulates phylogeny.” Are you affirming Haeckel’s principle, but in reverse order?

Furthermore, arguments by analogy alone are not considered legitimate. What evidence, beyond mere appearance, is there for your assertion that phylogeny recapitulates ontogeny?


29

PannenbergOmega

03/11/2008

3:51 pm

Alan Macneil is one zealous Darwinian.


30

jerry

03/11/2008

5:16 pm

PannenbergOmega,

We should be thankful that someone like Dr. MacNeill has agreed to talk with us. It is how we learn. I believe he has changed his attitudes toward some ID’s proponents a little in the last couple years. He certainly knows that most of ID is not based on religion and that is a plus. Most scientists who are Darwinist would not spend any time with us here.


31

jerry

03/11/2008

5:17 pm

Dr. MacNeill,

Jablonka amd Lamb’s book arrived today. So in a couple weeks I may have some questions for you if you are still around here.


32

PannenbergOmega

03/11/2008

5:38 pm

Hi Jerry,

I suppose you are right.


33

tribune7

03/11/2008

6:17 pm

It seems they want to have their soup and eat it too.
Evolution 101 at berkeley.edu


34

bFast

03/11/2008

6:43 pm

Jerry:

We should be thankful that someone like Dr. MacNeill has agreed to talk with us. It is how we learn….Most scientists who are Darwinist would not spend any time with us here.

A sad truth is that a number of scientists, zachriel comes to mind, have shared their knowledge on this forum in a reasonably tactful fashion, and got banned. I agree with you that knowledgable people from the other side of the equation are essential for our growth, and for keeping us honest.


35

PannenbergOmega

03/11/2008

6:53 pm

There is a new book out by ISCID fellow Jeffrey Schwartz.

http://www.amazon.com/Mind-Bra.....48-6788821

This is relevent to ID prediction number 7.

http://post-darwinist.blogspot.....esign.html


36

DLH

03/11/2008

8:07 pm

Allen_MacGuire at 6

Mitochondria are aerobic, but all of the geological evidence points to the conclusion that the early atmosphere of the Earth contained no free oxygen gas (that is, O2).

Were that the case, it would support your argument. Unfortunately, most facts on the Achaean Atmosphere appear to support the opposite oxic atmosphere. See:

Iron formations
Law, Phillips and Myers of the CSIRO review evidence for aoxic vs oxic archaean atmospheres and provide evidence for an oxic archean atmosphere using iron ”’Pisoliths”’ in Australian geological formations.

The Earth may have had an oxygen-rich atmosphere as long ago as three billion years and possibly even earlier . . . Pisoliths have been a vital tool in the discovery of $5 billion worth of new gold deposits in WA

* Primodial air may have been ”breathable”
* Jonathan Law, G. Neil Phillips, Russell, E. Myers, Relevance of the Archaean Atmosphere to the Genesis of Banded Iron Formations, AusIMM Bulletin Nov/Dec 2002, 28-35
* G.Neill Phillips, Jonathan D. M Law, & Russell E. Myers, Is the Redox State of the Archaean Atmosphere Constrained? Soc. of Economic Geologists Newsletter Oct. 2001, No. 47 pp9-17
* SEG Newsletter

neo-Darwinian theory effectively requires an anoxic archaean atmosphere to form the essential amino acids etc. (as assumed by the Miller-Urey experiment). Thus it is asserted and the data selected and interpreted accordingly. However, Law, Phillips and Myers show that most lines of data support an oxic atmosphere with the much smaller number being ambiguous as to oxic or anoxic.

Should texts on Evolution, cite evidence for both oxic and anoxic and comment on the consequences?
- OR should they mention only evidence for anoxic atmosphere to support the materialist neo-Darwinian theory?


37

Allen_MacNeill

03/11/2008

9:02 pm

jerry:

I would be delighted to discuss Jabloka and Lamb’s book, Evolution in Four Dimensions. I find them to be refreshingly iconoclastic vis-a-vis the “modern evolutionary synthesis”, as well as terrifically up-to-date on the subject of epigenetic (and non-genetic) inheritance. Their chapter on genetic assimilation, in particular, was both exciting and eye-opening. I recommend it very highly, not the least because they provide very strong evidence that mutations in many cases are anything but “random”. Indeed, they explain how many mutations (perhaps almost all) happen in precisely the regions of the genome that are most likely to code for adaptations that are reacting to environmental stress. I intent to add this to the “it-ain’t-RM-&-NS-anymore, -so-let’s-move-on” list the next time I update it.

This is why science is both fun and endlessly fascinating to me! Let’s do science!


38

ericB

03/11/2008

9:06 pm

Allen_MacNeill: “To be blunt, there is no empirical evidence at all for how the transition from non-living to living material came about. Hence, any discussions about the process are pure metaphysical speculation, nothing more, and nothing less.”

Actually, it would be more accurate to say there is no empirical evidence in support of that transition via an undirected process. But that does not imply that there is no relevant evidence available. It only looks like “no evidence” if one thinks exclusively in terms of “supporting evidence”.

We can study evidence from physics and chemistry that indicates in principle that such a transition is not to be expected from undirected processes. That is still true scientific evidence (if it is allowed to be heard). We are not left with nothing more than metaphysics.

This was done with The Mystery of Life’s Origin. A more recent work in the same line is Stuart Pullen’s Intelligent Design or Evolution? Why the Origin of Life and the Evolution of Molecular Knowledge Imply Design.

Absent intelligent agency, there is no support in experience or in theory for a prebiotic “engine” that could apply and direct available energy toward the kinds of work that would be required. Nor does the blind prebiotic world have access to direction toward the future benefit of symbolic representation.

In short, it is our scientific knowledge about chemistry and undirected processes that informs the always-tentative but justified conclusion that chemicals, left to themselves, do not behave at all like that.

That said, I agree with your point that this has little practical relevance to the working evolutionary biologist who begins with life as a given.

As always, thanks for your regularly informative posts.


39

Allen_MacNeill

03/11/2008

9:10 pm

According to the article by Law, Phillips, and Myers (cited above) the atmosphere of the Earth may have had significant concentrations of free molecular oxygen (i.e. O2) as early as 2.8 billion years ago. However, this in no way contradicts the assertion that the primordial Earth’s atmosphere lacked free oxygen. According to the best estimates (based on multiple lines of empirical evidence) the Earth is about 4.5 billion years old. Fossil evidence of living organisms (spherical prokaryotes) have been unambiguously identified in rocks that date to about 3.8 billion years ago. Therefore, those prokaryotes (and their ancestors) were living in an atmosphere virtually devoid of free oxygen gas.

So, where did the 21% oxygen in our atmosphere come from? Virtually all but a tiny percentage of it is a by-product of non-cyclic photophosphorylation, a metabolic process that apparently evolved about 3.5 billion years ago. That still leaves about 700 million years between the origin of cells that released oxygen into the atmosphere and the iron pisoliths that Law, Phillips, and Myers describe in their paper.

So, to answer DLH’s question, I will indeed mention these discoveries in my upcoming evolution textbook.


40

ericB

03/11/2008

9:25 pm

p.s. It is ignorance about something that allows us the freedom to believe that anything can happen. It is through increase of knowledge that we begin to understand in principle both what to expect and what not to expect.

In this way, the hope of alchemy (or of abiogenesis) gives way to the understanding of chemistry and physics regarding limitations.

“Notice, however, that the sharp edge of this critique is not what we do not know, but what we do know. Many facts have come to light in the past three decades of experimental inquiry into life’s beginning. With each passing year the criticism has gotten stronger. The advance of science itself is what is challenging the notion that life arose on earth by spontaneous (in a thermodynamic sense) chemical reactions.”

– The Mystery of Life’s Origin, Summary and Conclusion, p. 185.


41

ericB

03/11/2008

9:48 pm

Regarding prebiotic oxygen levels, The Mystery of Life’s Origin devoted a chapter to “Reassessing the Early Earth and its Atmosphere”.

As a caveat, this is not something that I have been keeping up with. But they noted evidence along multiple lines that the higher UV production of the young sun produced significant free oxygen from photodissociation of water in the atmosphere.

On the high end of estimates (they cite several different sources and estimates):

“Brinkmann calculated the amount of O2 generated from photodissociation and consumed in oxidation of rock, etc. He concluded that a minimum of 25% of the present level (0.25 PAL) of oxygen existed over 99% of geologic time.” (p. 79)

Other estimates were more conservative, but there is a strong case that the earth did not need to wait for life to have free oxygen.


42

DLH

03/11/2008

9:57 pm

Allen_MacNeill at 38
Thanks for effort to provide objective evidence. Per your comment on 2.8 vs 3.5 billion years, may I encourage you to read the published articles giving their full survey. e.g.

The researchers’ theory has been lent additional weight by evidence from the Western Australian Pilbara region for the presence of sulphates in rocks up to 3.5 billion years old. These, too, could not have formed without an oxygen-rich atmosphere.

That nominally allows about 300 million years to the “origin of cells”.


43

DLH

03/11/2008

10:08 pm

Allen_MacNeill at 22
I find curious your insistence:

Furthermore, as I have repeated multiple times, evolutionary biologists do not speculate on the origin of life. Darwin didn’t, nor do virtually all of my colleagues in the field.

