Home » Genetics, News » ICC 2013: Geneticist Jeff Tomkins vs. Evolutionary Biologist who got laughed off stage

ICC 2013: Geneticist Jeff Tomkins vs. Evolutionary Biologist who got laughed off stage

At the International Conference on Creationism 2013 (ICC 2013), professional geneticist Jeffrey Tomkins (along with Jerry Bergman) delivered a devastating critique of the claim that humans are 98% genetically similar to chimps. What he demonstrated was the fact that Darwinists are essentially saying “what is similar is 98% similar”, which is cherry picking. Tomkins acknowledges we are closer to chimps than daffodils, but humans are still substantially different from chimps.

I posted a less technical complaint here: With no dictionary tricks, humans only 70% similar to chimps.

Recall the “dictionary trick” whereby Tom Wolfe’s famous novel The Right Stuff can be shown to be almost 100% identical to a dictionary merely by aligning the words in Wolfe’s novel against identical words in the dictionary. The illusion of similarity is brought about by a total disregard for sentence structure and context of the words within sentences, paragraphs, and chapters. When those considerations are taken into account, it becomes preposterous to assert The Right Stuff is almost 100% identical to a dictionary. But such illegitimate lines of comparison are the staple of evolutionism.

Tomkins described the origin of the fallacious comparison as a myth that got started in reassociation kinetic methods of comparison in the mid-1970′s prior to the advent of modern sequencing techniques (like Illumina and Solexa). Reassociation kinetics was a technique where fragments of chimp and human DNA were mixed in the same chemical soup, and the DNAs that were reasonably similar would pair up, hence we got a biased sampling!

If we take genes that are found in both humans and chimps and disregard the indels, we get the 98% figure. When indels are considered, the similarity drops to 80-85%!

chimp human indel

When including other sequences, the similarity drops even further, down to 70%. But that 70% figure itself, imho, is too generous. I don’t think Tomkins used ORFans or pseudo genes or many other intergenic sequences, and he explicitly avoided the complication of Synteny. The links below go into detail. One might argue, the indels don’t have function. We don’t know that as a general rule, and even if they didn’t it still is a problem for evolution to account for how the indels got fixed into a population.

Tomkins pointed also to reports where lab workers may have contaminated the sequencing labs for Chimps with their own human DNA and thus biasing the figures! Hence re-sequencing has been done, and there is more sequencing pending to clean up these errors. He joked about the coughing and sneezing that may have gone on to cause contamination.

Further he pointed out that it seemed politically incorrect to dispute the 98% figure promoted by the reassociation kinetics work because it accorded with the false evolutionary narrative. He said, the industry is finally having to “fess up”, that some of their conclusions are “bogus”.

Tomkins has been reviewer on peer reviewed papers on genetics, he ran a genome lab at Clemson, and said if he had been the reviewer of some of the evolutionary papers he would have rejected them for publication because of the lack of clarity in their methodology, particularly in the material and methods sections of the paper.

During the answer and question session, a ranting raving evolutionary biologists gets up and whines and says something to the effect, “you’re using such inflammatory language … ‘sneeze and cough and ‘fess up’ and bogus’”. The evolutionary biologist then said, “as I said, what I have problems with is inflammatory your language, I don’t want to get into the technical details.” When he said that, he got laughed off stage. It was obvious Tomkins made an unassailable case and the evolutionary biologist didn’t want to be engage Tomkins technical assertions. Instead the evolutionary biologist grasped at irrelevant straws like Tomkins use of the words “sneeze” and “cough”. Pathetic!

Along those lines, I’ll give a sample of inflammatory language:

In science’s pecking order, evolutionary biology lurks somewhere near the bottom, far closer to phrenology than to physics

Jerry Coyne

Oh wait, that’s an evolutionist making inflammatory remarks about his own discipline, not a creationist.

I told Jeff, “I accepted the 98% figure for years, I thought it was true, creationists since Linnaeus have said we’re more similar to apes than to trees.” Jeff replied something to the effect, “that’s a good point, I accepted the 98% figure too, and I was prepared to accept it if that’s what my research indicated.” Tomkins spent 3 months reviewing the NCBI sequences himself, and Bergman devoted time to assist going through the literature. This was no small project. Tomkins lists recent peer-reviewed literature that supports his points.

Chimp/human similarity wasn’t directly a question of creation and evolution, it is a basic empirical question of the similarity in evidence today. If evolutionary biologists can’t be forthright and accurate about even basic empirical questions of data in the present day, why should they be trusted with speculations about the deep past?

NOTES:

Jeffrey Tomkins, Ph.D. (Genetics)

Jeffrey Tomkins has a Ph.D. in Genetics from Clemson University, a M.S. in Plant Science from the University of Idaho, Moscow and a B.S. in Agriculture from Washington State University. He was on the Faculty in the Dept of Genetics and Biochemistry, Clemson University, for a decade where he worked as a research technician in a plant breeding/genetics program, focusing on quantitative and physiological genetics in soybean. He is now a Staff Scientist at ICR. He has 56 publications in peer reviewed scientific journals and seven book chapters in scientific books. He is the primary author of The Design and Complexity of the Cell.

http://creation.com/dr-jeffrey-tomkins

Articles
The chromosome 2 fusion model of human evolution—part 1: re-evaluating the evidence
The chromosome 2 fusion model of human evolution—part 2: re-analysis of the genomic data
The junk DNA myth takes a well-deserved hit
Genomic monkey business—estimates of nearly identical human–chimp DNA similarity re-evaluated using omitted data

Is the human genome nearly identical to chimpanzee?—a reassessment of the literature

PS

Jerry Bergman had been an atheist while a professor before he got expelled. Thankfully he got rehired at a medical college where he has been teaching for the last 27 years.

Jerry Bergman, Ph.D., Biology

Biography

Jerry Bergman has taught biology, genetics, chemistry, biochemistry, anthropology, geology, and microbiology at Northwest State College in Archbold OH for over 25 years. He has 9 degrees, including 7 graduate (= ‘post-graduate’ in some non-US systems) degrees. Dr Bergman is a graduate of Medical College of Ohio, Wayne State University in Detroit, The University of Toledo, and Bowling Green State University. He has over 800 publications in 12 languages and 20 books and monographs. He has also taught at the Medical College of Ohio where he was a research associate in the department of experimental pathology, and he also taught 6 years at the University of Toledo, and 7 years at Bowing Green State University.

