Burdens of Proof

_{Barry Arrington

July 15, 2016

Intelligent Design}

Share: Facebook; Twitter; LinkedIn; Flipboard; Print; Email

I welcome Matspirit to these pages, because he gives us a never ending supply of materialist error to discuss. In his latest he addresses the origin of life debate. He says that all materialists have to do is make wildly implausible evidence-free assertions about OOL, and unless ID proponents can affirmatively disprove those wildly implausible evidence-free assertions, the materialists win the debate. Gpuccio shoots this lunacy down: Matspirit:

Prove that the DNA/RNA system we see today is the only one that ever existed. Prove that a simpler system didn’t exist long before and evolve the start of our present system.

Gpuccio

No. The system we see today is a fact, because we can observe it. It is the only system we can observe which can do what it does. If you try to explain its origin by stating that simpler systems existed in the past, it’s your burden to support that hypothesis by reasonable facts and inferences. We have no reason to “prove” that your unsubstantiated assumptions are wrong. They are unsubstantiated, and that’s enough to dismiss them, unless and until you substantiate them. Again, you must prove, or at least reasonably support (nothing is ever proved in empirical sciences) your hypothesis. This is basic epistemology. How can you discuss science, if you betray the basics of scientific thought with each new statement of yours?

Comments

If it appears to be designed, as Dawkins concedes, then it could be designed. The burden of proof is on Dawkins to demonstrate step-by-incremental-step how some mindless natural process completely accounts for the appearance of design. Even if he were able to explain this (I don’t think that he has) in existing biological forms, by invoking natural selection acting on random variation, that doesn’t help him, or anyone else, in explaining the origin of life.john_a_designer_{July 18, 2016
July
07
Jul
18
18
2016
10:31 AM
10
10
31
AM
PDT}

I'm a bit late to this discussion but here's my 2 cents: Dr. Behe addresses the burden of proof regarding design and where it lies in his Afterward of the 10th anniversary edition of Darwin's Black Box. Behe quotes Richard Dawkins' understanding of what biology is:
"Biology is the study of complicated things that give the appearance of having been designed for a purpose."
Behe:
"Let me repeat, he says that's the very definition of biology - the study of things that appear designed...Dawkins doesn't just grudgingly acknowledge some faint impression of design in life; he insists that the appearance of design, which he ascribes to natural selection, is overpowering: [Dawkins] "yet the living results of natural selection overwhelmingly impress us with the appearance of design as if by a master watchmaker, impress us with the illusion of design and planning." [emphasis mine]
Behe again:
A crucial, often-overlooked point is that the overwhelming appearance of design strongly affects the burden of proof: in the presence of manifest design, the onus of proof is on the one who denies the plain evidence of his eyes. For example, a person who conjectured that the statues of Easter Island or the images on Mount Rushmore were actually the result of unintelligent forces would bear the substantial burden of proof the claim demanded.
Wild speculation notwithstanding, the flagellum has never been shown not to be irreducibly complex nor has any other system Behe mentions in his book.RexTugwell_{July 18, 2016
July
07
Jul
18
18
2016
09:41 AM
9
09
41
AM
PDT}

seversky: You actually wrote “outboard propeller” which can reasonably be interpreted as an allusion to an outboard motor, given that the analogy has cropped up in previous discussions about the flagellum. Good try at deflection. Why would Barry's analog require an 'outboard' motor? You know good and well there is no outboard motor analog with flagella. They are outboard propellers as opposed the the inboard impellers on jet skiis.groovamos_{July 17, 2016
July
07
Jul
17
17
2016
09:47 PM
9
09
47
PM
PDT}

sagebrush gardener @ #54, I got my idea for this puzzle from what Richard Dawkins wrote in his book, The Blind Watchmaker, where he informs us:
Modern genetic engineers already have the technology to write the New Testament or anything else into a bacterium's DNA. The 'meaning' of the symbols in any information technology is arbitrary, and there is no reason why we should not assign combinations, say triplets, from DNA's 4-letter alphabet, to letters of our own 26-letter alphabet (there would be room for all the upper and lower-case letters with 12 punctuation characters). Unfortunately, it would take about five man-centuries to write the New Testament into a bacterium, so I doubt if anybody will bother. If they did, the rate of reproduction of bacteria is such that 10 million copies of the New Testament could be run off in a single day, a missionary's dream if only people could read the DNA alphabet but, alas, the characters are so small that all 10 million copies of the New Testament could simultaneously dance upon the surface of a pin's head. (p. 116, Norton 1987)
I have highlighted what I think is the key point above: “The 'meaning' of the symbols in any information technology is arbitrary…” In other words in the sequence I created up above @#9 I assigned the letters this way: CAA=(I) GTA=(N) GGG=(space) AGT=(T) TGA=(H) TAA=(E)… However, I could have done it this way: ATA=(I) TAA=(N) TCA=(space) CAA=(T) GTA=(H) GGG=(E)… Or, a large, indeed, very large number of other ways. Since there 64 codon triplets to choose from there are 64 possible combinations that can be selected to represent any letter, space or punctuation character. Again, it is totally arbitrary. With the genetic code it appears to be just as arbitrary. There is no known physical law (as far as we know) that would have dictated the sequence of the first strands of DNA or RNA. Therefore we are left with the question scientific question: How does (or did) chemistry create code? And a philosophical question: Is it even possible for chemistry (or some mindless natural process) to create a code? The burden of proof falls on those making such a claim. Can an intelligence create a code using DNA codons? I just did (see #9, 46, 49 & 50 above). But I am open minded. If you believe that some mindless natural process is the origin of the code we find in DNA, just tell me how. Or, do I need to accept it by faith? (For anyone else interested in this discussion, start @ #9 above, then 16, 22, 43, 46, 49, 50, 52-54.)john_a_designer_{July 17, 2016
July
07
Jul
17
17
2016
09:23 AM
9
09
23
AM
PDT}