How about Darwin’s speculation:

“But if (and Oh! what a big if!) we could conceive in some warm little pond, with all sorts of ammonia and phosphoric salts, light, heat, electricity, etc., present, that a protein compound was chemically formed ready to undergo still more complex changes, at the present day such matter would be instantly devoured or absorbed, which would not have been the case before living creatures were formed.” Charles Darwin, Letter to J.D. Hooker Febuary 1, 1871.

Are you saying that none of the scientists described under Abiogenesis or RNA world hypothesis are evolutionary biologists (including Stanley Miller)? Out of 8 million hits in searching for: “evolutionary biologist origin life” are there virtually none of your “evolutionary biologist” colleagues speculating on the origin of life? I thought science promoted curiosity.


44

ericB

03/11/2008

10:14 pm

p.s. FYI: After looking further in the chapter, it appears that the upper bound suggested by other estimates for photodissociation alone are in the range of 1% to 10% present levels (or 0.01 to 0.1 PAL). (At some point, ozone begins to block that process.)

In any case, for anyone truly interested in nailing this down in detail, I would recommend checking for more recent research.

The main take away point is that until the ozone (O3) layer was established, photodissociation was likely at work even before living organisms were present.


45

DLH

03/11/2008

10:44 pm

Allan_MacNeill at 26

johnnyb
“The problem as I see it is that large portions of evolutionary theory are founded on assumptions about the origin of life. ”

Name one.

Consider if neo-Darwinian evolution assumes:
* 1) Life which can experience “random mutation”.
* 2) Life is self replicating and subject to subsequent “natural selection”.
* 3) The four primary forces are sufficient to explain all processes observed in nature.
Considering the theme of this thread, consider if neo-Darwinian evolution assumes:
* 4) Intelligent causation of any of the genome or “phenome” is not detectable or testable.

While not strictly the “origin” of life:
* 5) The increase of information coded in DNA in more complex life forms occurred by naturally observed processes.
(e.g., gene duplication, introns etc as you have listed).

Consider if textbooks on evolution can forthrightly state:

The Origin of Life is unknown, and some hold it is unknowable. From the early Greeks to the present, some model “life” assuming it arose purely by materialistic causes. Others see coded information and finely tuned cellular “factories” and model to see if these were due to intelligent causation.

Can that reality be stated?
- OR are only statements mandating materialistic presuppositions allowable? (with the implicit assumptions.)

PS Considering the “enthusiasm” for “science” by your fellow evolutionary biologists on this subject, you are absolved from answering if that would damage your career. We look forward to what you do state in your upcoming text.


46

kairosfocus

03/12/2008

5:09 am

Footnote:

If 1% of present Oxygen levels were present, according to Thaxton et al, the evidence is that it would “poison” a Miller-Urey type reaction. [Note how M-U used a reducing atmosphere, and how latterly there have been many attempts to remove the origin of life-relevant monomers from contexts tied to the atmosphere, e.g. comets, other planets, or undersea vents. And that does not even begin to address the implications of the sort of mineral found, that point to an oxidising atmosphere from earth's earliest days.]

And, we have not even begun to address the realistic concentrations of M-U type components, nor the chaining to get to polymers, nor the implications of the resulting racemic forms vs the chirality for the interlocking geometry of life, nor the constraints on said chaining to get to bio-functional polymers, nor the need for encapsulating these in close proximity in appropriate structures and with energy and materials flows across the membrane, etc.

In short, there is a lot of easily and directly observed empirical evidence relevant to the formation of life by chance + necessity only, based on requisites of life as we observe it.

It is just that it does not point the way that devotees of the evolutionary materialist paradigm want.

That is why, for instance, we can read Shapiro in Sci Am on the RNA world type hypothesis:

The RNA nucleotides are familiar to chemists because of their abundance in life and their resulting commercial availability. In a form of molecular vitalism, some scientists have presumed that nature has an innate tendency to produce life’s building blocks preferentially, rather than the hordes of other molecules that can also be derived from the rules of organic chemistry. This idea drew inspiration from . . . Stanley Miller. He applied a spark discharge to a mixture of simple gases that were then thought to represent the atmosphere of the early Earth. Two amino acids of the set of 20 used to construct proteins were formed in significant quantities, with others from that set present in small amounts . . . more than 80 different amino acids . . . have been identified as components of the Murchison meteorite, which fell in Australia in 1969 . . . By extrapolation of these results, some writers have presumed that all of life’s building could be formed with ease in Miller-type experiments and were present in meteorites and other extraterrestrial bodies. This is not the case.

A careful examination of the results of the analysis of several meteorites led the scientists who conducted the work to a different conclusion: inanimate nature has a bias toward the formation of molecules made of fewer rather than greater numbers of carbon atoms, and thus shows no partiality in favor of creating the building blocks of our kind of life . . . I have observed a similar pattern in the results of many spark discharge experiments . . . . no nucleotides of any kind have been reported as products of spark discharge experiments or in studies of meteorites, nor have the smaller units (nucleosides) that contain a sugar and base but lack the phosphate.

To rescue the RNA-first concept from this otherwise lethal defect, its advocates have created a discipline called prebiotic synthesis. They have attempted to show that RNA and its components can be prepared in their laboratories in a sequence of carefully controlled reactions, normally carried out in water at temperatures observed on Earth . . . . Unfortunately, neither chemists nor laboratories were present on the early Earth to produce RNA . . . .

The analogy that comes to mind is that of a golfer, who having played a golf ball through an 18-hole course, then assumed that the ball could also play itself around the course in his absence. He had demonstrated the possibility of the event; it was only necessary to presume that some combination of natural forces (earthquakes, winds, tornadoes and floods, for example) could produce the same result, given enough time. No physical law need be broken for spontaneous RNA formation to happen, but the chances against it are so immense, that the suggestion implies that the non-living world had an innate desire to generate RNA. The majority of origin-of-life scientists who still support the RNA-first theory either accept this concept (implicitly, if not explicitly) or feel that the immensely unfavorable odds were simply overcome by good luck.

And, Orgel [PLOS] rebuts, on the metabolism first scenario:

It must be recognized that assessment of the feasibility of any particular proposed prebiotic cycle must depend on arguments about chemical plausibility, rather than on a decision about logical possibility . . . few would believe that any assembly of minerals on the primitive Earth is likely to have promoted these syntheses in significant yield. Each proposed metabolic cycle, therefore, must be evaluated in terms of the efficiencies and specificities that would be required of its hypothetical catalysts in order for the cycle to persist. Then arguments based on experimental evidence or chemical plausibility can be used to assess the likelihood that a family of catalysts that is adequate for maintaining the cycle could have existed on the primitive Earth . . . .

The most serious challenge to proponents of metabolic cycle theories—the problems presented by the lack of specificity of most nonenzymatic catalysts—has, in general, not been appreciated. If it has, it has been ignored. Theories of the origin of life based on metabolic cycles cannot be justified by the inadequacy of competing theories: they must stand on their own . . . .

The prebiotic syntheses that have been investigated experimentally almost always lead to the formation of complex mixtures. Proposed polymer replication schemes are unlikely to succeed except with reasonably pure input monomers. No solution of the origin-of-life problem will be possible until the gap between the two kinds of chemistry is closed. Simplification of product mixtures through the self-organization of organic reaction sequences, whether cyclic or not, would help enormously, as would the discovery of very simple replicating polymers. However, solutions offered by supporters of geneticist or metabolist scenarios that are dependent on “if pigs could fly” hypothetical chemistry are unlikely to help.

I think both are right.

And, let us observe the force of Shapiro’s “then” on atmospheric composition. That is, the Miller Urey type experiment is of historical not scientific interest.

We can draw out some pointers if not conclusions: We have FSCI, we have algorithms and machinery that implements it. We know where such information based systems routinely come from. Agent action.

So, why is it that so many resist such an empirically anchored explanation for the origin of life? [And, given the same basic constraint on information generation, the body plan level diversity we observe across say a starfish, a trilobite and a turtle?]

GEM of TKI


47

Joseph

03/12/2008

7:06 am

Joseph asked (about Lynn Margulis):

“How is her testing coming?”

Just fine, thank you.

Has she observed free-living bacteria engulfing other free-living bacteria, with the engulfed bacteria continuing to live inside of the first one?

She’s been working hard in the field and in the laboratory, collecting empirical evidence that has convinced virtually every scientist in the world that her serial endosymbiotic theory of the origin of eukaryotes is the best supported theory for that process.

Many scientists also are convinced that whales “evolved” from land mammals. However there isn’t any data that would demonstrate that such a transformation is even possible.

Some of this is summarized in Symbiosis in Cell Evolution (for which she has been repeatedly nominated for a Nobel Prize). Have you read it?

I have read much of her work. I have read quite a bit on serial endosymbiosis- pros & cons. I will see about that book though. Thanks.

Have you read:

Kurland CG, Collins LJ, Penny D. Genomics and the irreducible nature of eukaryote cells. Science. 2006 May 19;312(5776):1011-4.

Al Gore received a Nobel Prize for something that turned out to be bogus.