Among his books is a monograph on peer evaluation published by the College Student Journal Press, a Fastback on the creation-evolution controversy published by Phi Delta Kappa, a book on vestigial organs with Dr George Howe (‘Vestigial Organs’ are Fully Functional), a book on psychology and religious cults, a book on religious discrimination published by Onesimus Press, and a book on mental health published by Claudius Verlag in München. He has also published a college textbook on evaluation (Boston, Houghton Mifflin Co.), and has contributed to dozens of other textbooks. He was also a consultant for over 20 science text books, mostly biology and biochemistry.

Dr Bergman has presented over one hundred scientific papers at professional and community meetings in the United States, Canada, and Europe. To discuss his research, he has been a featured speaker on many college campuses throughout the United States and Europe, and is a frequent guest on radio and television programs. His research has made the front page in newspapers throughout the country, has been featured by the Paul Harvey Show several times, and has been discussed by David Brinkley, Chuck Colson, and other nationally known commentators on national television.

His other work experience includes over ten years experience at various Mental Health/Psychology clinics as a licensed professional clinical counselor and three years full time corrections research for a large county circuit court in Michigan and inside the walls of Jackson Prison (SPSM), the largest walled prison in the world. He has also served as a consultant for CBS News, ABC News, Reader’s Digest, Amnesty International, several government agencies and for two Nobel Prize winners, including the inventor of the transistor. In the past decade he has consulted or has testified as an expert witness or consultant in almost one-hundred court cases. A Fellow of the American Scientific Association, member of The National Association for the Advancement of Science, and many other professional associations, he is listed in Who’s Who in America, Who’s Who in the Midwest and in Who’s Who in Science and Religion.

Education
M.P.H., Northwest Ohio Consortium for Public Health (Medical College of Ohio, Toledo, Ohio; University of Toledo, Toledo, Ohio; Bowling Green State University, Bowling Green, Ohio), 2001.
M.S. in biomedical science, Medical College of Ohio, Toledo, Ohio, 1999.
Ph.D. in human biology, Columbia Pacific University, San Rafael, California, 1992.
M.A. in social psychology, Bowling Green State University, Bowling Green, Ohio, 1986.
Ph.D. in measurement and evaluation, minor in psychology, Wayne State University, Detroit, Michigan, 1976.
M.Ed. in counseling and psychology, Wayne State University, Detroit, Michigan, 1971.
B.S., Wayne State University, Detroit, Michigan, 1970. Major area of study was sociology, biology, and psychology.
A.A. in Biology and Behavioral Science, Oakland Community College, Bloomfield Hills, Michigan, 1967.

http://creation.com/dr-jerry-bergman

  • Delicious
  • Facebook
  • Reddit
  • StumbleUpon
  • Twitter
  • RSS Feed

45 Responses to ICC 2013: Geneticist Jeff Tomkins vs. Evolutionary Biologist who got laughed off stage

  1. Off topic, but creationist Dr. Jay Wile just posted a somewhat negative review of Eban Alexander’s book, Proof of Heaven.

    We really need a forum.

  2. We really need a forum.

    Would you like to help me build a forum, invited participants mostly…

    Sal

  3. The review by Dr. Jay Wile is filled with medical errors. Wile admits his lack on study of NDE’s and it shows. As a physician who has studied NDE for 20 years and had these episodes described to me, Dr. Alexander had an NDE which was not an hallucination. Dr. Wile did not want to accept the thelogy presented by Alexander, who went into the episode with no religious belief. Dr. Wile commented from a Christian perspective. God is God to all religions, and theologies differ.

  4. Sal, I help moderate r/creation on reddit if anyone would like to participate there.

  5. Sal, of all the talks that you had listed of the conference this one, along with Dr. John Sanford’s, was one of the two I was most interested in watching. Will you do a synapses of the Sanford talk as well? and Do you know if a video will be made available?,,, Oh never mind, you listed the link already,,

    http://creationicc.org/proceedings.php

  6. it still is a problem for evolution to account for how the indels got fixed into a population.

    I thought you knew neutral variants fixed at the mutation rate?. Of course, since indels change several bases you need many fewer events to explain the number of differences (and many of them are human-specific ERV insertions).

    I wouldn’t get too excited about ORFans either…

  7. Orphan Genes (And the peer reviewed ‘non-answer’ from Darwinists) – video
    http://www.youtube.com/watch?v=1Zz6vio_LhY

    Proteins and Genes, Singletons and Species – Branko Kozuli? PhD. Biochemistry
    Excerpt: Horizontal gene transfer is common in prokaryotes but rare in eukaryotes [89-94], so HGT cannot account for (ORFan) singletons in eukaryotic genomes, including the human genome and the genomes of other mammals.,,,
    The trend towards higher numbers of (ORFan) singletons per genome seems to coincide with a higher proportion of the eukaryotic genomes sequenced. In other words, eukaryotes generally contain a larger number of singletons than eubacteria and archaea.,,,
    That hypothesis – that evolution strives to preserve a protein domain once it stumbles upon it contradicts the power law distribution of domains. The distribution graphs clearly show that unique domains are the most abundant of all domain groups [21, 66, 67, 70, 72, 79, 82, 86, 94, 95], contrary to their expected rarity.,,,
    Evolutionary biologists of earlier generations have not anticipated [164, 165] the challenge that (ORFan) singletons pose to contemporary biologists. By discovering millions of unique genes biologists have run into brick walls similar to those hit by physicists with the discovery of quantum phenomena. The predominant viewpoint in biology has become untenable: we are witnessing a scientific revolution of unprecedented proportions.
    http://vixra.org/pdf/1105.0025v1.pdf
    Of Note: Branko Kozulic is on the editorial team of BioComplexity
    http://bio-complexity.org/ojs/.....TeamBio/23

    Moreover the ‘anomaly’ of unique ORFan genes is found in every new genome sequenced:

    Widespread ORFan Genes Challenge Common Descent – Paul Nelson – video with references
    http://www.vimeo.com/17135166

    Estimating the size of the bacterial pan-genome – Pascal Lapierre and J. Peter Gogarten – 2008
    Excerpt: We have found greater than 139 000 rare (ORFan) gene families scattered throughout the bacterial genomes included in this study. The finding that the fitted exponential function approaches a plateau indicates an open pan-genome (i.e. the bacterial protein universe is of infinite size); a finding supported through extrapolation using a Kezdy-Swinbourne plot (Figure S3). This does not exclude the possibility that, with many more sampled genomes, the number of novel genes per additional genome might ultimately decline; however, our analyses and those presented in Ref. [11] do not provide any indication for such a decline and confirm earlier observations that many new protein families with few members remain to be discovered.
    http://www.paulyu.org/wp-conte.....genome.pdf