I am about 20% of the way through Doug Axe's book. If the rest of the book is pointless (which I doubt), this part alone is a keeper. So far it is a philosophy of science or knowledge discussion using his personal experiences to illustrate many of the points. He discusses how materialism corrupts both science and knowledge. It is a completely unnecessary concept for science. He uses personal examples of how one is limited in what one can express due to current trends in thinking and how science is often not a search for the truth. He wants to create a layman's version of the science to help them decide who is right. He is not unaware of how difficult this will be because of the entrenched flow in the other direction. A flow that is not based on anything found in science. I was discussing the book with my wife this morning and I was telling her that his work revolves around the rareness of proteins. Her immediately reply was that there were tens of thousands of proteins so how could they be rare. The answer is that there is about a 100,000 proteins or about 10ˆ5 while the potential proteins based on amino acid sequences is 10ˆ70 which means that randomly one of these sequence is only 1 in 10ˆ65. So yes, they are rare. Now the question is whether functional proteins actually make up a much larger population than the 100,000 we know about. As far as ID, here is how he contrasts creationism with ID
The truth is that ID and creationism have always differed fundamentally in their methods and starting assumptions. Creationism starts with a commitment to a particular understanding of the biblical text of Genesis and aims to reconcile scientific data with that understanding. ID, on the other hand, starts with a commitment to the essential principles of science and shows how those principles ultimately compel us to attribute life to a purposeful inventor— an intelligent designer. ID authors settle for this vague description not because they want to smuggle God into science but because the jump from “intelligent designer” to “God” requires something beyond the essential principles of science.
Hopefully, will have more time today to read further. Axe is an excellent writer or has an extremely good editor.jerry_{July 17, 2016
July
07
Jul
17
17
2016
07:49 AM
7
07
49
AM
PDT}

hi seversky and upright. we know that the flagellum is the result of design' even if its made from organic parts or its drive by a different way then a human motor. think about a ufo with an advance tech. anyone that will see a flying ufo will conclude that this ufo was designed because of its complexity (even if its have a different tech then us). you can also think about a self replicating robot or watch with dna. even in this case anyone will agree that those kind of watches and robots are designed.mk_{July 17, 2016
July
07
Jul
17
17
2016
05:29 AM
5
05
29
AM
PDT}

The point is, as it has always been, whether the similarities are sufficient to warrant the inference that, because outboard motor propeller assemblies are designed, so must the bacterial flagellum. This question has yet to be resolved so the point is moot.
Hello Seversky, Many people have likened the flagellum to an outboard motor, particularly in function. Others, apparently including yourself, see the uncanny resemblance to human-designed electrical motors, stators, etc. Frankly, I can easily imagine a prop designer looking at the flagellum and seeing the spiraling flow that trails the blades a prop. He or she might very well take issue with your statement that it bears no resemblance at all to a propeller -- after all, what do you think the surfaces are doing? In any case, it seems somewhat idle to fixate over what the flagellum reminds individuals of. After all, its a biological object and its construction is observable to us. The flagellum is constructed by the reading of a representational medium. The medium contains permutations of spatially-oriented objects organized in a reading-frame code. The medium is established by preserving the physical discontinuity between the arrangement of the objects and their referents within the system. This independence is what enables the capacity to specify the end products of the system (which cannot be derived from the physical properties of the medium). The only other place this physical system can be found is in recorded language and mathematics (two unambiguous correlates of intelligence). The inference to design comes directly from universal experience, prediction, and experiment. It's wrapped up in the observed realities of the system, and the observations aren't even controversial.Upright BiPed_{July 16, 2016
July
07
Jul
16
16
2016
09:23 PM
9
09
23
PM
PDT}