And, while we’re at it, what field and laboratory research have you done to collect empirical evidence for an alternate theory, and where has it been published?

I have been too busy working on national security issues- detecting biological & chemical agents- and recovering from injuries I sustained in Iraq- three surgeries down and hopefully only one more to go.


48

Joseph

03/12/2008

7:15 am

BTW without free oxygen how did the nucleotides- you know the building blocks of DNA & RNA- come to be?

(only the purine adenine is without O)


49

kairosfocus

03/12/2008

8:19 am

H’mm:

First, best wishes to Joseph for a speedy recovery.

It also seems from his remarks just above, that there is an issue that needs to be firmly addressed:

[Allen:] And, while we’re at it, what field and laboratory research have you done to collect empirical evidence for an alternate theory, and where has it been published?

[Joseph:] I have been too busy working on national security issues- detecting biological & chemical agents- and recovering from injuries I sustained in Iraq- three surgeries down and hopefully only one more to go.

We need to look seriously at the issue of empirical testing and scientific hypotheses, as there is a whole province of such testing that, IMHBCO is not being properly and squarely faced by advocates of the evolutionary materialist paradigm.

Accordingly, I [again this morning . . .] need to excerpt from the Altenberg thread at 204:

Science is indeed in large part about inference to best current explanation, and retroductive, unifying explanation of diverse phenomena is as important and often at least as powerful as prediction.

Some would indeed argue that prediction is a subset of such empirical explanation, i.e providing a unifying construct that points to as yet non-instantiated empirical data. That is, the logic in basic form has structure, where T – theory, O – observation of fact, P – prediction of not yet observed fact:

T –> {O1, O2, . . . On} AND {P1, P2, . . . Pm},

where the marker between O’s and P’s is set temporally and sometimes financially. [Recall here the unbuilt super-collider that was going to be the lifetime employment programme for a lot of physicists . . . pardon my hints of cynicism.]

However, there is a further factor, as — as GP hints at — domains in science interact.

Namely, there are also points where theories have bridges (B) to other domains in science and associated bodies of accepted theory. Thus, we extend the basic model:

T –> {O1, O2, . . . On} AND {P1, P2, . . . Pm} AND {B1, B2, . . . Bk}

The classic current a case in point would be quantum physics which unifies across a very large cluster of domains across several entire fields of science and associated technologies, brilliantly. Never mind its own gaping inner challenges.

Now, too, let us observe: when a bridge to another established domain in science opens up, all at once there is the major potential for cross-checks across entire domains.

Thus, the opening of a bridge is fraught with potential for confirmation and disconfirmation, as all at once whole new domains of fact and associated theories are exposed to mutual cross-examination. If there is mutual coherence and support, then it lends our confidence in the underlying constructs in both domains a greatly enhanced weight of credence. [For instance, think here on the import of key bridging concepts such as atoms, energy, particles such as electrons, the wave concept, and now information.] But, on the other hand, where there is incoherence, we then have to look at the weights of the relevant alternative explanations and come to conclusions on where the changes need to be made.

That is a major reason why I take the design inference seriously, as the progress of molecular scale biology over the past 60 or so years has revealed elements of a complex, in part digitally based information system at the core of cell based life. Onward, that bridges to an even more established domain of science, thermodynamics. One may deny the bridges but they plainly are there and it boils down to this: the current dominant chance + necessity only paradigm in biology is deeply challenged to account coherently for the information systems and content at the core of cell based life.

Now, there is an alternative paradigm, design, that can. But it is controversial as it cuts across major worldview level commitments of many leading practitioners in the sciences. So, we now see a major political dust-up taking place, across entire domains of science and also in the education system and wider culture, where key dominant elites have embedded in key elements of the evolutionary materialist paradigm in their worldviews and life/culture agendas.

1 –> The existence of the information bridge implies, inter alia that work in information science is relevant to work on relevant alternate theories.

2 –> The key points on the exhaustion of probabilistic resources in searching config spaces of 10^300 or more cells on the gamut of the observed cosmos to find islands of bio-functionally relevant information, has been published in all sorts of peer reviewed literature by many people, as can easily be documented from the list of peer-reviewed articles at DI.

3 –> Actually though the peer reviewed research issue is a red herring leading to a strawman. For the underlying issue is well known and long since deeply embedded in the world of experience. Functionally specified complex information is to date only observed to be produced by intelligent agents, usually in the context of intentional activity, i.e design. The posts on this web page are immediately accessible cases in point. [Cf my "lucky noise" discussion in Section A of my always linked.]

4 –> So, there is a burden of proof shifting attempt going on. The real issue is that evo mat advocates are asserting — in the teeth of overwhelming improbability linked directly to the reasons we have confidence in the 2nd law of thermodynamics and the law of large numbers in statistics [cf my thought expt case study here, that expands Hoyle's 747 in a junkyard by a tornado illustration] — that mere bare logical or physical possibility is enough to overcome such overwhelming improbability.

5 –> Sorry, we aren’t buying that story anymore — you are up against overwhelming improbabilities on the scale of the observed cosmos, so much so that there is in praxis no effective difference between the probabilities and a practical/empirical zero. [Indeed in stat thermodynamics it is common to see odds of 1 in 10^50 being viewed as effectively zero.]

6 –> Nor does positing quasi-infinite arrays of cosmi with suitably scattered physical parameters get you any further than directly implying that we have crossed over from empirically anchored science to metaphysical speculation. On philosophy, we have a right to demand that ALL materially relevant alternative worldviews be admitted to the level playing field of comparative difficulties.

7 –> And that is before we get to discussing the outrageous censorship and career-busting multiplied by outright slander being carried out by the evolutionary materialist establishment. (Hence the likely success of Expelled.)

As they say in my homeland: “wheel and tun and come again.”

GEM of TKI


50

Joseph

03/12/2008

9:01 am

Allen,

Thanks for the book recommendations. I will be reading them.

The book Jerry just received “Evo in 4 Dim” at least appears to mirror Dr Lee Spetner’s “non-random evolutionary hypothesis” in which “built-in responses to environmental cues” is the main mechanism for adaptation.

Thanks again- live long and prosper…


51

jerry

03/12/2008

9:11 am

Having not read Spetner’s book, wouldn’t his hypothesis be easy to test. Just change the environmental cues and watch what happens. I am sure this has been done many times with various species. There should be a lot of published results.


52

tribune7

03/12/2008

9:23 am

Allen — with regard to DLH post 43.

It seems almost self-evident that OOL and evolution are conflated. You may not think it proper but that is the reality.


53

JPCollado

03/12/2008

10:00 am

tribune7 @ 33 wrote:

“It seems they want to have their soup and eat it too.” Origin of Life in Evolution 101 from Understanding Evolution at Berkeley.edu

Hey tribune, thanks for the web link. And great rejoinder too! This contradicts Mr. MacNeill’s assertion @ 23, when he wrote:

“Furthermore, as I have repeated multiple times, evolutionary biologists do not speculate on the origin of life.”

Perhaps Mr. MacNeill could clarify, especially when the site,

[...] is a collaborative project of the University of California Museum of Paleontology and the National Center for Science Education.

[in addition to the following organizations]
American Institute of Biological Sciences (AIBS)

National Evolutionary Synthesis Center (NESCent)

[And also]

Support for Understanding Evolution has been provided by The National Science Foundation and the Howard Hughes Medical Institute.

Maybe Mr. MacNeill is not aware of his colleagues’ efforts in the field?

Mr. MacNeill?
{DLH added Origin of Life Link & corrected other link to Evolution of Life http://evolution.berkeley.edu/evolibrary/home.php }


54

jerry

03/12/2008

12:02 pm

University of California at Berkeley has been on record for several years that evolution is not concerned about the origin of life

See this on their website about evolution

http://evolution.berkeley.edu/.....eory.shtml

It is standard with evolutionary biologists to not be concerned with OOL. It is an important issue and one often misrepresented in textboøks but usually only a minor discussion within the discussion of evolution.


55

JPCollado

03/12/2008

1:07 pm

Thank you jerry. Let me provide the link once more since the one I included @ 53 above apparently has the wrong file:

http://evolution.berkeley.edu/.....soflife_01

Now if it is true that evolutionary biology plays a minor or insignificant role in OOL research, then the heading of the article is very misleading:

“From soup to cells — the origin of life”

How can a website devoted to the furtherance of evolutionary education make such a strong statement without providing the facts? Surely, this will entail discussion of OOL, which is what supposedly evolutionary biology is not concerned with. Yet, the statement compels further discussion and explanation of the matter. How do they know that the original cell formed from a soup of chemicals? Do they really want to get into the foibles of such ponderings? Is it not better just to start with the cell and proceed from there? If OOL is not the mainstay, it would behoove them not make statements like that, for obvious reasons.

The site continues:

It’s important to keep in mind that changes to these hypotheses [about how life originated] are a normal part of the process of science and that they do not represent a change in the basis of evolutionary theory. [emphasis mine]

How do they know it would not change their current understanding of evolutionary theory when OOL is not even a domain of research, or when all of the full blown implications of such research have not been clearly spelled out as of yet? This sounds to me more like an emotional response to the dilemma posed by OOL. If it is determined that the process that gave rise to the first cell is in fact imbued with intelligence, then this will have tremendous implications for a theory that is materialistic-based and reductive-mechanistic by nature.