    At the 12:40 minute mark of the following ‘The Dictionary of Life’ video, Dr. Nelson describes the breaking point for Darwinian scenarios from the genetic evidence:

    The Dictionary of Life | Origins with Dr. Paul A. Nelson – video
    http://www.youtube.com/watch?f.....vCo#t=760s

    The essential genome of a bacterium – 2011
    Figure (C): Venn diagram of overlap between Caulobacter and E. coli ORFs (outer circles) as well as their subsets of essential ORFs (inner circles). Less than 38% of essential Caulobacter ORFs are conserved and essential in E. coli. Only essential Caulobacter ORFs present in the STING database were considered, leading to a small disparity in the total number of essential Caulobacter ORFs.
    http://www.ncbi.nlm.nih.gov/pm.....201158.pdf

  8. wd400, I saw you mention neutral variants, so as to make it seem like you were trying to be rational in all this, but perhaps it would interest you (and others) to know some of the weaknesses inherent in the ‘neutral theory’ of evolution that Darwinists are very reluctant to openly admit:

    Kimura’s Quandary
    Excerpt: Kimura realized that Haldane was correct,,, He developed his neutral theory in response to this overwhelming evolutionary problem. Paradoxically, his theory led him to believe that most mutations are unselectable, and therefore,,, most ‘evolution’ must be independent of selection! Because he was totally committed to the primary axiom (neo-Darwinism), Kimura apparently never considered his cost arguments could most rationally be used to argue against the Axiom’s (neo-Darwinism’s) very validity.
    John Sanford PhD. – “Genetic Entropy and The Mystery of the Genome” – pg. 161 – 162

    A graph featuring ‘Kimura’s Distribution’ being properly used is shown in the following video:

    Evolution Vs Genetic Entropy – Andy McIntosh – video
    http://www.metacafe.com/watch/4028086

    Further quotes on the rather embarrassing situation Darwinists now find themselves in with the ‘neutral’ theory:

    Here is a Completely Different Way of Doing Science – Cornelius Hunter PhD. – April 2012
    Excerpt: But how then could evolution proceed if mutations were just neutral? The idea was that neutral mutations would accrue until finally an earthquake, comet, volcano or some such would cause a major environmental shift which suddenly could make use of all those neutral mutations. Suddenly, those old mutations went from goat-to-hero, providing just the designs that were needed to cope with the new environmental challenge. It was another example of the incredible serendipity that evolutionists call upon.
    Too good to be true? Not for evolutionists. The neutral theory became quite popular in the literature. The idea that mutations were not brimming with cool innovations but were mostly bad or at best neutral, for some, went from an anathema to orthodoxy. And the idea that those neutral mutations would later magically provide the needed innovations became another evolutionary just-so story, told with conviction as though it was a scientific finding.
    Another problem with the theory of neutral molecular evolution is that it made even more obvious the awkward question of where these genes came from in the first place.
    http://darwins-god.blogspot.co.....ay-of.html

    Thou Shalt Not Put Evolutionary Theory to a Test – Douglas Axe – July 18, 2012
    Excerpt: “For example, McBride criticizes me for not mentioning genetic drift in my discussion of human origins, apparently without realizing that the result of Durrett and Schmidt rules drift out. Each and every specific genetic change needed to produce humans from apes would have to have conferred a significant selective advantage in order for humans to have appeared in the available time (i.e. the mutations cannot be ‘neutral’). Any aspect of the transition that requires two or more mutations to act in combination in order to increase fitness would take way too long (>100 million years).
    My challenge to McBride, and everyone else who believes the evolutionary story of human origins, is not to provide the list of mutations that did the trick, but rather a list of mutations that can do it. Otherwise they’re in the position of insisting that something is a scientific fact without having the faintest idea how it even could be.” Doug Axe PhD.
    http://www.evolutionnews.org/2.....62351.html

    Michael Behe on the theory of constructive neutral evolution – February 2012
    Excerpt: I don’t mean to be unkind, but I think that the idea seems reasonable only to the extent that it is vague and undeveloped; when examined critically it quickly loses plausibility. The first thing to note about the paper is that it contains absolutely no calculations to support the feasibility of the model. This is inexcusable. – Michael Behe
    http://www.uncommondescent.com.....evolution/

    Majestic Ascent: Berlinski on Darwin on Trial – David Berlinski – November 2011
    Excerpt: The publication in 1983 of Motoo Kimura’s The Neutral Theory of Molecular Evolution consolidated ideas that Kimura had introduced in the late 1960s. On the molecular level, evolution is entirely stochastic, and if it proceeds at all, it proceeds by drift along a leaves-and-current model. Kimura’s theories left the emergence of complex biological structures an enigma, but they played an important role in the local economy of belief. They allowed biologists to affirm that they welcomed responsible criticism. “A critique of neo-Darwinism,” the Dutch biologist Gert Korthof boasted, “can be incorporated into neo-Darwinism if there is evidence and a good theory, which contributes to the progress of science.”
    By this standard, if the Archangel Gabriel were to accept personal responsibility for the Cambrian explosion, his views would be widely described as neo-Darwinian.
    http://www.evolutionnews.org/2.....53171.html

    Ann Gauger on genetic drift – August 2012
    Excerpt: The idea that evolution is driven by drift has led to a way of retrospectively estimating past genetic lineages. Called coalescent theory, it is based on one very simple assumption — that the vast majority of mutations are neutral and have no effect on an organism’s survival. (For a review go here.) According to this theory, actual genetic history is presumed not to matter. Our genomes are full of randomly accumulating neutral changes. When generating a genealogy for those changes, their order of appearance doesn’t matter. Trees can be drawn and mutations assigned to them without regard to an evolutionary sequence of genotypes, since genotypes don’t matter.
    http://www.uncommondescent.com.....tic-drift/

    At the 2:45 minute mark of the following video the mathematical roots of the junk DNA argument, that is still used by Darwinists in spite of the ENCODE findings of Sept. 2012, is traced through Haldane, Kimura, and Ohno’s work, in the 1950′s, 60′s and 70′s, in population genetics:

    What Is The Genome? It’s Not Junk! – Dr. Robert Carter – video – (Notes in video description)
    http://www.metacafe.com/w/8905583

    A bit more detail on the history of the junk DNA argument, and how it was born out of evolutionary thought, is here:

    Functionless Junk DNA Predictions By Leading Evolutionists
    http://docs.google.com/View?id=dc8z67wz_24c5f7czgm

  9. I wouldn’t get too excited about ORFans either…

    Paul Nelson had a talk at ICC 2013 on ORFans. The evolutionary paradigm hates them and thus had a predisposition to use the faulty Chimp/Human comparisons as evidence against human ORFans. Given Tomkins study, Lander’s work should be looked with suspicion.