further to rvb8:
Evolution of the Genus Homo – Annual Review of Earth and Planetary Sciences – Ian Tattersall, Jeffrey H. Schwartz, May 2009 Excerpt: “Unusual though Homo sapiens may be morphologically, it is undoubtedly our remarkable cognitive qualities that most strikingly demarcate us from all other extant species. They are certainly what give us our strong subjective sense of being qualitatively different. And they are all ultimately traceable to our symbolic capacity. Human beings alone, it seems, mentally dissect the world into a multitude of discrete symbols, and combine and recombine those symbols in their minds to produce hypotheses of alternative possibilities. When exactly Homo sapiens acquired this unusual ability is the subject of debate.” http://www.annualreviews.org/doi/abs/10.1146/annurev.earth.031208.100202 “A number of hominid crania are known from sites in eastern and southern Africa in the 400- to 200-thousand-year range, but none of them looks like a close antecedent of the anatomically distinctive Homo sapiens…Even allowing for the poor record we have of our close extinct kin, Homo sapiens appears as distinctive and unprecedented…there is certainly no evidence to support the notion that we gradually became who we inherently are over an extended period, in either the physical or the intellectual sense.” Dr. Ian Tattersall: – paleoanthropologist – emeritus curator of the American Museum of Natural History – (Masters of the Planet, 2012) Leading Evolutionary Scientists Admit We Have No Evolutionary Explanation of Human Language - December 19, 2014 Excerpt: Understanding the evolution of language requires evidence regarding origins and processes that led to change. In the last 40 years, there has been an explosion of research on this problem as well as a sense that considerable progress has been made. We argue instead that the richness of ideas is accompanied by a poverty of evidence, with essentially no explanation of how and why our linguistic computations and representations evolved.,,, (Marc Hauser, Charles Yang, Robert Berwick, Ian Tattersall, Michael J. Ryan, Jeffrey Watumull, Noam Chomsky and Richard C. Lewontin, "The mystery of language evolution," Frontiers in Psychology, Vol 5:401 (May 7, 2014).) Casey Luskin added: “It's difficult to imagine much stronger words from a more prestigious collection of experts.” http://www.evolutionnews.org/2014/12/leading_evoluti092141.html The Fundamental Difference Between Humans and Nonhuman Animals - Michael Egnor - November 5, 2015 Excerpt: Human beings have mental powers that include the material mental powers of animals but in addition entail a profoundly different kind of thinking. Human beings think abstractly, and nonhuman animals do not. Human beings have the power to contemplate universals, which are concepts that have no material instantiation. Human beings think about mathematics, literature, art, language, justice, mercy, and an endless library of abstract concepts. Human beings are rational animals. Human rationality is not merely a highly evolved kind of animal perception. Human rationality is qualitatively different -- ontologically different -- from animal perception. Human rationality is different because it is immaterial. Contemplation of universals cannot have material instantiation, because universals themselves are not material and cannot be instantiated in matter.,,, It is a radical difference -- an immeasurable qualitative difference, not a quantitative difference. We are more different from apes than apes are from viruses.,,, http://www.evolutionnews.org/2015/11/the_fundamental_2100661.html Do Animals Have Language? - Michael Egnor - July 12, 2016 Excerpt: Shallit mischaracterizes de Waal's work. De Waal is a pioneer in the study of animal emotion and moral behavior. De Waal's views on the link between thought and language are nuanced and are not views I share, but his view on animal language is worth noting. De Waal: "You won't often hear me say something like this, but I consider humans the only linguistic species. We honestly have no evidence for symbolic communication, equally rich and multifunctional as ours, outside our species." Perhaps, in addition to recommending de Waal's books, Shallit should read them. http://www.evolutionnews.org/2016/07/do_animals_have102990.html Mental time travel: An exclusively human capacity? December 22, 2015 Excerpt: There is, however, no evidence that they (animals) are able to construct, reflect and compare different future scenarios like humans are. We therefore don't believe that animals are capable of mental time travel," says Prof Sen Cheng. http://www.sciencedaily.com/releases/2015/12/151222082343.htm
Moreover, the ability to create and understand information, that is unique to humans, provides very strong evidence that humans were indeed created in the image of God. This is because both reality itself and life are both 'information theoretic' in the foundational basis:
"it from bit” Every “it”— every particle, every field of force, even the space-time continuum itself derives its function, its meaning, its very existence entirely—even if in some contexts indirectly—from the apparatus-elicited answers to yes-or-no questions, binary choices, bits. “It from bit” symbolizes the idea that every item of the physical world has a bottom—a very deep bottom, in most instances, an immaterial source and explanation, that which we call reality arises in the last analysis from the posing of yes-no questions and the registering of equipment—evoked responses, in short all matter and all things physical are information-theoretic in origin and this is a participatory universe." – Princeton University physicist John Wheeler (1911–2008) (Wheeler, John A. (1990), “Information, physics, quantum: The search for links”, in W. Zurek, Complexity, Entropy, and the Physics of Information (Redwood City, California: Addison-Wesley)) 48:24 mark: “It is operationally impossible to separate Reality and Information” 49:45 mark: “In the Beginning was the Word” John 1:1 Prof Anton Zeilinger speaks on quantum physics. at UCT - video http://www.youtube.com/watch?v=s3ZPWW5NOrw "The most fundamental definition of reality is not matter or energy, but information–and it is the processing of information that lies at the root of all physical, biological, economic, and social phenomena." Vlatko Vedral - Professor of Physics at the University of Oxford, and CQT (Centre for Quantum Technologies) at the National University of Singapore, and a Fellow of Wolfson College - a recognized leader in the field of quantum mechanics. Complex grammar of the genomic language – November 9, 2015 Excerpt: The ‘grammar’ of the human genetic code is more complex than that of even the most intricately constructed spoken languages in the world. The findings explain why the human genome is so difficult to decipher –,,, ,,, in their recent study in Nature, the Taipale team examines the binding preferences of pairs of transcription factors, and systematically maps the compound DNA words they bind to. Their analysis reveals that the grammar of the genetic code is much more complex than that of even the most complex human languages. Instead of simply joining two words together by deleting a space, the individual words that are joined together in compound DNA words are altered, leading to a large number of completely new words. http://www.sciencedaily.com/releases/2015/11/151109140252.htm
It is hard to imagine a more convincing proof that we are made 'in the image of God', than finding that both the universe and life itself are 'information theoretic' in their foundational basis, and that we, of all the creatures on earth, uniquely possess an ability to understand and create information. I guess a more convincing evidence could be if God Himself became a man, defeated death on a cross, and then rose from the dead to prove that He was God. But who has ever heard of such overwhelming evidence as that?
Shroud of Turin: From discovery of Photographic Negative, to 3D Information, to Quantum Hologram - video https://www.facebook.com/philip.cunningham.73/videos/1119619634717635/?pnref=story
Verses and Music:
Genesis 1:26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth. John 1:1-4 In the beginning was the Word, and the Word was with God, and the Word was God. The same was in the beginning with God. All things were made by Him, and without Him was not anything made that was made. In Him was life, and that life was the Light of men. Casting Crowns - The Word Is Alive https://www.youtube.com/watch?v=X9itgOBAxSc
bornagain77_{July 16, 2016
July
07
Jul
16
16
2016
08:01 PM
8
08
01
PM
PDT}