Notwithstanding, my question to Mr. MacNeill still merits attention: the statement that “within the field of evolutionary biology, the origin of life is of special interest” thus spurring the creation of hypotheses to deal with this issue is still in conflict with what Mr. MacNeill maintained @ post # 23.


56

JPCollado

03/12/2008

1:15 pm

JPCollado:
“If a theory is to be hailed as the cornerstone of a particular field of study it should at least fruitfully address the origin of the very thing that it purports to explain.”

Allen_MacNeill @ 23 responded:

“By your criteria, then, physics has no business studying gravity, since it proposes no origin for it, and chemistry has no business studying atoms, as it proposes no origin for subatomic particles.

[…]

Speculating about the origin of life […] isn’t evolutionary biology, which presupposes the existence of life in the same way that gravitational physics presupposes the existence of gravitational force.”

Mr. MacNeill,

You are providing a faulty analogy.

(1) first of all, the study of gravity and atoms is akin to the study of homeostasis and cells in biology, yet neither is called upon as a proper framework for the initial exploration of the origin of the universe or life, respectively.

(2) the origin of gravity has been intensely studied and is well established, albeit some minor exceptions.

(3) scientists have also proposed to explain the origin of the universe by way of multiple theoretical models, not the least of which is the Big Bang, the grand-daddy of them all (which, again, has nothing to do with gravity and atoms as starting points – see note 1 above).

(4) gravity is a known law of nature confirmed by repeatable testing and precise calculations, similar to quantum electrodynamics which is accurate to 13 unyielding decimal places. But Darwin’s theory makes no identical predictions at all and has not been observed with the same degree of mathematical precision and experimental certainty.

(5) we don’t hear cosmologists, physicists or chemists praising a particular theory as the cornerstone of the physical sciences. We do, however, hear about Kepler’s laws of planetary motion as forming an important foundation for later cosmological research and further enrichment of our understanding of the heavens. Kepler’s rigorous methods, though, are vastly different from those employed by evolutionists.


57

JPCollado

03/12/2008

1:24 pm

Let me also add that evolution.berkley also lists ancient fossils and phylogenetics as lines of evidence to “help illuminate the origin of life.” So Mr. MacNeill’s position that there is no speculation on the side of evolutionary biologists concerning OOL is without basis.


58

DLH

03/12/2008

1:47 pm

evolution.berkeley further touts:
From the origin of life to the future of biotech: The work of Andy Ellington

The understatements of the day at:
How did life originate?

“RNA and DNA molecules — the genetic material for all life — are just long chains of simple nucleotides.”

Many biologists hypothesize that this step led to an “RNA world” in which RNA did many jobs, storing genetic information, copying itself, and performing basic metabolic functions. Today, these jobs are performed by many different sorts of molecules (DNA, RNA, and proteins, mostly), but in the RNA world, RNA did it all.


59

tribune7

03/12/2008

2:02 pm

Jerry,

So when Berkeley has a web site — geared at kids– called “Understanding Evolution, Evolution 101″ and has it first page call “From soup to cells — the origin of life” they mean what?
I’d say they are trying to have their soup and eat it too.


60

JPCollado

03/12/2008

2:56 pm

Yeah DLH and tribune, so much for not wanting your pants to get wet in soup.

I like the link that DLH introduced. It has these interesting and choice quotes (bolded emphasis are mine):

Dr. Andy Ellington…studies evolution… uses evolutionary principles to evolve molecules [so if Dr. Ellington artificially induces these changes, it can't be darwinian in principle - - but the article does not make the required distinction] and organisms that serve all sorts of functions…

Surprisingly, Andy’s first research focus was not biotechnology, but the origin of life. [I thought specualtion of this area was not an issue with evolutionists] How did a scientist whose burning interest lies in the billion-year old chemical reactions of the primordial soup [notice that they take this at face value and expect people to go along with the tide] wind up running a lab of 50 people with millions of dollars in research grants? Although a fascinating issue, the origin of life typically does not attract much in terms of research funds. [I wonder why]Nevertheless, to Andy, the connection between origins research and evolutionary engineering is clear: “The same type of processes that would have led to functional molecules at or near origins are the processes that I use to make biosensors for military or homeland defense.” [and people wonder why there is so much government waste. Here we have a PhD scientist who is supposed to be a very intelligent and capable guy equating the use of artificial (i.e. intelligently guided) methods to create biosensors with the materialistic process implicated in OOL, when they are clearly not the same thing. And the contradicting statements are made in the space of a few sentences! So much for editorializing.]


61

JPCollado

03/12/2008

3:03 pm

As a follow up to post # 60 -

The various contradicting statements found in the articles linked with evolution.berkeley leads me to conclude not to put too much stock in whatever they have to say, OOL in particular.


62

jerry

03/12/2008

4:39 pm

tribune7,

It is probably that one person isn’t talking with the other. I have seen four different versions of their evolution courses and origin of life is mentioned only in passing.

I saw this web page a few years ago before I understood the debate as well as I do now and thought it was a big deal. Then I saw the same claim repeated several times by others.

These are really two separate issues. Each has no basis for their claims but how you assess each is quite different.


63

jerry

03/12/2008

4:53 pm

I understand a lot of the OOL research is funded by NASA as part of their exobiology program. So my guess it is limited since there is little application to anything useful such as medicine which generates zillions of research money.


64

StephenB

03/12/2008

5:09 pm

—–bfast: “A sad truth is that a number of scientists, zachriel comes to mind, have shared their knowledge on this forum in a reasonably tactful fashion, and got banned. I agree with you that knowledgable people from the other side of the equation are essential for our growth, and for keeping us honest.”

Is this really true? I have been around less than a year, so I could easily have missed something. During my time here, I have observed several bans, but I always knew the reason why. Are you suggesting that the arguments from the other side were so daunting that the ID administrators ran for the tall grass? I have a hard time believing that. What is your take on the reason they were expelled? Can you point me to a previous thread so I can make my own calculation about the justice or the injustice of the ban.


65

Atom

03/12/2008

5:50 pm

StephenB,

Sometimes people have been banned or threatened to be banned for simply not agreeing after a long series of exchanges. The threat comes something like:

“Consider yourself warned, if you keep posting nonsense and refuse to acknowlege the point I’m making you’re outta here. I’ve had to correct you X amount of times, already…”

more or less.

I agree, sometimes posters will use sarcasm, mock or simply insult ID or IDers and so should be banned.

But if you speak with a civil tone and still disagree with me, I see no reason to ban you. I think it stimulates the conversation on here when the other side gets involved. I’ve had or seen nice debates with Professor Olafsson, greatape, zachriel, Allen Macneill, etc.

But then again, this isn’t my site and I don’t have to take out the trash, so to speak. I’m sure it gets tiring.


66

PannenbergOmega

03/12/2008

5:52 pm

Good point Atom. By the way, it is nice to see you posting on Uncommon Descent again.


67

Allen_MacNeill

03/12/2008

6:40 pm

DLH mentioned (as I expected someone would) that Darwin did mention the origin of life in a letter to Joaeph Hooker. However, this was a private letter, and was never published during Darwin’s lifetime. Indeed, it was not published until the late 20th century, as part of the Darwin correspondence Project, now about to bring out volume 16 of Darwin’s collected correspondence (they’ve been at it for over two decades, and nowhere near the end).

In other words, what I asserted — that Darwin never speculated about the origin of life in written works that he published during his lifetime — is an accurate depiction of the state of affairs as far as I know.


68

Allen_MacNeill

03/12/2008

6:43 pm

Stanley Miller was not an evolutionary biologist. Indeed, he was not a biologist at all, he was a chemist, working in the laboratory of a physical chemist (Harold Urey). Furthermore, his research results were published in a journal of physical chemistry, not evolutionary biology.

Regardless of whether one is a supporter of evolutionary biology or intelligent design, it should be clear that questions about the origin of life from non-living materials are questions about chemistry, not biology. Biology begins with living material (cells, etc.) and goes on from there.


69

Allen_MacNeill

03/12/2008

6:48 pm

DLH wrote:

“Consider if neo-Darwinian evolution assumes:
* 1) Life which can experience “random mutation”.
* 2) Life is self replicating and subject to subsequent “natural selection”.
* 3) The four primary forces are sufficient to explain all processes observed in nature.
Considering the theme of this thread, consider if neo-Darwinian evolution assumes:
* 4) Intelligent causation of any of the genome or “phenome” is not detectable or testable.

While not strictly the “origin” of life:

* 5) The increase of information coded in DNA in more complex life forms occurred by naturally observed processes.
(e.g., gene duplication, introns etc as you have listed). ”

Precisely; every one of these processes happen in and require the functional operation of already living cells. Once again, they do not happen (as far as we have been able to determine to date) in non-living arrangements of chemicals. This, therefore, neither “proves” nor “disproves” the assertion that the origin of life from such chemicals is possible or impossible via natural means.

As I have stated before, this means that there is no empirical evidence either way, and I suspect there never will be.


70

StephenB

03/12/2008

6:58 pm

Atom: thanks for your assessment.