  10. I thought you knew neutral variants fixed at the mutation rate?. Of course, since indels change several bases you need many fewer events to explain the number of differences (and many of them are human-specific ERV insertions).

    If that is the indel mutation rate, we could test that couldn’t we and also make prediciton about the structure of the human genome. This may lead to problems.

    Nevertheless, if you invoke indels as neutral, and indels are found to serve function, then we have a case where a function evolved free of selection, hance at least Dawkins is wrong if indels have some significance.

  11. I’m curious, are evolutionists going to respond to this research or just pretend it doesn’t exist? When are the formal debates?

    Can videos of these talks be viewed anywhere? Are they part of the “box sets” on the ICC page?

  12. To my knowledge there are no videos, but supposedly audio is available. The papers are available on DVD.

    Now, to save you some money, I can tell you the links I provided above will give you most of the data you would be interested in anyway.

    The graphic of the indels above should give you a picture of the problem. Remove the indels, and everything looks like the evolutionary story, include them and the comparison goes down to 80-85%.

    Same with the exons and introns and regulatory elements associated with the genes. Include those and the similarity of 98% is obliterated.

    This has important medical significance. The regulatory regions are important. The 98% myth has de-emphasized the regulatory regions, and thus hindered the advance of medical science since the regulatory regions have influence on hereditary disease. Not good…Darwinism hurts science and medicine. Frankly, I can’t see where it has ever helped — creationist comparative anatomy and common design assumptions would have done far better than common descent assumptions as far as medicine goes, imho.

  13. Here is a peer-reviewed paper supporting Tomkins and the functional significance of indels. It suggests indels have function, and this has impact the evolvability of humans from apes.

    http://www.mobilednajournal.com/content/2/1/13

    Background

    Although humans and chimpanzees have accumulated significant differences in a number of phenotypic traits since diverging from a common ancestor about six million years ago, their genomes are more than 98.5% identical at protein-coding loci. This modest degree of nucleotide divergence is not sufficient to explain the extensive phenotypic differences between the two species. It has been hypothesized that the genetic basis of the phenotypic differences lies at the level of gene regulation and is associated with the extensive insertion and deletion (INDEL) variation between the two species. To test the hypothesis that large INDELs (80 to 12,000 bp) may have contributed significantly to differences in gene regulation between the two species, we categorized human-chimpanzee INDEL variation mapping in or around genes and determined whether this variation is significantly correlated with previously determined differences in gene expression.

    Results

    Extensive, large INDEL variation exists between the human and chimpanzee genomes. This variation is primarily attributable to retrotransposon insertions within the human lineage. There is a significant correlation between differences in gene expression and large human-chimpanzee INDEL variation mapping in genes or in proximity to them.

    Conclusions

    The results presented herein are consistent with the hypothesis that large INDELs, particularly those associated with retrotransposons, have played a significant role in human-chimpanzee regulatory evolution.

  14. wd400:

    I thought you knew neutral variants fixed at the mutation rate?.

    On paper, perhaps. But no one has ever shown that to be so.

    I wouldn’t get too excited about ORFans either…

    Of course YOU wouldn’t. Your position magically accomodates just about anything. Just wait until some developmental biologist demonstrates (on paper) that saltation is not only possible but the only explanation for macroevolution?

  15. semi related:

    This is the sequence of the RNA transcript encoding NADH dehydrogenase 7 in Trypanosoma brucei. What’s fascinating about this sequence is that only the nucleotides colored black in the graphic below are actually encoded in the mitochondrial DNA. The uridine nucleotides colored red have been inserted post-transcription by RNA editing. The blue asterisks (*) indicate locations where uridines have been deleted.

    As you can see, almost the whole gene has been re-written post-transcription by RNA editing (without the editing, the gene is nonfunctional). Now, how would a non-intelligent process like neo-Darwinism account for this kind of phenomenon…?
    http://www.facebook.com/photo......38;theater

  16. scordova:

    If evolutionary biologists can’t be forthright and accurate about even basic empirical questions of data in the present day, why should they be trusted with speculations about the deep past?

    Ironically, it may be comparatively easier for them to be forthright about the deep past, since they only offer speculations that can be retracted and/or revised whenever needed.

    It is in the present day that the accessible hard empirical facts most devastatingly impinge upon the grand story they want to tell. For example, the true extent of the differences between humans and chimps (or any other supposed closely relate species) is incompatible with their story.

    What choice do they have, if they are unwilling to let go of their story and face these unwelcome facts?

  17. For example, the true extent of the differences between humans and chimps (or any other supposed closely relate species) is incompatible with their story.

    Do you want to spell out how this is the case? The indel differences between humans and chimps require far fewer mutational events to explain the the ~2% differences arising by substitution. It seems quite compatable with a 6Ma divergence time for humans and chimps.

  18. If that is the indel mutation rate, we could test that couldn’t we and also make prediciton about the structure of the human genome. This may lead to problems.

    Predict away.. but what are the problems?

    Nevertheless, if you invoke indels as neutral, and indels are found to serve function, then we have a case where a function evolved free of selection, hance at least Dawkins is wrong if indels have some significance.

    Lol. It’s not neutral theory or selection. It’s both. Some indels are probably selectively neutral (most of our DNA is junk, after alll) but some will be deleterious and a few might be beneficial (that’s the transposon-mediated differences in gene expression and the like).

    I’m still not actually sure what the point of any of this is. DNA is an essence, the 98% figure is sacred among evolutionary biologists, it’s just what you count the number of single-nucleotide difference between the genomes.

  19. Lol. It’s not neutral theory or selection. It’s both. Some indels are probably selectively neutral (most of our DNA is junk, after all) but some will be deleterious and a few might be beneficial (that’s the transposon-mediated differences in gene expression and the like).

    Lol at yourself. Are you suddenly suggesting most fixed indels are the result of positive selection? Or maybe 10% or 5% or 1%. If you say 80%, then what is the evidence of that given that only about 1000 traits can be fixed via selection according to Haldane’s dilemma.