Barry Arrington @ 19
Seversky @ 11.
The bacterial flagellum is nothing like [a motor].
I said it was like a propeller, not a motor. Sev, if I felt compelled to set up straw men every time I addressed my opponent’s argument, it would probably give me pause. That’s just me — ya know, committed to logic and evidence and all.
You actually wrote "outboard propeller" which can reasonably be interpreted as an allusion to an outboard motor, given that the analogy has cropped up in previous discussions about the flagellum.
1. The question is whether intelligent agents have been demonstrated to be capable of assembling machinery like propeller assemblies, which are analogous in some respects to the flagellum assembly, which even Sev admits.
Agreed. Human beings, in some cases at least, can be considered as intelligent agents and human beings have designed propeller assemblies such as those seen on outboard motors.
Sev, if I had to try to use Jedi mind tricks in idiotic attempts to dismiss my opponents’ arguments, because I could not defeat them with logic or evidence, I think I would change my position. Just sayin’
The point is, as it has always been, whether the similarities are sufficient to warrant the inference that, because outboard motor propeller assemblies are designed, so must the bacterial flagellum. This question has yet to be resolved so the point is moot.Seversky_{July 16, 2016
July
07
Jul
16
16
2016
07:27 PM
7
07
27
PM
PDT}

If Modern Humans Are So Smart, Why Are Our Brains Shrinking? - January 20, 2011 Excerpt: John Hawks is in the middle of explaining his research on human evolution when he drops a bombshell. Running down a list of changes that have occurred in our skeleton and skull since the Stone Age, the University of Wisconsin anthropologist nonchalantly adds, “And it’s also clear the brain has been shrinking.” “Shrinking?” I ask. “I thought it was getting larger.” The whole ascent-of-man thing.,,, He rattles off some dismaying numbers: Over the past 20,000 years, the average volume of the human male brain has decreased from 1,500 cubic centimeters to 1,350 cc, losing a chunk the size of a tennis ball. The female brain has shrunk by about the same proportion. “I’d call that major downsizing in an evolutionary eyeblink,” he says. “This happened in China, Europe, Africa—everywhere we look.” http://discovermagazine.com/2010/sep/25-modern-humans-smart-why-brain-shrinking Study suggests humans are slowly but surely losing intellectual and emotional abilities - November 12, 2012 Excerpt: "Human intelligence and behavior require optimal functioning of a large number of genes, which requires enormous evolutionary pressures to maintain. A provocative hypothesis published in a recent set of Science and Society pieces published in the Cell Press journal Trends in Genetics suggests that we are losing our intellectual and emotional capabilities because the intricate web of genes endowing us with our brain power is particularly susceptible to mutations and that these mutations are not being selected against in our modern society." http://medicalxpress.com/news/2012-11-humans-slowly-surely-intellectual-emotional.html#jCp Is Human Intellect Degenerating? - February 19, 2013 Excerpt: A recent study of the Online Mendelian Inheritance in Man (OMIM) database, although incomplete, indicates that about half of all human genetic diseases have a neurologic component, [6], frequently including some aspect of [intellectual deficiency], consistent with the notion that many genes are required for intellectual and emotional function. The reported mutations have been severe alleles, often de novo mutations that reduce fecundity. However, each of these genes will also be subject to dozens if not hundreds of weaker mutations that lead to reduced function, but would not significantly impair fecundity, and hence could accumulate with time... https://uncommondescent.com/intelligent-design/is-human-intellect-degenerating/ Human Genetic Variation Recent, Varies Among Populations - (Nov. 28, 2012) Excerpt: Nearly three-quarters of mutations in genes that code for proteins -- the workhorses of the cell -- occurred within the past 5,000 to 10,000 years,,, "One of the most interesting points is that Europeans have more new deleterious (potentially disease-causing) mutations than Africans,",,, "Having so many of these new variants can be partially explained by the population explosion in the European population. However, variation that occur in genes that are involved in Mendelian traits and in those that affect genes essential to the proper functioning of the cell tend to be much older." (A Mendelian trait is controlled by a single gene. Mutations in that gene can have devastating effects.) The amount variation or mutation identified in protein-coding genes (the exome) in this study is very different from what would have been seen 5,000 years ago,,, The report shows that "recent" events have a potent effect on the human genome. Eighty-six percent of the genetic variation or mutations that are expected to be harmful arose in European-Americans in the last five thousand years, said the researchers. The researchers used established bioinformatics techniques to calculate the age of more than a million changes in single base pairs (the A-T, C-G of the genetic code) that are part of the exome or protein-coding portion of the genomes (human genetic blueprint) of 6,515 people of both European-American and African-American decent.,,, http://www.sciencedaily.com/releases/2012/11/121128132259.htm
bornagain77_{July 16, 2016
July
07
Jul
16
16
2016
07:04 PM
7
07
04
PM
PDT}