71

tribune7

03/12/2008

7:12 pm

Jerry

These are really two separate issues. Each has no basis for their claims but how you assess each is quite different.

I’m not really arguing with you with regard to this.

My point is that there are people and institutions who are anti-IDists that don’t separate the issues or separate the issues only when they perceive there to be some sort of political advantage which is even more troubling and rather non-scientific to boot.

And it is not unreasonable to ask why this occurs — the only answer I see is that they are seeking to establish a religion — and to tell ID skeptics who visit this site and insist that OOL doesn’t apply to evo that they are preaching to the wrong choir.


72

Allen_MacNeill

03/12/2008

7:31 pm

Joseph asked:

“Has [Lynn Margulis] observed free-living bacteria engulfing other free-living bacteria, with the engulfed bacteria continuing to live inside of the first one?”

Yes, thousands of times. You can, too; the most common example is a bacterium called Bdellavibrio, which penetrates the cells of other bacteria and lives inside them as a semi-parasite.

However, a much more spectacular example is an Australian protozoan named Myxotricha paradoxa. This protozoan lives in the guts of wood-eating termites. On superficial examination, they appear to be very large ciliated protozoa. However, on closer examination they can be seen to consist of several hundred symbiotic bacteria of at least three distinct types (”species”, although this concept does not apply to bacteria). Lynn often shows videos of Mixotricha to illustrate her concept of serial endosymbiosis (as she did in her lecture last month for Cornell’s Darwin Day celebration).


73

Allen_MacNeill

03/12/2008

7:37 pm

Joseph wrote:

“Many scientists also are convinced that whales “evolved” from land mammals. However there isn’t any data that would demonstrate that such a transformation is even possible.”

On the contrary, there is a mountain of evidence for precisley this point, derived from multiple lines of empirical evidence. For example, there is a large and growing fossil record of intermediate forms, begining with a Paleocene artiodactyl and moving through such forms as Pakycetus up to modern-day Mysticeti. Furthermore, there is abundant evidence for the genetic modifications that took place during this series of phenotypic transitions. Finally, there is the fact (known since the early 19th century) that whales occasionally grow legs, which are anatomically extremely similar to those of tetrapods, especially artiodactyls. Once again, the inference that virtually all evolutionary biologists draw from such evidence is that whales evolved from an artiodactyl ancestor, and that this phenotypic evolution was correlated with corresponding genetic changes.


74

Paul Giem

03/12/2008

7:39 pm

Allen_MacNeill, (69)

I’m surprised at you. After previously being reasonably careful, you state, regarding “the assertion that the origin of life from such chemicals is possible or impossible via natural means”, “there is no empirical evidence either way, and I suspect there never will be.”

Now, I can understand if you said “there is no conclusive proof either way”, or even “the evidence is weak.” But don’t Pasteur’s experiments, or the difficulties in creating bases for nucleic acids, or the uniform failure of OOL experiments, or the absence of detectable life on Mars, even count as empirical evidence?

I can understand why one might wish to disregard such evidence as not proving a naturalistic scenario wrong, and using that lack of proof to accept a physical or metaphysical theory that one finds attractive on other grounds. Faith, in science, is what keeps people searching for something until they find it, say, the HIV virus, or the effect of gravity on light. And faith sometimes has to go against the grain of the available empirical evidence. But really, to say that there is no empirical evidence at all?


75

Allen_MacNeill

03/12/2008

7:40 pm

JPCollado wrote:

“…gravity is a known law of nature confirmed by repeatable testing and precise calculations, similar to quantum electrodynamics which is accurate to 13 unyielding decimal places.”

Yes, but neither Newton nor Einstein proposed any explanation of why the gravitational force exists, only that it does. Furthermore, the most important physicist in the development of quantum electrodynamics, Richard Feinman (formerly of Cornell, BTW) himself admitted that he couldn’t explain why the theory works, only that it does. That is, the “law” of gravity and the theory of quantum electrodynamics are purely descriptive, and do no provide any explanation of why such forces exist in the first place.


76

DLH

03/12/2008

7:41 pm

Allen_MacNeill at 67:

. . .what I asserted — that Darwin never speculated about the origin of life in written works that he published during his lifetime — is an accurate depiction of the state of affairs as far as I know.

However, at 23 your actual assertion was unqualified:

evolutionary biologists do not speculate on the origin of life. Darwin didn’t, . . .

Thus, citing Darwin is still justified on your actual assertion, (not on what you wished you had said.)


77

Allen_MacNeill

03/12/2008

7:44 pm

JPCollado also wrote:

“…we don’t hear cosmologists, physicists or chemists praising a particular theory as the cornerstone of the physical sciences.”

We don’t? Then why does John Wheeler’s book on gravitation (arguably the most influential book on the subject ever published) begin with a detailed analysis of Einstein’s theory of general relativity, upon which virtually all modern cosmology and gravitational physics is based? Scientists don’t so much go into “praise”; what passes for “praise” in science is citing someone every time you talk about a particular subject. Like Darwin, for example, when one is talking about evolution…


78

Allen_MacNeill

03/12/2008

7:52 pm

DLH:

I stand corrected; what I should have said is what I said in my later post: that Darwin never speculated in his published works about the origin of life. I knew this when I wrote the previous post, but was not careful enough in qualifying my description. So sue me…


79

DLH

03/12/2008

7:53 pm

Allen_MacNeill
Thanks for responding and affirming that neo-Darwinism holds:
“* 3) The four primary forces are sufficient to explain all processes observed in nature.”

This restates materialism, and per force excludes intelligent agents or asserts that “intelligent agents” are but stochastic materialistic processes. In particular, it disavows “theistic evolution”, because limiting processes to “the four primary forces” precludes any action of a theistic or deistic “creator” (no matter how much Kenneth Miller protests.)

By saying neo-Darwinism affirming:
“* 4) Intelligent causation of any of the genome or “phenome” is not detectable or testable.”
it specifically a priori claims that panspermia, with alien formation of genomes and seeding on Earth, is not detectable.

However, Craig Venter et al. have coded a copyright into DNA.

GTCGTGCAATTGGAGTAGAGAACACAGAACGA [33]

(CRAIGVENTER)

GTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAG [45]

(VENTERINSTITVTE)

CATGCAATGTCGATGATTACCCAC [24]

(HAMSMITH)

TGCATAAACGACATCGCTAATGACTGTCTTTATGATGAA [39]

(CINDIANDCLYDE)

GGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG [39]

(GLASSANDCLYDE)

Thus any blanket assertion by neoDarwinism that “Intelligent causation of the genome . . . is not detectable or testable” is now contradicted by evidence of the recent detection of intelligent causation in artificial DNA.


80

DLH

03/12/2008

8:31 pm

Allan_MacNeill at 78
Thank you for your acknowledgment. It helps to hold each other accountable.


81

DLH

03/12/2008

8:48 pm

Allen MacNeill at 69
Thanks for your affirmation that: “neo-Darwinian evolution assumes:
* 1) Life which can experience “random mutation”.
* 2) Life is self replicating and subject to subsequent “natural selection”.
* 3) The four primary forces are sufficient to explain all processes observed in nature.”

Let us explore the next step back in time and consider if:

“neo-Darwinian evolution assumes that:

6). Stochastic processes of the four forces of nature are sufficient to form simple genomic life that can experience “random mutation”.

7). Stochastic processes of the four forces of nature are sufficient to form self replicating simple life with inheritable changes that experiences “natural selection.”

You further stated:

Once again, they do not happen (as far as we have been able to determine to date) in non-living arrangements of chemicals.

Further to this statement, consider the alternative presupposition:

“8). Simple life experiences inheritable variations, some of which may affect reproduction. Whether life originated from stochastic natural processes, or included intelligent causation is unknown.”

Does neo-Darwinian modern evolution require 6) and 7)?
OR could it consider 8)?


82

ericB

03/12/2008

9:18 pm

Atom: “But if you speak with a civil tone and still disagree with me, I see no reason to ban you. …”

I’d like to add that in my experience Allen_MacNeill has consistently set an excellent example for bringing an informed, thoughtful, and civil evolutionary perspective to discussions.

I also give him high marks among evolutionists for his crystal clear understanding about certain issues, e.g. that natural selection is not an engine of evolution.

I don’t agree with everything he says (more in a moment), but I would be hard pressed to think of an evolutionist representative that I would rather see in a panel discussion.


83

DLH

03/12/2008

9:33 pm

ericB
Here ye, here ye. MacNeill is a gentleman and a scholar. We all wish his example was not so uncommon.


84

ericB

03/12/2008

9:40 pm

Allen_MacNeill (69): “As I have stated before, this means that there is no empirical evidence either way, and I suspect there never will be.”

Hi, Allen. Say, I seem to have missed your response to my posts 38 and 40 above on this point.

I will readily grant your general points that

1) OOL is itself outside the scope of evolutionary biology,

2) That this is therefore outside your area of expertise (so it is reasonable that you should not be expected to defend or assess particular positions in the matter), and

3) OOL is more so in the line of interest for physicists and chemists, rather than biologists.

I affirm all three.