    If you don’t accept Haldane’s dilemma feel free to provide for the reader the number of SNPs, indels, or whatever can be fixed via selection in 6 million years. Don’t have a figure? Then you have no basis to Lol except at yourself since you’ll confidently assert it’s no problem for evolution yet you won’t provide figures for indel fixation rates due to selection.

    Also, just because an indel’s absence might be severely deleterious does not imply positive selection was the reason they got incorporated into the population.

    . DNA is an essence, the 98% figure is sacred among evolutionary biologists, it’s just what you count the number of single-nucleotide difference between the genomes.

    98% figure sacred? Sounds religious.

    The number SNPs is not the only gauge of difference since phenotypic effects appear influenced by indels, or do you disagree with the above linked paper that attributes phenotypic differences to other factors than protein substitutions? Further 98% is only comparison of orthologous genes, not even the indels, introns, exons, pseudo genes, orphans, etc.

    The 98% figure is misleading. I still hear bio students saying we’re 98% similar to other apes….

  20. I obviously mean no sacred. As in it’s just a number.

    What do you think an exon is? And why do you think exons introns and pseudogenes don’t have orthologues?

  21. Jut to be clear, last ‘graph of 18 should read

    I’m still not actually sure what the point of any of this is. DNA is not an essence, the 98% figure is not sacred among evolutionary biologists, it’s just what you get when count the number of single-nucleotide difference between the genomes

  22. Raw aligned sequence similarity is a metric for similarity. Chimp, orangutan, rat, catfish, all have different degrees of raw sequence similarity to humans, and the similarity increases with other measures of genetic and evolutionary distance, including the alternative measures Tomkins suggests. If all we want to do is to ask questions like “is the chimp genome more similar, or less similar, to the human genome than the orangutan genome?”, then all of these measures are going to give the same answer (more similar). This is why the raw aligned similarity measure is useful, although it may not be as good as some other measures that are harder to compute.

    By contrast, if we take an encyclopedia, Tom Wolfe’s book, a dictionary, your local newspaper, this web page, and break them down into a word list, then ask for the overlap with dictionary words, we get 100 % every time, except for miss-spellings.

    Sequence similarity discriminates: vocabulary overlap with the dictionary does not. Sequence similarity is not based on disregarding the order of nucleotides! This is clear from the figure shown above. The claim of a “dictionary trick” is a false charge, whether it is coming from a geneticist or not. Can’t you people figure these things out? If you want to play scientist, you need to learn how to distinguish a bad argument from a good one.

  23. And why do you think exons introns and pseudogenes don’t have orthologues?

    I never said that, you’re attributing a claim to me I didn’t make.

  24. What does this mean? And what is an exon?

    “Further 98% is only comparison of orthologous genes, not even the indels, introns, exons, pseudo genes, orphans, etc.”

  25. I wouldn’t get too excited about ORFans either…

    The paper you cited by Lander is questionable even though it is a PNAS paper. Paul Nelson criticized it at ICC 2013 (more on that later)

    It tries to argue that human ORFans don’t really exist because we don’t find traces of them in dogs, or mouse. Here is science daily on Lander’ “work” where lander uses the assumption of evolution to dismiss human orfans as real: :roll:

    To distinguish such misidentified genes from true ones, the research team, led by Clamp and Broad Institute director Eric Lander, developed a method that takes advantage of another hallmark of protein-coding genes: conservation by evolution. The researchers considered genes to be valid if and only if similar sequences could be found in other mammals – namely, mouse and dog. Applying this technique to nearly 22,000 genes in the Ensembl gene catalog, the analysis revealed 1,177 “orphan” DNA sequences. These orphans looked like proteins because of their open reading frames, but were not found in either the mouse or dog genomes.

    Although this was strong evidence that the sequences were not true protein-coding genes, it was not quite convincing enough to justify their removal from the human gene catalogs. Two other scenarios could, in fact, explain their absence from other mammalian genomes. For instance, the genes could be unique among primates, new inventions that appeared after the divergence of mouse and dog ancestors from primate ancestors. Alternatively, the genes could have been more ancient creations — present in a common mammalian ancestor — that were lost in mouse and dog lineages yet retained in humans.

    If either of these possibilities were true, then the orphan genes should appear in other primate genomes, in addition to our own. To explore this, the researchers compared the orphan sequences to the DNA of two primate cousins, chimpanzees and macaques. After careful genomic comparisons, the orphan genes were found to be true to their name — they were absent from both primate genomes. This evidence strengthened the case for stripping these orphans of the title, “gene.”

    Talk about biased distortion. They argue if the gene isn’t in dogs, mice, other primates, but is found in humans, then it isn’t a gene. Thus the eliminate ORFans via definition, not actually by experiment or observation of the proteins the ORFans may code for!

    First Jerry Coyne a few years after the Lander paper:

    More than 6 percent of genes found in humans simply aren’t found in any form in chimpanzees. There are over fourteen hundred novel genes expressed in humans but not in chimps. – See more at: http://www.evolutionnews.org/2.....yW9rE.dpuf

    Here is an example of processed pseudogene(retrogenes) that seemed to escape Lander’s paper. Now that time has passed and more data emerged, the Lander paper is losing it’s force.

    http://www.ncbi.nlm.nih.gov/pubmed/23066043

    Tomkins writes on the orphan retrogenes:

    http://designed-dna.org/blog/f.....eb4-65.php

    But this could all be moot. Lander points out we really don’t even know all the proteins we’re dealing with so we’re just guessing at what are and are not genes.

    Furthermore, the notion of “gene” is a bit misleading since alternative splicing can create lots of other protein isoforms, how many:

    First, the nonredundant set of proteins has here been defined as a single representative protein from every gene locus. At present, the human genome contains 22,000–23,000
    genes, although the estimated number is still changing on a monthly basis (www.ensembl.org). Thus, the nonredundant set of proteins in the human proteome is probably between 20,000 and 25,000. On the other hand, if one includes all the protein variants generated by RNA splicing or specific proteolytic processing, the number of protein isoforms rapidly increases. Splicing is a common phenomenon and frequently gives rise to different forms of the same protein, often through events linked to a targeting of the protein variants to different compartments of the cell (50). Site-specific proteolysis is particularly
    common in the processing of preproteins of neuropeptides,
    but has also been shown to be involved in the aturation of proteins, such as the cleavage of the C-peptide from the proinsulin molecule to create functional insulin and
    C-peptide (51). The estimated number of protein variants
    represented by splicing and proteolysis is still unknown, but the number might be between 50,000 and 500,000.