Andre, 'Hahahahahaha', is not really a reply. Would you agree intelligent parents have intelligent children? I fully agree that 'environment' (another Darwinian factor), plays a significant role in developing intelligence, but so does genetics. Why is it so difficult for you to grasp that curiosity, along with brown eyes can be a genetic trait. Your ID friends spend screeds of paper explaining the enormous numbers involved in genetic combination, and recombination. Scientists today fully understand that they have barely scrathched the epidermis of a layer, beneath which lay caverns of unknowns. Yet you, with that curious inability to be curious laugh off the possibility that curiosity may be inherited? This seems to be an ID genetic trait; an inability to be curious. Perhaps it's inherited?rvb8_{July 16, 2016
July
07
Jul
16
16
2016
06:06 PM
6
06
06
PM
PDT}

Hi john_a_designer, I had an interest in codes when I was a kid, and spent a lot of time figuring them out with pencil and paper. But I have not done it for a long time, and no longer have all day to play, so your post inspired me to look up some online deciphering tools. I found http://quipqiup.com/ to be especially helpful. It wasn't as easy as copy-paste-and-click, but it did save a lot of time. Thanks for the entertaining puzzle!sagebrush gardener_{July 16, 2016
July
07
Jul
16
16
2016
12:53 PM
12
12
53
PM
PDT}

Hi sagebrush gardener, That is @ #50 (drum roll please) the correct answer. For our listening audience, can you tell us a little bit more how you figured that out?john_a_designer_{July 16, 2016
July
07
Jul
16
16
2016
12:25 PM
12
12
25
PM
PDT}

By the way, john_a_designer, your little puzzle is a wonderful counter-example to the idea that seems to be endemic among atheists (as nicely illustrated by rvb8 @22) that belief in design is somehow the end of inquiry. In my experience, the situation is quite the opposite. When I first saw your seemingly random string of letters @9, I passed it over, thinking there was not much worth exploring there. But when I realized (thanks to GBDixon @46 and your additional clue @49) that there was an intelligent design behind the seeming randomness, my curiosity was piqued. I spent some time digging deeper, and found it quite satisfying to have discovered the meaning. As another example, I am 100% certain that this computer in front of me was designed by an intelligence greater than mine. Does that inhibit my desire to learn more? Of course not! On the contrary, it makes me want to learn more, knowing that whoever made it has a much greater understanding than my own.sagebrush gardener_{July 16, 2016
July
07
Jul
16
16
2016
12:17 PM
12
12
17
PM
PDT}

Gpuccio @ 48:
If yur post at #42 is an answer to me, you have a very strange idea of what an answer is. First of all, why do you “answer” my #30 (in the other thread, while you have completely ignored my #16, which is much more detailed and requested any specific answers from you
Read the OP. Our moderator quoted from #30 when he hijacked the thread for the third time. The Designer (WMNBG) only knows why. I had a response to #16 about half finished when I found out from another site that the thread had been hijacked again. No message left on the old thread to tell readers it had been hijacked, of course. I'll finish the message if I ever find the old thread again, but I may answer it here too because I'm getting tired of all this thread jacking around. If you're going to stick to "evolution is impossible" then we probably haven't got much to talk about, but if you ever have any questions ask Barry where the thread is and and ask there.MatSpirit_{July 16, 2016
July
07
Jul
16
16
2016
11:57 AM
11
11
57
AM
PDT}

john_a_designer @49 In the beginning was the code. https://www.youtube.com/watch?v=T1Ogwa76yQosagebrush gardener_{July 16, 2016
July
07
Jul
16
16
2016
11:34 AM
11
11
34
AM
PDT}