But then, on what basis do you confidently exclude the possibility of empirical evidence on the matter, especially when I have already quoted from scientists who are in those fields and who say there has been an increase in relevant empirical evidence on the matter (albeit not in favor of the abiogenesists)?

Is it reasonable to both place it outside your field and your expertise, and insist that it is not amenable to empirical evidence, despite the statements of those in the relevant fields to the contrary?


85

jerry

03/12/2008

10:13 pm

tribune7,

A popular college biology text I just purchased, Sadava, Heller, Orians, Purves and Hillis, 2008 devotes 280 pages to evolution and 7 pages to origin of life or a ratio of 40 to 1. The OOL part is in the first section of the book when the chemistry of biology is discussed.

If you went over the entire Berkeley site on evolution you might see similar proportions for evolution vs. OOL.

One reason I am sure is that they feel less comfortable with making any claims about how OOL happened. If I get to read all of Sadava et al’s text on evolution, then I will see what evidence they provide that Darwinian processes can produce complexity. My guess is that it will be little. There is a framework for evolution but not for OOL so this is why there is much more devoted to it. They actually believe Darwinian processes work but have no faith in anything related to OOL.

Since a lot of Dembski’s work is directly relevant to OOL, it is likely that a lot of people conflate the two topics. Behe’s work is more directly related to evolution. Since ID subsumes the two approaches, those coming to ID get the two perceived as one until enough is made of the difference.


86

Joseph

03/13/2008

7:15 am

Allen,

All the “evidence” to support cetacean evolution from a land mammal is circumstantial at best and relies on the assumption.

Now if I assumed a common design I could also incorporate that SAME evidence into that scenario.

And if I assumed convergence I could still incorporate the SAME evidence into that scenario.

IOW UCD is nothing more than magical mystery mutations plus father time.

Until someone can account for the physiological and anatomical differences via the genetic differences alll you have is speculation based on the assumption.

And THAT is why I chose technology over biology as a career.


87

tribune7

03/13/2008

8:09 am

If you went over the entire Berkeley site on evolution you might see similar proportions for evolution vs. OOL.
That’s fine. But why do they have a page called Origin of Life– From soup to cells on a site called Understanding Evolution, Evolution 101?


88

DLH

03/13/2008

8:24 am

Allen et al.
Some consider OOL “part of” neo-Darwinian “modern” evolution, others insist that it is separate.

Either way, does not neo-Darwinian evolution require self replicating life to start with?
See DLH at #45 and MacNeill at#69 above.

For atelic models, BOTH of these assume “stochastic” variations or “random” mutations.

The major difference as I see it is that “neo-Darwinism” assumes filtering by “natural selection” while OOL does not yet have “life” which at least requires a self replicating cell.

Neo-Darwinists appeal to “natural selection” as “creating” the observed increase in coded DNA and new cell forms and body plans
(Which ID sees as new “complex specified information” that is NOT mechanistically causable by “natural selection”).

However, OOL does not have the self replicating cell on which “natural selection” can work. (Though I see various Darwinian enthusiasts try to appeal to “natural selection” for OOL mechanisms.)

So foundationally, I see materialistic OOL has no “natural selection” of self replicating cells.
Consequently it only has
1) stochastic or random variation
and
2) “self organization” due to natural forces.
e.g. macromolecule “coalescing” or “folding” caused by stereo constraints and by Van der Waals forces or similar arguments.

This raises even greater challenges than neo-Darwinisism to explain
3) The origin of coded information in DNA

4) The “information processing” mechanisms of
4a) replicating DNA and
4b) expressing proteins from DNA.

5) Energy capture/conversion to biotic energy. (e.g. photosynthesis, ATPsynthase and ATP cycles.)

6) Cell membranes with ion pumps, nuclear pores, systems to replicate those components and other “material processing” systems.

Allen has further pointed to major cell mechanisms or the “phenome” complementary to and not explainable by the “genome.”

There are further error correction mechanisms needed to preserve the coded information from being destroyed by “entropy” via “random mutation”.

ID sees no foundational method for neo-Darwinism to “create” the increased “Complex Specified Information” starting from the self reproducing cell.

ID sees far greater problems of taking stochastic processes of the four laws of nature and arriving at “life” with self reproducing cells.

And yet neo-Darwinism requires this to proceed.

Thus whether OOL is “part of” “neo-Darwinism” or not, it is still “foundational” and necessary to it.

If “neo-Darwinism” seeks to require only materialistic causes, then we expect it to equivalently require only materialistic causes for OOL.

(Though Darwin attributed it to the Creator as politically correct for his day.)

Thus the challenge to neo-Darwinists is provide mechanisms that even conceptually arrive at coded information, energy processing, etc. in self reproducing cells that is separate from “self organization” by the stochastic four laws of physics.

Theoretical physics happly models black holes and other astronomical objects on which we cannot run physical experiments. While there are no “fossils” for the origin of Life etc. that does not mean that known processes of chemistry, physics and biochemistry cannot be applied.

It is from what we KNOW of physics, chemistry, biochemistry and the foundational stochastic processes of the four forces that ID holds that OOL and neo-Darwinism is foundationally incapable of arriving at the new coded information and fine tuned operations and energy flows of the simplest living cells, let alone biotic systems with complex body plans.

Correspondingly, it is from what we KNOW that coded information and intricately designed are caused by intelligent agents (as in computers, information storage, software programming etc.) that ID attributes biotic systems to originate by intelligent agents.

This is what I mean when I say that OOL is the “Achilles heel” of neo-Darwinism, whether OOL is considered a part of neo-Darwinism or not.

See: The Altenberg 16 comment by DLH #167 and
Response by Allen_MacNeill at Altenbert 16 comment #174


89

jerry

03/13/2008

9:42 am

tribune7,

“That’s fine. But why do they have a page called Origin of Life– From soup to cells on a site called Understanding Evolution, Evolution 101?”

Why don’t you ask them about the supposed contradiction, I can give you a stock answer and that is “People ask about it and thus we include a brief discussion about the chemical evolution of life.”

And then you can give them your reply that this isn’t entirely consistent because of the two pages. At which point they will say what real difference does it make. And they will be right since they do not make a big deal of it.

I find this entire discussion of little use unless it helps separate the two issues in people’s minds. But even with this discussion there is an attempt to conflate them. Both OOL and the macro evolution part of the modern synthesis are equally bogus as far as I am concerned and it is important to make the distinctions between them and the then subsequent arguments against each. Just as it is important to make the distinction between macro evolution and micro evolution and that natural selection has been very productive but only in micro evolution. But many people here don’t make that distinction either.

I bet if you asked the typical commenter here whether Dembski’s work is primarily concerned with OOL or evolution, they would answer evolution. And they would be wrong. While his ideas are being extended to include evolution they are primarily about OOL and the origin of specified information in DNA. (I am sure there will be many ready to line and say different) Behe is nearly 100% about evolution.

There are some similarities between OOL and evolution. We use arguments used to discredit macro evolution to also discredit OOL. If we found naturalistic causes to support macro evolution, those same causes would then be invoked to support OOL. The fact that we do not find any naturalistic causes for macro evolution let’s us extend this argument against OOL.

People here have a singular objective, to discredit materialism. And because of that they often do not see the forrest for the trees and look for any argument whether it is coherent or not.

If you are looking for fodder to discredit materialism using OOL specifically then look at the statements of both MacNeill and Robert Hazen who has written a popular book on OOL. Both of them say we essentially know nothing. They will not admit the enormity of the problem only that we know essentiall nothing. As such this sentiment should appear in every biology textbook in existence. But it won’t. What appears is the latest speculations presented as facts.

Hazen has lots of optimism about finding a solution and expresses the opinion that it is just a matter of time before we find the explanation. But all he presents is his optimism and a myriad of speculative concepts. And he is at the center of research on this issue.


90

Charlie

03/13/2008

9:42 am

Hi Allen,
At #81 DLH says you affirm his third point:
That neo-Darwinian theory assumes 3) The four primary forces are sufficient to explain all processes observed in nature.

I know that the complete implications of this thought are not the exact point, but did you mean, in fact, to affirm this when you said “Precisely”?

At that comment #69 you also said this:

This, therefore, neither “proves” nor “disproves” the assertion that the origin of life from such chemicals is possible or impossible via natural means.

As I have stated before, this means that there is no empirical evidence either way, and I suspect there never will be.

As Paul Giem implied at #74, you seem to be off on what constitutes “evidence” on this point.

ps.
As an example of evidence which does not rely on “proof” v. “disproof” you mention Pakicetus - as an aside, has this freshwater creature not now been replaced as an ancestor to modern whales to now stand as an example of “convergence”?


91

Joseph

03/13/2008

10:29 am

Allen,

Thank you for the references on endosymbiosis- ie Dr Margulis’ experiments..


92

DLH

03/13/2008

11:26 am

Charlie at 90
Good catch.
While Allen has nominally supported #3, I will now presume Allen has not seriously considered the implications of #3.


93

DLH

03/13/2008

9:09 pm

jerry at 89
“whether Dembski’s work is primarily concerned with OOL or evolution,”

Any evidence on your assertions?

e.g. See his papers on conservation of information in searching etc.
Publications Evolutionary Informatics Lab.