    ….
    Another form of variation in the human proteome is the combinatorial variants created by somatic rearrangement in cells involved in the immune system. A well-known example is the immunoglobulin G (IgG) The number of different IgG molecules in a human individual is probably
    more than 10 million molecules all with different complementarity-determining regions and thus different binding properties

    http://www.mcponline.org/conte.....l.pdf+html

    And just where are those fabulous proteins realized? Not necessarily just in the coding regions but exactly those regions ignored by those claiming 98% similarity between chimps and humans.

    And in the case of IgG proteins, the variants are achieved via different mechanism than alternative splicing, thus the 10,000,000 IgG proteins can’t easily be deduced merely looking at the DNA. From this website,

    http://pathmicro.med.sc.edu/ma.....cs2000.htm

    it appears that the 10,000,000 IgG variants are sourced from only about a few hundred “genes”:

    What if we find even more cell specific protein variants? :-)

  26. I should have clarified, non-orthologous non-alignable exons.

    I was referring to the tendency to tally only exons that are only in chimp and humans and highly alignable.

  27. One of the most ambiguous of all human–chimp studies was published by Nielson et al.23 In keeping with the established obfuscational trend, only highly conserved exons were used and no data were given to allow one to calculate any type of real overall similarity. Of the total starting number of gene sequences in the analysis (20,361) the researchers decided to throw out 33% (6,630) in an ambiguously stated “very conservative quality control”. In other words, one third of the initial chimp data did not align to human, so it got tossed out.

    http://creation.com/human-chim.....-evaluated

  28. Arlin:

    Can’t you people figure these things out? If you want to play scientist, you need to learn how to distinguish a bad argument from a good one.

    So Arlin, are humans 98% similar to chimps?

    Sequence similarity is not based on disregarding the order of nucleotides!

    So disregarding indels isn’t disregarding order? Heck you do worse than that! You don’t just disregard order you disregard entire sets of nucleotides, you snip out words and letters to force fit a comparison.

    Then you disregard synteny, then non-coding regionslike the differences in promoter regions, then disregard ORFans.

    Can’t you people figure these things out? If you want to play scientist, you need to learn how to distinguish a bad argument from a good one.

    Actually, the problem is we figured some of the evolutionary ruses, the falsehoods and the misleading information that pretends to be science.

    And no, I don’t want to play scientist, this is just a public blog, and it’s not real science, but it does try to report on what happens in world of science.

    At least I’m willing to say what I write isn’t real science, whereas the 98% similarity argument isn’t science even though it pretends it is.

  29. Sal, if that’s what you meant then this sentence is meaningless

    ““Further 98% is only comparison of orthologous genes, not even the indels, introns, exons, pseudo genes, orphans, etc.””

    The 98% included exons, introns and pseudogenes.

  30. And just where are those fabulous proteins realized? Not necessarily just in the coding regions but exactly those regions ignored by those claiming 98% similarity between chimps and humans.

    This is also not true. Where do you think the 98% figure comes from?

  31. The 98% comes from looking at similar DNA sequences.

    But anyway unguided evolution cannot account for exons, introns and alteranitve splicing

  32. wd400, for all your commenting on this article, you seem to be just focusing on minor details. I am curious what is your opinion (or any evolutionist’s opinion, assuming you are one) of the substance of the research and its implications? Do you still feel the public is currently presented with an accurate picture of human-chimp genetic similarity with the ~98% claim?

  33. The 98% included exons, introns and pseudogenes.

    The 98% included only “orthologous exons”.

    ““Further 98% is only comparison of orthologous genes, not even the indels, introns, exons, pseudo genes, orphans, etc.””

    This sentence is indeed meaningless, thanks for your editorial help and correction. The meaningful revision:

    ““Further 98% is only comparison of orthologous portions, not the indels, non-orthologous exons, non-orthologous pseudo genes, orphan genes (which are non-orthologous by definition), non orthologous promoter regions, non orthologous regulatory regions, non-orthologous intergenic sequences, non-orthologous large scale structures caused by synteny differences etc.

    Would you agree with that? Does that make more sense. Feel free to revise it to accord with the truth. And the larger question, in light of this editorial improvement, is the 98% hypothesis improved. Heck no, Tomkins claim stands, and is probably understating if anything.

    Thanks for your participation and comments in my discussion.

    Now, if you are willing, can you answer request I posed above:

    If you don’t accept Haldane’s dilemma feel free to provide for the reader the number of SNPs, indels, or whatever can be fixed via selection in 6 million years

    Mendel’s accountant says about 1000. Haldane’s work suggest about 1000 (a figure that implicitly appears in Ohta and Kimura of 1 nucleotide substitution every 300 generation on average). Mendel’s Account therefore agrees with published evolutionary literature for the last 60 years! Nothing new. If you think you have another figure feel free to provide it. As I said, I think most fixation would have to be neutral not selective.

  34. The 98% included only “orthologous exons”.

    Wrong again. The ~98% figure includes comparisons of intergenic space, introns, regulatory elements and pseudogenes.

    ““Further 98% is only comparison of orthologous portions, not the indels, non-orthologous exons, non-orthologous pseudo genes, orphan genes (which are non-orthologous by definition), non orthologous promoter regions, non orthologous regulatory regions, non-orthologous intergenic sequences, non-orthologous large scale structures caused by synteny differences etc.

    Well, I guess yeah, it includes all the regions that are orthologous and not those that aren’t. I don’t know why’d you list them all, but fine. The point remains the “98%” accurately describes the single base pair differences between humans and chimps across most of the genome. Indels and structural variation will create more apparent divergence (i.e. more bases that don’t line up between the species), but the nature of these events means we retuire fewer mutations to explain them.

    I don’t know about a speed limit for Darwinian evolution, but Haldane’s 1/300 generations is an obvious underestimate, as it assumes a population has to fix genes in serial. If Mendel’s accountant found the same result we can be fairly sure that’s based on false assumptions too.

    Even so, ~2,000 difference between humans and chimps fixed by selection seems like quite a few to me.

  35. lifepsy.

    If the public are told that humans and chimps ar 98% alike then they aren’t getting a good picture of what DNA is. If they are being told are genomes are usually about 2% different from each other then they are getting a pretty accurate picture of what our genomes look like.

  36. Wrong again. The ~98% figure includes comparisons of intergenic space, introns, regulatory elements and pseudogenes.

    Good gravy, do we have to go through all this over again!