GBDixon @ 46 That’s an interesting possibility… However, you are wrong. GGG does not equal E. Try TAA. Any other code breakers out there?john_a_designer_{July 16, 2016
July
07
Jul
16
16
2016
09:47 AM
9
09
47
AM
PDT}

MatSpirit: If yur post at #42 is an answer to me, you have a very strange idea of what an answer is. First of all, why do you "answer" my #30 (in the other thread, while you have completely ignored my #16, which is much more detailed and requested any specific answers from you? Regarding the rest, my only claim is that complex functional information originates in the mind of a designer, and nowhere else. We observe complex functional information arising from the mind of designers all the time. Would you say that stating that Windows 10 was designed is the same as recurring to some Intelligent Poofer? Would you say that trying to decode some ancient language is Intelligent Poofery? You don't know what you are talking about. If we accept that functional information was inputted into biological objects ny some designer, we have a lot to look for and analyze. We have to find what information was inputted, when, the general form and purpose of that information, the way it was implemented, and so on. All those are perfectly scientific aims. As we try to reconstruct some ancient civilization from its artifacts, so we can try to decode the natural history of biological design from the artifacts that are left to us, in fossils and, especially, in living biological beings. That is a fascinating scientific task, much better and much more satisfying than just trying to imagine how something which never evolved could have evolved.gpuccio_{July 16, 2016
July
07
Jul
16
16
2016
09:29 AM
9
09
29
AM
PDT}

Dionisio @35
Would post @32 help to reinforce your arguments?
I had assumed, perhaps incorrectly, that this information was common knowledge here, and did not need reinforcement. But yes, your links @32 would be helpful for anyone who is curious about how the flagellar motor works. Thanks.sagebrush gardener_{July 16, 2016
July
07
Jul
16
16
2016
09:18 AM
9
09
18
AM
PDT}

Mr. Designer seems to be toying with us. I think his DNA strand is in a code contrived by him, where each three consecutive letters decode to a letter of the English alphabet. I think GGG=E, the first word is likely THE and the second word appears to be four letters long and is repeated in the second section. I tried to figure it out but have run out of time. There are, of course, a myriad of ways information can be encoded into DNA. For all we know, a great deal of information about the designer is encoded in cell DNA, just waiting for someone smart enough to decode it.GBDixon_{July 16, 2016
July
07
Jul
16
16
2016
08:53 AM
8
08
53
AM
PDT}

OT: Memory in cells outside of DNA
Protein pairs make cells remember – 15 July 2016 Excerpt: Like our brains, individual cells also have a kind of memory, which enables them to store information. To make this possible, the cells require positive feedback from their proteins. The research group led by Prof. Attila Becskei at the Biozentrum of the University of Basel has now discovered that the proteins need to form pairs in these feedback loops to store information.,,, The cell not only requires the appropriate feedback from protein pairs in order to remember information but also for cell division and cell differentiation - the development of specialized cells. http://www.eurekalert.org/pub_releases/2016-07/uob-ppm071516.php
bornagain77_{July 16, 2016
July
07
Jul
16
16
2016
08:52 AM
8
08
52
AM
PDT}

John I can answer it from a materialist pov... It evolvedAndre_{July 16, 2016
July
07
Jul
16
16
2016
08:46 AM
8
08
46
AM
PDT}

Seversky & rvb8, Thanks for taking my word that the strand that I provided above @9 is really a coded sequence. But how do you know that it is not just a random sequence? Obviously if it was a random sequence no one could or would claim the sequence was coded. Here again is the sequence: CAAGTAGGGAGTTGATAAGGGATATAATCACAAGTAGTACAAGTATCAGGG…TCTAAAACTGGGAGTTGATAAGGGACAGCAAGATAA (A=adenine, G=guanine, T=thymine & C=cytosine) …rvb8 wrote @ 22,
john- ‘How did the code get there?’ I don’t know. No one knows…
How can you say that “no one knows?” I know. Do you know how I know?
But what I do know is that the theories being proposed are infinately more substantial, plausible, and intellectually fulfilling, and satisfying than saying, ‘the Designer did it.’
I am not making the argument ‘the Designer did it.’ However, I am willing to argue that “an intelligence” is a possible source of coded semiotic information. I could also ask how mindless chemistry and mindless natural law can create a semiotic code. Can you answer that question?john_a_designer_{July 16, 2016
July
07
Jul
16
16
2016
07:17 AM
7
07
17
AM
PDT}