94

kairosfocus

03/14/2008

1:24 am

H’mm:

While I see Windows Vista is acting up again [I REALLY cannot recommend it!!!], I must comment on the below extract from 89:

[Jerry, 89:] I bet if you asked the typical commenter here whether Dembski’s work is primarily concerned with OOL or evolution, they would answer evolution. And they would be wrong. While his ideas are being extended to include evolution they are primarily about OOL and the origin of specified information in DNA. (I am sure there will be many ready to line and say different) Behe is nearly 100% about evolution.

There are some similarities between OOL and evolution. We use arguments used to discredit macro evolution to also discredit OOL. If we found naturalistic causes to support macro evolution, those same causes would then be invoked to support OOL. The fact that we do not find any naturalistic causes for macro evolution let’s us extend this argument against OOL.

I am not so sure that WD’s work is primarily about OOL and only by extension macro-evolution:

1 –> Last I checked, WD is in the main dealing with origin of INFORMATION of a particular type or two [a] complex, specified information (CSI) (of which [bio-]functionally specified, complex information [FSCI] is a relevant subset), and latterly, [b] active information that enables search algorithms to exceed the on-average performance [including failure!] of random walk searches.

2 –> In that context, he has proposed an explanatory filter which allows us to distinguish on an observed reliable empirical basis among: necessity, chance and intelligent design/agency.

3 –> In short, [1] if lawlike natural regularity rooted in mechanical necessity then “necessity”; [2] if highly contingent, then either chance or design; [3] if “simply” specifiable [in various relevant senses such as Kolmogorov complexity or by observable functionality etc] and complex beyond odds of 1 in 10^150 then design; [4] otherwise, chance.

4 –> In all cases where we directly know/observe the causal story, and where this filter rules “design,” it is correct. [It is deliberately designed to be prone to false negatives and will potentially rule "chance" in many cases where the design is not sufficiently complex.]

5 –> On both OOL and macro-evolution, we see that we address the origin of complex, bio-functionally specified information. In the first case, to get to/ account for the first viable life form. In the second, to originate/ account for especially body-plan level bio-diversity.

6 –> For both cases, the information found in and expressed physically through the DNA-RNA-Ribosome-Enzyme protein system is a highly relevant case in point. Of these, it is convenient to select DNA, a code-bearing storage molecule that ranges 300 - 500,000 to 3 - 4 bn base pairs, each having four possible states.

7 –> Relevant to OOL, Meyer informs us that 300 k is about the lower limit observed for viable cell-based life. But 4^300,000 ~ 9.94 * 10^180,617.

8 –> That is the configuration space for the shortest credibly viable DNA chain — ignoring issues over pre-biotic spontaneous synthesis of relevant monomers, formation of sufficiently long chains to be credible and chirality [on either RNA world or metabolism first scenarios as already noted] — is vastly beyond the UPB. Even if we assume 10^1000 islands of biofunctional states, each with 10^150 states, that is not even a droplet in the bucket.

9 –> That is, we see no credible basis for a random walk based search in a prebiotic soup getting to the shoreline of an island of biofunction from the assumed arbitrary start point. But, we know that agents are capable of using insight, skill and intent to design and effect highly isolated specified functional structures in highly contingent contexts, e.g. even this thread in aggregate is a case in point.

10 –> As Meyer pointed out in PBSW, the sort of body-plan level bio-diversity exhibited in say the Cambrian life revolution is also a case relevant to generation of CSI. For, we are dealing with the origin of dozens of phyla and sub-phyla, requiring novel architectures for cells, organs and systems as well as the body as a while. For instance we move from a few mn base prs for unicellular organism to for comparison 180 million base pairs for a modern arthropod; here viewed as a model for the complexity of say a trilobite. We similarly have to account for the complexity of say a starfish and a chordate — all within the window allowed by the conventional geological timescale.

11 –> An increment of 100 mn base pairs entails an increment of ~ 1.36*10^60,205,999 in the required config space; and such has to happen several times over. This dwarfs even the challenge at OOL, even if we make generous allowances for “junk” DNA or the like.

12 –> In short for BOTH ool and oo body plan level biodiversity, we see required increments in CSI that are not credible relative to the available probabilistic resources of the observed cosmos and moreso, the 4.5 By usually held to be available on earth [much less the 5 - 10 MY usually held to be the duration of the Cambrian window].

I therefore conclude that the work of Dembski is relevant to both cases, as I discuss in my always linked.

Further to this, the key observation is that once it was recognised that a code-bearing molecule of enormous storage capacity and functionality lies at the heart of the cell, we have opened a series of bridges to all the science of information, thermodynamics and chemistry, inter alia. Thus, there are now serious, empirically anchored challenges to the concepts advanced through the Darwinian syntheses of the 1830’s - 50’s and also the 1930’s, based on the rise of information science since the 1940’s. And NDT is not doing so well in addressing these challenges.

Dr MacNeill has more or less tried to cordon off the OOL problem [though there is enough evidence form other quarters to show that NDT is part of an integrated paradigm of proposed materialistic evolutions form hydrogen to humans]. Indeed, conformity to this cascade has become in effect an unacknowledged criterion for definition of what is “scientific,” in many quarters: things are “scientific” only if they conform to this grand story of of origins.

But the same basic challenge holds for macro-level, body-plan originating evolution.

And WD’s work applies to both.

GEM of TKI


95

Joseph

03/14/2008

7:03 am

“Has [Lynn Margulis] observed free-living bacteria engulfing other free-living bacteria, with the engulfed bacteria continuing to live inside of the first one?”

Allen Macneill:
Yes, thousands of times. You can, too; the most common example is a bacterium called Bdellavibrio, which penetrates the cells of other bacteria and lives inside them as a semi-parasite.

It drills/ bores inside and eats the host from the inside out. Once it starts replicating it’s all over for the host. Not a very good symbiotic relationship developer.

Allen:
However, a much more spectacular example is an Australian protozoan named Myxotricha paradoxa. This protozoan lives in the guts of wood-eating termites.

Protozoan. I was unaware that a protozoan was now classified as a “free-living bacteria”.

Is that what you teach?

Allen Macneill:
On superficial examination, they appear to be very large ciliated protozoa. However, on closer examination they can be seen to consist of several hundred symbiotic bacteria of at least three distinct types (”species”, although this concept does not apply to bacteria). Lynn often shows videos of Mixotricha to illustrate her concept of serial endosymbiosis (as she did in her lecture last month for Cornell’s Darwin Day celebration).

There is a better example with a melee bug. That is a bacteria living inside of a melee bug has another bacteria inside of it.

So what I get from this is if we have suitable hosts- termites, protozoans and melee bugs- then we can observe a form of endosymbiosis, therefor endosymbiosis for the origins of organelles in eukaryotes is confirmed.

Sounds fishy to me.


96

JPCollado

03/14/2008

11:51 am

DLH @ 88. Excellent summary.

I just can’t fathom how a profession devoted to the study of a given subject would resist exploring an area of such great relevance and import as offering the potential for shedding further enlightenment. One would think that biologists would be interested to know how the first living entity acquired those astounding attributes that so sets it apart from the rest of the inanimate world.

The nature of OOL research demands a multidisciplinary approach requiring the joint effort of chemists/physicists/biologists alike because of the thin veil existing between the living and non-living at the moment of the existential differentiation and separation. Isn’t the long-standing, insurmountable mystery of OOL enough to compel scientists of all stripe to work together in finding a solution? Like others have said in this thread, it is but a copout when an evolutionist says that OOL is not a subject of study for biology. As if geochemists working autonomously are in a more enviously advantageous position for settling the matter.

Washing one’s hands and leaving the responsibility to others is counterproductive and against the soul of science, when active cooperation proves to be the more efficacious alternative. Isn’t curiosity the father of discovery? Taking such a stance speaks volumes about the possible ramifications that may be had and gives us a glimpse of a possible backlash that evolutionists may be fearing. And talk about science stoppers. At least, finding out what was it that generated the first living thing could prove helpful in determining whether all life forms actually came from a single common ancestor or multiple sources.


97

JPCollado

03/14/2008

12:26 pm

JPCollado @ 56:
“…gravity is a known law of nature confirmed by repeatable testing and precise calculations, similar to quantum electrodynamics which is accurate to 13 unyielding decimal places.”

Allen_MacNeill @ 75:
“Yes, but neither Newton nor Einstein proposed any explanation of why the gravitational force exists, only that it does. Furthermore, the most important physicist in the development of quantum electrodynamics, Richard Feinman (formerly of Cornell, BTW) himself admitted that he couldn’t explain why the theory works, only that it does.”

C’mon, Mr. MacNeill.

I wasn’t the one who introduced the concept of gravity to begin with. As a matter of fact, your response in post # 75 is further substantiation of what I was trying to elucidate in # 56 (specifically, points 1 and 3). Incredibly, now you are agreeing with me that using gravity as a starting point for explaining the origin of the universe is quite misplaced. And that was one of my lines of argument - that the analogy is just simply flawed on the grounds that it is not an adequate platform for analyzing or exploring the relevant questions as should be.

Also, the question was not why gravity exists, but how it has come to exist. Weren’t we discussing the origin of things in the first place?