    Do FASTA files include intergenic sequences?

    JoeCoder, any computer types out there, we ought to be able to do a UNIX diff or PEARL script or whatever to these FASTA files and settle the issue. If the Synteny blows the comparison off the map we might be able to coax the comparison a bit, but we know the Chimp FASTA files are already patched according to the human genome since it wasn’t done properly, so we might actually get a decent diff score.

    Tomkins did as much with PEARL scripts and got 70%. We can duplicate it and publish it on the net.

  37. Sal, niwrad may be able to help with the computer stuff. He had the article a while back:

    A simple statistical test for the alleged “99% genetic identity” between humans and chimps – September 2010
    Excerpt: The results obtained are statistically valid. The same test was previously run on a sampling of 1,000 random 30-base patterns and the percentages obtained were almost identical with those obtained in the final test, with 10,000 random 30-base patterns. When human and chimp genomes are compared, the X chromosome is the one showing the highest degree of 30BPM similarity (72.37%), while the Y chromosome shows the lowest degree of 30BPM similarity (30.29%). On average the overall 30BPM similarity, when all chromosomes are taken into consideration, is approximately 62%.
    http://www.uncommondescent.com.....nd-chimps/

  38. Yes, as long as you continue to be dead wrong you’ll have to justify your comments.

    What do you mean me being dead wrong. Let’s define what you mean by dead wrong.

    If I take the Y chromosome of a chimp and a human and do a DIFF (or other optimal string comparison) do you expect the Chromosomes will yield a 98% number?

    Of course you’ll complain that’s not a proper comparison, that we have to do alignments (a euphemism for a dictionary trick).

    How about Chromosome 21 a small one. I take a fasta file containing 48 million letters for the human. Are you saying if I do a simple Diff between the human and chimp chromosome 21, you expect that I should get 98% similarity?

    If you don’t say that, what do you suggest — we snip out the similar sections throw out the dissimilar sections, rearrange the sections so they line up and then compare only the similar sections (essentially a dictionary trick)? In such case, I’m not dead wrong, since you’ve done exactly the illegitimate comparison procedure being criticized.

    Maybe I could be generous, I could snip out 5 million base pair regions in the human and see if there is a corresponding 5 million base pair region at the 98% matching level. Any predictions of what I’ll find? Do you want to insist I’m still dead wrong, or maybe you can define for the readers what you mean by dead wrong.

    Thankfully the databases are now available publicly for all to see and the net has bandwidth to download files containing 48 million characters (around 48 megabytes, likely less in compressed format). These comparisons can be done, they are not longer protected from the view of the public and filtered by the gatekeepers wishing to maintain a false narrative.

  39. wd400, a bit OT but, how do the undirected processes of Darwinism write overlapping codes when I best programmers can’t even do as such?

    Multiple Overlapping Genetic Codes Profoundly Reduce the Probability of Beneficial Mutation George Montañez 1, Robert J. Marks II 2, Jorge Fernandez 3 and John C. Sanford 4 – published online May 2013
    Excerpt: In the last decade, we have discovered still another aspect of the multi- dimensional genome. We now know that DNA sequences are typically “ poly-functional” [38]. Trifanov previously had described at least 12 genetic codes that any given nucleotide can contribute to [39,40], and showed that a given base-pair can contribute to multiple overlapping codes simultaneously. The first evidence of overlapping protein-coding sequences in viruses caused quite a stir, but since then it has become recognized as typical. According to Kapronov et al., “it is not unusual that a single base-pair can be part of an intricate network of multiple isoforms of overlapping sense and antisense transcripts, the majority of which are unannotated” [41]. The ENCODE project [42] has confirmed that this phenomenon is ubiquitous in higher genomes, wherein a given DNA sequence routinely encodes multiple overlapping messages, meaning that a single nucleotide can contribute to two or more genetic codes. Most recently, Itzkovitz et al. analyzed protein coding regions of 700 species, and showed that virtually all forms of life have extensive overlapping information in their genomes [43].
    Conclusions: Our analysis confirms mathematically what would seem intuitively obvious – multiple overlapping codes within the genome must radically change our expectations regarding the rate of beneficial mutations. As the number of overlapping codes increases, the rate of potential beneficial mutation decreases exponentially, quickly approaching zero. Therefore the new evidence for ubiquitous overlapping codes in higher genomes strongly indicates that beneficial mutations should be extremely rare. This evidence combined with increasing evidence that biological systems are highly optimized, and evidence that only relatively high-impact beneficial mutations can be effectively amplified by natural selection, lead us to conclude that mutations which are both selectable and unambiguously beneficial must be vanishingly rare. This conclusion raises serious questions. How might such vanishingly rare beneficial mutations ever be sufficient for genome building? How might genetic degeneration ever be averted, given the continuous accumulation of low impact deleterious mutations?
    http://www.worldscientific.com.....08728_0006

    ‘It’s becoming extremely problematic to explain how the genome could arise and how these multiple levels of overlapping information could arise, since our best computer programmers can’t even conceive of overlapping codes. The genome dwarfs all of the computer information technology that man has developed. So I think that it is very problematic to imagine how you can achieve that through random changes in the code.,,, and there is no Junk DNA in these codes. More and More the genome looks likes a super-super set of programs.,, More and more it looks like top down design and not just bottom up chance discovery of making complex systems.’ –
    Dr. John Sanford
    http://www.youtube.com/watch?f.....dM_s#t=31s

    Moreover wd400, besides the fact that the underlying assumptions of neo-Darwinism are now known to be false (Nobel, Shapiro) is not the gene-centric view of the genome, which you are currently defending, now overturned by the ENCODE findings of Sept. 2012?