This answer, which is in the "Burden of Proof" thread, is to Gpuccio's Msg 30 in the "That's Gotta Hurt" thread. That thread was torn off the "On Gritting Teeth" thread which in turn came from the "Gobsmackingly Stupid" thread which was started by Barry Arrington, apparently to prove he can't parse a logical statement. The "its" gpuccio is talking about is the modern DNA/RNA system in operation in today's cells. He is apparently a biosemiosis supporter and biosemiosis believes this system did not evolve. In fact, if it did, biosemiosis is basically dead. gpuccio:
If you try to explain its origin by stating that simpler systems existed in the past, it’s your burden to support that hypothesis by reasonable facts and inferences. We have no reason to “prove” that your unsubstantiated assumptions are wrong. They are unsubstantiated, and that’s enough to dismiss them, unless and until you substantiate them.
You claim that the DNA/RNA system did not evolve, yet the complexity of that system is many many orders of magnitude too complex to have occurred by chance. [See Dembski.] So if it's too complex to have occurred by chance and you insist it didn't evolve, it's up to you to tell us how it did come to exist. Saying it was poofed into existence by the Intelligent Poofer (who might not necessarily be God) is a pure God of the Gaps argument. It's a good tactical position to take because the reality-based world (often called materialists) has no fossils from that ancient date and little hope of finding any, and you can pooh pooh any hypothetical answers they may present. But meanwhile the biosemiosis hypothesis is built on a physically impossible foundation so your side is understandably not investigating those foundations. (Intelligent Poofery is not a mechanistic theory, and it’s not IP’s task to match your pathetic level of detail in telling mechanistic stories.) So you're basically standing on air with no hope of that situation improving. The reality based community, on the other hand, has no rEason to fear ino estimating the OoL and it ìs.. You'll be able to dismiss whatever they find, of course, even if they make actual self reproducing molecules. (Test tube science! We demand you show us what really happened, like we don't!) They'll never be able to show you the step by step evolution of the modern system from simple self reproducing molecules, which is what IP demands and, of course, you don't have to meet that pathetic level of proof because ... you can't?MatSpirit_{July 16, 2016
July
07
Jul
16
16
2016
06:57 AM
6
06
57
AM
PDT}

RVB8 You actually believe your story? Hahahahahaha!!!! Curiosity can not evolve from non curiosity..... Darwinian evolution can only work with matter... Curiosity does not consist of matter... Try again and this time try harder.Andre_{July 16, 2016
July
07
Jul
16
16
2016
06:38 AM
6
06
38
AM
PDT}

gpuccio Sorry I misspelled your name @34. Definitely I should be more careful next time.Dionisio_{July 16, 2016
July
07
Jul
16
16
2016
05:24 AM
5
05
24
AM
PDT}

... if your short on time and patience to grasp Plantinga’s nuanced argument, see if you can digest this thought from evolutionary cognitive psychologist Steve Pinker, who baldly states: “Our brains are shaped for fitness, not for truth; sometimes the truth is adaptive, sometimes it is not.”
I would like to add that, given evolutionary materialism, there is no such thing as a person "who" has a brain. So it makes little sense to say that "our brains" are shaped for fitness. There is no person, which implies that, when rvb8 speaks about being "intellectually fulfilled" by some theory, all that is going on is blind chemical interactions in a clump of matter. And, to make matters even worse, the chemical state of this clump of matter, which rvb8 terms "being intellectually fulfilled", is completely unrelated to the theory rvb8 imagines "he" is fulfilled by. The chemical state is not about some theory. Even atheistic philosophers acknowledge that:
Physics and neuroscience both tell us, for different reasons, that one clump of matter can’t be about another clump of matter. Computer science combines both to show that human brain states can’t really be about stuff for exactly the same reason that the internal workings of your laptop can’t really be about anything at all. Introspection must be wrong when it credits consciousness with thoughts about birthdays, keys, and bosses’ names. But the mistake introspection makes is so deep and so persuasive, it’s almost impossible to shake, even when you understand it. At first you won’t even be able to conceive how it could be a mistake. But it has to be. The mistake is the notion that when we think, or rather when our brain thinks, it thinks about anything at all. We have to see very clearly that introspection tricks us into the illusion that our thoughts are about anything at all. [Rosenberg, 'The Atheist Guide To Reality']
Origenes_{July 16, 2016
July
07
Jul
16
16
2016
05:21 AM
5
05
21
AM
PDT}

