Home » Biology, Darwinism, Evolution » Complex speciation of humans and chimpanzees

Complex speciation of humans and chimpanzees

John Wakeley1

Abstract

Arising from: N. Patterson, D. J. Richter, S. Gnerre, E. Lander & D. Reich Nature 441, 1103–1108 (2006); Patterson et al.

Genetic data from two or more species provide information about the process of speciation. In their analysis of DNA from humans, chimpanzees, gorillas, orangutans and macaques (HCGOM), Patterson et al.1 suggest that the apparently short divergence time between humans and chimpanzees on the X chromosome is explained by a massive interspecific hybridization event in the ancestry of these two species. However, Patterson et al.1 do not statistically test their own null model of simple speciation before concluding that speciation was complex, and—even if the null model could be rejected—they do not consider other explanations of a short divergence time on the X chromosome. These include natural selection on the X chromosome in the common ancestor of humans and chimpanzees, changes in the ratio of male-to-female mutation rates over time, and less extreme versions of divergence with gene flow (see ref. 2, for example). I therefore believe that their claim of hybridization is unwarranted.

[Bold added]

Just curious…How does interspecific hybridization occur between a Pan & Homo ?

 

  • Delicious
  • Facebook
  • Reddit
  • StumbleUpon
  • Twitter
  • RSS Feed

571 Responses to Complex speciation of humans and chimpanzees

  1. 1

    So this says that chimps and humans were interbreeding?

    A. I thought ID believed that there was a great differnce between chimps and humans. That you can’t determine kinship by genetic similarity. It could be common design.

    B. Dr. Dembski has said that the evidence doesn’t support Universal Common Descent. Maybe he is wrong?

    What is going on here? Is ID full full of malarkey? Someone isn’t telling the truth here.

  2. Just curious…How does interspecific hybridization occur between a Pan & Homo ?

    We know that hybridization occurs between Bison (genus Bison) and cow, (genus bos). This is an equivelant hybridization.

    Dr. Dembski has said that the evidence doesn’t support Universal Common Descent. Maybe he is wrong?

    Other IDers, such as Behe, support common descent. I, for one, have concluded from the evidence that there is a common ancestor between chimps and humans. If there is any question of universal common descent, then the breaks in common descent happen far up the ladder. There is some validity in the argument that the cambrian explosion, for instance was not an event of common descent.

    The nearer the split between chimp and human, the more potent becomes ReMine’s “Haldane’s dilemma” challenge. (ReMine, by the way, suggests that there is too much genetic diversity between human and chimp for there not to have been a De Nuveau creation. I beg to differ.)

    Further, consider the HAR1F gene. It is different in 18 point mutations with the chimp. Big deal? It is ultra-conserved in chickens and mice! The bottom line is that this thing had to have all 18 mutations happen at the same time. Such an event is, in itself, beyond the UPB.

    PannenbergOmega, there is a significant contingent of IDers who find no reason to question common descent. I think that we are more ready to question common descent than the darwinists, but common descent actually has strong supporive evidence.

  3. The kind of science this article is talking about is mere speculative science. DNA is often similar and often not among species that are and are not related. My point is that the evidence the authors use is questionable as almost all of evolution science is. This is to be taken with a grain of salt. There are currently all kinds of opposing theories about how evolution and diversification happened. This is one of many and they cant all be right.

  4. 4

    Interesting. Thank you bFast.
    It’s too bad (in my opinion) that there is so much evidence for common ancestry. I don’t see how you can reconcile it with the Biblical account of creation.

    What I’m saying is, I wish the data undeniably supported the Biblical account of creation.

  5. I’d just like to second Frost’s (3) point. If I understand correctly, the article is claiming that the X chromosome is not as divergent between chimps and humans as other chromosomes are. If so, those are the facts. The proposed explanation of those facts appears to leave something to be desired. If there was hybridization, why was the X chromosome the only chromosome that got shared? Shouldn’t there be other chromosomes that were also shared? If the gene transfer went in only one direction, shouldn’t there be two widely divergent versions of the X chromosome in either humans or chimps, or if it went in both directions, in both? (Other questions come up. Was the sharing before or after the divergence between chimpanzees and bonobos? WHere do gorillas fit in?)

    I’m not saying that there is no theoretical possibility that this could have happened. But it does seem that the model being proposed doesn’t explain the facts well.

    On the other hand, If someone (or Someone) designed the two species, one could easily conceive of a re-use of some sections of code with minimal modification, like the X chromosome, and highly modified code in other areas, such as the HAR1F gene, and perhaps even areas of totally new code.

    So, PannenbergOmega, I actually don’t see this as evidence of hybridization, let alone common ancestry.

  6. bFast,

    I disagree. First, the chromosomes are off by a couple, which will likely produce a sterile hybrid (an evolutionary dead end). Of course, this is just speculation, since the article says that “the X chromosome is explained by a massive interspecific hybridization event in the ancestry of these two species.” So, the hybrid event is only conjecture. BTW—I am not surprised that evolutionists would take this line of reasoning. You know, they will eventually have to point to the actual ancestors. Second, there are stark reproductive differences between chimps and humans. What is the likelihood that their ancestors were not? Third, the genetic differences are much greater than originally thought:

    http://www.sciencemag.org/cgi/...../5833/1836

    http://www.newscientist.com/article.ns?id=dn5044

    Sorry, I don’t think that the evidence for common ancestry is as solid as you hope.