Let me reiterate what I wrote in # 56:

“3) scientists have also proposed to explain the origin of the universe by way of multiple theoretical models, not the least of which is the Big Bang, the grand-daddy of them all (which, again, has nothing to do with gravity and atoms as starting points.”

Here now I am amazed to see that you are destroying the analogy that you introduced as a way of countering my original argument (at post # 21), viz. ”if a theory is to be hailed as the cornerstone of a particular field of study it should at least fruitfully address the origin of the very thing that it purports to explain.”

All of this just to save face and protect a helpless and indaquate theory.


98

JPCollado

03/14/2008

1:03 pm

Allen MacNeill @ 77:

You mention cosmology (the science that studies the origin of the universe) yet fail to see how well this ties to my main argument @ #21 & #56, i.e., that physical scientists - in contrast to biologists - have indeed proposed to “speculate” on the origin of the very thing that they purport to explain.


99

JPCollado

03/14/2008

1:39 pm

Alan MacNeill @ 67:

“what I asserted — that Darwin never speculated about the origin of life in written works that he published during his lifetime — is an accurate depiction of the state of affairs as far as I know.”

Mr. MacNeill, do you suppose this has something to do with Darwin’s stealthy methods of escaping from a problem, like for instance, his similar avoidance in trying to explain how an eye could have developed or, more specifically, how an optical nerve would become sensitive to light?


100

JPCollado

03/14/2008

3:33 pm

jerry @ 89:

“At which point they will say what real difference does it make. And they will be right since they do not make a big deal of it.”

The more important question is, why aren’t they making a big deal of it to begin with? Is it because they don’t want to concede that darwinian processes are powerless at that juncture where life and non-life meet and incapable of creating the wonders that are so often heaped upon it? The continued insistence for not providing the real reason is very revealing.

These guys are just following the same tactics Darwin used in his Origin of Species. Darwin, the shrewd rhetorician that he was, saw the pitfalls that a discussion of OOL would entail, and smartly opted to leave the matter untouched. In similar stealthy fashion, Darwin also did not want to discuss how “organs of extreme perfection and complication,” such as the eye, could have developed via natural selection (which, btw, is something rightfully belonging in the realm of developmental biology), preferring instead to conjure up his fanciful imagination in sliding the problem away and dumping it along with OOL as matters that were of no concern to his theory.

[…] the difficulty of believing that a perfect and complex eye could be formed by natural selection, though insuperable by our imagination, can hardly be considered real. How a nerve comes to be sensitive to light, hardly concerns us more than how life itself first originated.

Source: Origin of Species, Chapter 6 - Difficulties on Theory

How convenient.


101

DLH

03/15/2008

10:39 am

Allen et al. See further discussion at:
DLH at 128


102

DLH

03/15/2008

5:05 pm

Allan at 23, 67
See also Letter 3154 — Darwin, C. R. to Herschel, J. F. W., 23 May [1861]] Darwin wrote:

“The point which you raise on intelligent Design has perplexed me beyond measure; & has been ably discussed by Prof. Asa Gray, with whom I have had much correspondence on the subject. I am in a complete jumble on the point. One cannot look at this Universe with all living productions & man without believing that all has been intelligently designed; yet when I look to each individual organism, I can see no evidence of this.

Darwin’s acknowledging that “all has been intelligently designed” while refusing to see evidence in individual organism’s appears to continue on to today.


103

ericB

03/15/2008

7:27 pm

Allen_MacNeill,

You have repeatedly maintained that the abiogenesis issue is “pure metaphysical speculation, nothing more, and nothing less”. If you really believe that, would you favor the termination of spending government scientific research funds on OOL projects?

If you support continued funding of OOL projects with the government’s scientific research dollars, even though “all valid theories must have empirical support” and it is not “likely that such evidence will eventually be forthcoming”, then, applying a consistent standard, what other kinds of metaphysical projects could be funded with government science research dollars?

If you actually consider OOL research to be legitimately scientific research, do you then consider abiogenesis to be falsifiable? If so, how? If not, how is an unfalsifiable position that is currently without the support of any empirical evidence a “scientific” position?

If it is not a “scientific” position, would it be appropriate to remove any and all claims that life originated spontaneously from non-life from science textbooks? If not, what other metaphysical speculations should be permissible in science textbooks?

[Regarding Huxley's principle, I will post my response in the "Complex speciation of humans and chimpanzees" thread.]


104

kairosfocus

03/16/2008

4:08 am

Eric [and Allen et al]:

The funding issue is indeed an interesting and telling angle, but does not capture the full issue.

For, if OOL is a metaphysical speculation project, it is a scientifically linked philosophical issue. That is, it is in the Lakatosian worldview-tinged “core” that ties together the “belt” of theories, models, concepts and data that are the more visible components of the evolutionary materialist “research programme.”

That means that the whole research programme, embracing inter alia, OOL and macro-evolution, properly, should be looked at in light of the broader phil methodology [which includes addressing scientific methods as a significant subset], i.e comparative difficulties across factual adequacy, coherence and explanatory power.

Thus, all live options should be on the table, including that we know from our experience a credible source of functionally specified, complex information such as we now find in the core of life: namely, intelligent agency.

So, obviously, the evolutionary materialism research programme has a major empirical adequacy problem, and that on a key point — where does the life-ball start rolling, how?

As you know, I have long since seriously argued in this blog and elsewhere that it also has a serious challenge with logical coherence, once it has to address the origin and credibility of mind.

Thirdly, as we see the rise of more and more empirical and logical challenges, the whole structure is taking on the looks of an ad hoc patchwork.

So, it is not at all surprising to see that there are moves to defend the system by imposing question begging definitions of science [cf my challenge to Mr Jack Krebs in the speciation thread] and/or smuggling in materialism through the back door [cf Denyse's current remark on imposing materialism in neuroscience over at DOL]. (Note also how studiously this issue was dodged by JK.)

Looks more and more like the Emperor is “nekkid” . . .

GEM of TKI


105

Dov Henis

04/01/2008

2:21 pm

(Darwinian) Evolution starts with the first organisms, which were the first individual organisms not yet genomed nor celled. Here is a comment I posted earlier today in this forum on another thread:

Chirality In Life, The Earliest Surviving Darwinian Evolution Product

http://www.physforum.com/index.....ntry327715

A. From “…key to life before its origin on Earth?”
http://www.physorg.com/news123440279.html#tab

When scientists synthesize these molecules in the laboratory, half of a sample turns out to be “left-handed” and the other half “right-handed.” But the amino acids that are the building blocks of terrestrial proteins are all “left-handed,” while the sugars of DNA and RNA are “right-handed.” The mystery as to why this is the case, “parallels in many of its queries those that surround the origin of life…”

Thanks to the pristine nature of this meteorite, we were able to demonstrate that other extraterrestrial amino acids carry the left-handed excesses in meteorites and, above all, that these excesses appear to signify that their precursor molecules, the aldehydes, also carried such excesses,” Pizzarello said. “In other words, a molecular trait that defines life seems to have broader distribution as well as a long cosmic lineage.”

B. From “Allosteric, chiral-selective drug binding to DNA”
http://www.pnas.org/cgi/reprint/97/22/12032.pdf

(Allosteric: of, relating to, undergoing, or being a change in the shape and activity of a protein, as an enzyme, that results from combination with another substance at a point other than the chemically active site)

DNA is polymorphic and exists in a variety of distinct conformations. Duplex DNA can adopt a variety of sequence-dependent secondary structures that range from the canonical right-handed B form through the left-handed Z conformation. Multistranded triplex and tetraplex structures are now known to exist. All of these unique conformations may play important functional roles in gene expression.

C. Chirality in life still awaits elucidation

First, reasearch findings should be stated scientifically correctly. In A above NOT “a molecular trait that defines life seems to have broader distribution as well as a long cosmic lineage”, but YES “a molecular conformation dominant in Earth life may have broader distribution and additional cosmic presence.”

Next, re in A above “the mystery as to why this is the case”:

My conjecture about the probable reasons for the prevailing chirality:

Darwinian evolution started at life’s day one, with the genesis of the first organisms, the replicating oligomers, pre-archaea genes. It started under yet-unknown energetic conditions, by a serendipitous occurrence, with oligomeric (RNA?) conformations, in a soup containing all their essential molecular progenitors. These conformations happened to absorb the amounts of energy enabling their polymerization, to lengths precipitated as determined by the nature and conditions of the soup.

The sugars and the nitrogen-based compounds that, together with the phosphates, are the components of the genes-organisms, are chiral. There probably is an energetic advantage in homochirality and chiral homogeneity for the self-replication of biopolymers.

This serendipitous occurrence set up a matrix-field of energy with a potential extended between its source, the sun radiation and the precipitating organisms. This was the genesis of the ongoing formation and maintenance of Earth’s biosphere.

And since the biosphere had thus started it could only evolve in the directions of more favorable energy balances-life-packages and towards stabler conformations. Survival was the direction. After all, this was already the course of Earth life evolution.

But this is a conjecture. Chirality in life still awaits elucidation…

Dov Henis

http://blog.360.yahoo.com/blog.....8211;?cq=1