rvb8 at 36, actually contrary to what you believe, if naturalism were true there would be no true perception of reality:
Scientific Peer Review is in Trouble: From Medical Science to Darwinism - Mike Keas - October 10, 2012 Excerpt: Survival is all that matters on evolutionary naturalism. Our evolving brains are more likely to give us useful fictions that promote survival rather than the truth about reality. Thus evolutionary naturalism undermines all rationality (including confidence in science itself). Renown philosopher Alvin Plantinga has argued against naturalism in this way (summary of that argument is linked on the site:). Or, if your short on time and patience to grasp Plantinga's nuanced argument, see if you can digest this thought from evolutionary cognitive psychologist Steve Pinker, who baldly states: "Our brains are shaped for fitness, not for truth; sometimes the truth is adaptive, sometimes it is not." Steven Pinker, evolutionary cognitive psychologist, How the Mind Works (W.W. Norton, 1997), p. 305. http://blogs.christianpost.com/science-and-faith/scientific-peer-review-is-in-trouble-from-medical-science-to-darwinism-12421/ Content and Natural Selection - Alvin Plantinga - 2011 http://www.andrewmbailey.com/ap/Content_Natural_Selection.pdf
Donald Hoffman has, through detailed analysis of population genetics, extended Plantinga's 'evolutionary argument against naturalism' to be a much more devastating 'evolutionary argument against reality' since it shows that not only are some of our observations of reality unreliable but that ALL of our observations of reality are unreliable:
The Evolutionary Argument Against Reality - April 2016 The cognitive scientist Donald Hoffman uses evolutionary game theory to show that our perceptions of an independent reality must be illusions. Excerpt: “The classic argument is that those of our ancestors who saw more accurately had a competitive advantage over those who saw less accurately and thus were more likely to pass on their genes that coded for those more accurate perceptions, so after thousands of generations we can be quite confident that we’re the offspring of those who saw accurately, and so we see accurately. That sounds very plausible. But I think it is utterly false. It misunderstands the fundamental fact about evolution, which is that it’s about fitness functions — mathematical functions that describe how well a given strategy achieves the goals of survival and reproduction. The mathematical physicist Chetan Prakash proved a theorem that I devised that says: According to evolution by natural selection, an organism that sees reality as it is will never be more fit than an organism of equal complexity that sees none of reality but is just tuned to fitness. Never.” https://www.quantamagazine.org/20160421-the-evolutionary-argument-against-reality/ Donald Hoffman: Do we see reality as it is? - Video - 9:59 minute mark Quote: “fitness does depend on reality as it is, yes.,,, Fitness is not the same thing as reality as it is, and it is fitness, and not reality as it is, that figures centrally in the equations of evolution. So, in my lab, we have run hundreds of thousands of evolutionary game simulations with lots of different randomly chosen worlds and organisms that compete for resources in those worlds. Some of the organisms see all of the reality. Others see just part of the reality. And some see none of the reality. Only fitness. Who wins? Well I hate to break it to you but perception of reality goes extinct. In almost every simulation, organisms that see none of reality, but are just tuned to fitness, drive to extinction that perceive reality as it is. So the bottom line is, evolution does not favor veridical, or accurate perceptions. Those (accurate) perceptions of reality go extinct. Now this is a bit stunning. How can it be that not seeing the world accurately gives us a survival advantage?” https://youtu.be/oYp5XuGYqqY?t=601
Although atheists, because of the mathematics of population genetics, are forced to believe that ALL of their observations of reality are unreliable and therefore 'illusory', it is interesting to point out that reliable observation of reality in a necessary cornerstone of the scientific method:
Steps of the Scientific Method Observation/Research Hypothesis Prediction Experimentation Conclusion http://www.sciencemadesimple.com/scientific_method.html
Thus, in what should be needless to say, a worldview that undermines the scientific method itself by holding all our observations of reality are unreliable, even illusory, is NOT a worldview that can be firmly grounded within the scientific method! Moreover, completely contrary to materialistic premises, conscious observation, far from being unreliable and illusory, is experimentally found to be far more integral to reality, i.e. far more reliable of reality, than the math of population genetics predicted. In the following experiment, it was found that reality doesn’t exist without an observer.
New Mind-blowing Experiment Confirms That Reality Doesn’t Exist If You Are Not Looking at It – June 3, 2015 Excerpt: The results of the Australian scientists’ experiment, which were published in the journal Nature Physics, show that this choice is determined by the way the object is measured, which is in accordance with what quantum theory predicts. “It proves that measurement is everything. At the quantum level, reality does not exist if you are not looking at it,” said lead researcher Dr. Andrew Truscott in a press release.,,, “The atoms did not travel from A to B. It was only when they were measured at the end of the journey that their wave-like or particle-like behavior was brought into existence,” he said. Thus, this experiment adds to the validity of the quantum theory and provides new evidence to the idea that reality doesn’t exist without an observer. http://themindunleashed.org/2015/06/new-mind-blowing-experiment-confirms-that-reality-doesnt-exist-if-you-are-not-looking-at-it.html
Apparently science itself could care less if atheists are forced to believe, because of the math of population genetics, that their observations of reality are illusory!bornagain77_{July 16, 2016
July
07
Jul
16
16
2016
04:19 AM
4
04
19
AM
PDT}

In order to state the obvious fact that a 2016 Ford car is fully designed, do we have to know or mention that there was a fully designed 1908 Model T?Dionisio_{July 16, 2016
July
07
Jul
16
16
2016
03:53 AM
3
03
53
AM
PDT}

That's easy Andre. Our earliest ancestors had a survival advantage if they went to check what made the bush rustle. Those ancestors who made sure there was no danger passed on their curious nature, those who had faith that the bushes russeled for unknown reasons, were eaten by the stalking leopard:)rvb8_{July 16, 2016
July
07
Jul
16
16
2016
03:49 AM
3
03
49
AM
PDT}

1 2 3 Next

You must be logged in to post a comment.

Leave a Reply