    Landscape of transcription in human cells – Sept. 6, 2012
    Excerpt: Here we report evidence that three-quarters of the human genome is capable of being transcribed, as well as observations about the range and levels of expression, localization, processing fates, regulatory regions and modifications of almost all currently annotated and thousands of previously unannotated RNAs. These observations, taken together, prompt a redefinition of the concept of a gene.,,,
    Isoform expression by a gene does not follow a minimalistic expression strategy, resulting in a tendency for genes to express many isoforms simultaneously, with a plateau at about 10–12 expressed isoforms per gene per cell line.
    http://www.nature.com/nature/j.....11233.html

    Time to Redefine the Concept of a Gene? – Sept. 10, 2012
    Excerpt: As detailed in my second post on alternative splicing, there is one human gene that codes for 576 different proteins, and there is one fruit fly gene that codes for 38,016 different proteins!
    While the fact that a single gene can code for so many proteins is truly astounding, we didn’t really know how prevalent alternative splicing is. Are there only a few genes that participate in it, or do most genes engage in it? The ENCODE data presented in reference 2 indicates that at least 75% of all genes participate in alternative splicing. They also indicate that the number of different proteins each gene makes varies significantly, with most genes producing somewhere between 2 and 25.
    Based on these results, it seems clear that the RNA transcripts are the real carriers of genetic information. This is why some members of the ENCODE team are arguing that an RNA transcript, not a gene, should be considered the fundamental unit of inheritance.
    http://networkedblogs.com/BYdo8

    Demise of the Gene – September 19, 2012
    Excerpt: Although the gene has conventionally been viewed as the fundamental unit of genomic organization, on the basis of ENCODE data it is now compellingly argued that this unit is not the gene but rather the transcript (Washietl et al. 2007; Djebali et al. 2012a). On this view, genes represent a higher-order framework around which individual transcripts coalesce, creating a poly-functional entity that assumes different forms under different cellular states, guided by differential utilization of regulatory DNA. (What does our genome encode? John A. Stamatoyannopoulos Genome Res. 2012 22: 1602-1611.)
    http://www.evolutionnews.org/2.....64371.html

    The Extreme Complexity Of Genes – Dr. Raymond G. Bohlin – video
    http://www.metacafe.com/watch/8593991/

    Not that the 98% myth needs to be forcefully dealt with and clearly overturned wd400, but does not all of the preceding evidence sort of make your defense of the 98% myth a bit futile and pointless?

    footnote:

    Stephen Meyer – Functional Proteins And Information For Body Plans – video
    http://www.metacafe.com/watch/4050681

    Dr. Stephen Meyer comments at the end of the preceding video,,,

    ‘Now one more problem as far as the generation of information. It turns out that you don’t only need information to build genes and proteins, it turns out to build Body-Plans you need higher levels of information; Higher order assembly instructions. DNA codes for the building of proteins, but proteins must be arranged into distinctive circuitry to form distinctive cell types. Cell types have to be arranged into tissues. Tissues have to be arranged into organs. Organs and tissues must be specifically arranged to generate whole new Body-Plans, distinctive arrangements of those body parts. We now know that DNA alone is not responsible for those higher orders of organization. DNA codes for proteins, but by itself it does not insure that proteins, cell types, tissues, organs, will all be arranged in the body. And what that means is that the Body-Plan morphogenesis, as it is called, depends upon information that is not encoded on DNA. Which means you can mutate DNA indefinitely. 80 million years, 100 million years, til the cows come home. It doesn’t matter, because in the best case you are just going to find a new protein some place out there in that vast combinatorial sequence space. You are not, by mutating DNA alone, going to generate higher order structures that are necessary to building a body plan. So what we can conclude from that is that the neo-Darwinian mechanism is grossly inadequate to explain the origin of information necessary to build new genes and proteins, and it is also grossly inadequate to explain the origination of novel biological form.’ -
    Stephen Meyer – (excerpt taken from Meyer/Sternberg vs. Shermer/Prothero debate – 2009)

  40. Here’s what I mean by dead wrong. You keep saying the 98% figure is fore exons only. It’s not. You are wrong about that.

    BTW, that old post is classic.

    If I read it right, they find there is a ~0.67 chance of finding a 30 base pair run that perfectly matches between genomes. Treating each nucleotide indepentantly, that gives an expected similarity per nucleotide of 0.67^(1/30) ~ 98%! If you want a lower number just make the perfect-match criterion longer and longer you’ll end up with no matches at all.

  41. You keep saying the 98% figure is fore exons only. It’s not. You are wrong about that.

    So if I take chromosome 21 in human and chromosome 21 in chimp, and do an objective computerized comparison with no alignments, what do you expect? 98%?

    For the reader’s benefit, in Configuration Management and Version Control Systems that track the versions of documents, an optimal way to track all the changes between versions is to find some sort of minimal amount of editing needed to transform one version to the other. These minimal edits are then stored in file. Thus, algorithms exist which can approximately describe the minimal number of evolutionary transformations from one string to another. The relevance of such techniques should be obvious to the question of evolving one gigantic string of DNA to another (like Chromosome 21). Such algorithms are an objective measure of the differences between strings.

    Hence, we ought to be able to do this between Chromosome 21 of humans and chromosome 21 of chimps if they are 98% similar. If the algorithm blows up in the attempt, this is evidence we aren’t 98% similar to chimps in chromosome 21. We can then do the same for every chromosome.

    Any predictions as to what such an honest comparison will yield?

    For the reader’s benefit, here is a description of this objective comparison method:

    http://en.wikipedia.org/wiki/Diff

    Lest anyone think it is illegitimate to use algorithms comparing human documents versus DNA, consider this:

    http://en.wikipedia.org/wiki/L.....ce_problem

    The longest common subsequence (LCS) problem is to find the longest subsequence common to all sequences in a set of sequences (often just two). Note that subsequence is different from a substring, for the terms of the former need not be consecutive. It is a classic computer science problem, the basis of file comparison programs such as diff, and has applications in bioinformatics.

    Here is a sample DNA sequence in FASTA format:

    gcctgaattcttttgtccactcgtgtcaggtgatttcgtaactgcaatctaagccatccagattctaagttcggatcgacgacatagctttctgtattctcgtcactcagcgcattgaaatgcactagcttgccacacattaaaatgtactacatgacacaaccagcgttgaatcgcctcttaacgctatagtaggcaacagcacggtgcgctacaggcctctcgatgatcgcctgctct
    tcgtagtagtaattagcccatcattttcatcccaaaggtatagacccttcacgccgtgtcttttgcctgctttcggccga

    We get a file that is 48 million letters long for human chromosome 21 and one for chimp chromosome 21. Any predictions for what the diff procedure will yield?

  42. Diff would give you a really big patch, but that’s because (as I understand it) diff doesn’t deal with rearrangements (shuffled lines).

  43. Diff would give you a really big patch, but that’s because (as I understand it) diff doesn’t deal with rearrangements (shuffled lines).

    Thanks for your comments. I eventually will have to try a few things, but I’ve got to start somewhere. I have contacts in the Computer Science and Bioinformatics community including those that worked on the BLAST algorithms, I might have to ping them for assistance.

    Thanks again.

Leave a Reply