  7. In regards to what Paul is saying,

    Id like to aso add that if in fact man bread with apes and we are the result of such an evolutionary mechinism- then we apparenty aren’t man.

    Apparently man lived along time ago and disappeared. So I guess we should address each another not as fellow man but fellow hybrid.

    I. Don’t. Buy it.

    However, looking at the three apes we have running for president: Hillary, Obama and Mccain; I dont think we can totaly rule out the above hypothesis.

  8. Paul Glem asked:

    “If there was hybridization, why was the X chromosome the only chromosome that got shared?”

    It wasn’t; it was the only one “studied” in this investigation. There are many other pieces of genetic evidence pointing to the same conclusion. Perhaps one of the best is the discovery that human chromosome 2 is actually two chromosomes glued together: two chromosomes that are separate in chimpanzees (and all other primates). That is, in the divergence between the line of primates that evolved into chimps (genus Pan) and humans (genus Australopithecus and genus Homo) one of the significant genetic changes that occurred is that two of the chromosomes of the ancestral ape-like primate became fused to form the human chromosome 2.

    In other words, there are multiple lines of evidence all supporting the assertion that chimps and humans diverged from a common primate ancestor somewhere around 6 million years ago.

  9. Furthermore, I think there is some confusion here. The authors of the report didn’t assert that chimps and humans hybridized. What they concluded (based on multiple lines of genetic evidence) is that the early diverging lines of primates that would eventually become chimps and primates that would eventually become humans interbred for quite a while.

    This is a well-known phenomenon among diverging lines of eukaryotes, especially animals. For example, mallard ducks (Anas platyrhynchos) and wood ducks (Anas rubripes) readily hybridize in zones of overlap (such as within walking distance of my house here in Ithaca), as do blue warblers (Vermivora pinus) and golden-winged warblers (Vermivora chrysoptera) in the Adirondacks where my family goes camping. In the latter case, there are multiple hybridization events, similar to what has been inferred for the divergence between the line that became chimps and the line that became humans.

    That is, in the early stages of the divergence between two incompletely isolated populations, hybridization is common. It is only after considerable divergence has occurred that complete reproductive isolation eventually takes place.

    And sometimes it doesn’t (or it breaks down) and what were two separate populations go back to being one species again. This has apparently happened between the coyoté (Canis latrans) and the red wolf (Canis rufus) in the southeastern United States.

    Also, this should answer the question of how it is that chimps and humans hybridized. The simple answer is: they didn’t, their ancestors (which were almost phenotypically indistinguishable) did.

  10. Mario Lopez wrote:

    “First, the chromosomes are off by a couple, which will likely produce a sterile hybrid (an evolutionary dead end).”

    This subject has been addressed before, in this blog and at mine. For more on the subject, I refer you to:
    http://evolutionlist.blogspot......eding.html

  11. If anyone wants a fun read on something related to this topic, get Michael Crichton’s “Next.” I read all 423 pages in two nights reading. Lost a lot of sleep because I couldn’t put it down. It is a novel that has a bibliography.

    It is all about genetics issues and the two most enjoyable characters in the book are a transgenic chimp/human named Dave and a transgenic parrot named Gerrard who can do math and repeat everything he ever heard. I got to believe Gerrard will win an academy award if they make a movie of the book.

    The main theme of the book is about who owns genes and how they can be used in research and medicine and the ethics of cloning and creating transgenic species.

  12. 12

    This is nuts. People are not chimps.
    Or chimp/human hybrids.

  13. bFast: “I, for one, have concluded from the evidence that there is a common ancestor between chimps and humans.”
    Have you indeed? I say, baloney on that conclusion! :-o

    All the evidence you may wish to point to must be speculated upon, extrapolated and conjectured into Darwinian theory before any such conclusion can be made.

    The same data can be interpreted quite differently into the ID paradigm of a common designer.

    We supposedly share 50% DNA with bananas. Does that mean we also share common ancestry with them? Or toads? Or mice? Or any organism you care to mention?

    Under this common ancestry line of reasoning we ought to consider the following:
    How about canning Darwins’ man descending from primates and rather saying that primates descend from us?

    Really! By what rule must it be the contrary? Absolutely not the laws of thermodynamics at any rate.
    So what is it?

    Why are we so convinced of our own “superiority” or being “higher”? How does descended from = higher?

    Under real Darwinism (ie Darwinism taken to it’s logical conclusions) there is no such thing as superiority, only different levels of complexity and intelligence etc. It’s all just an illusion of superiority since nature knows nothing of superior, inferior etc.

    Materialism has no grounds whatsoever for declaring intelligence or anything at all a basis for so-called “higher” and “lower” terms applied to life forms.

    If materialism is true then intelligence itself is meaningless – just like the whole universe.
    Upon what grounds then does the mere illusion of intelligence = higher or superior?

    Once you swallow the common ancestor line – at least to the degree of humans/chimps sharing one – you cannot escape the hook and sinker either.

  14. Just curious…How does interspecific hybridization occur between a Pan & Homo ?

    Well, first you put on some soft music. Then you dim the lights. Pour some wine, set out some chocolate, maybe a banana…

  15. Well, Pannenberg, they aren’t really saying that we are hybrids- they are saying that there is a similarity between chimps and humans in the X chomosome. The “theory” is that people mated with a ape like ansester of both chimps and humans. But.. we know that evolution requires mutation as a rule anyway. So, why then could the x chromosome not simply be the result of a common ansester that had the mutation happen prior to any interbreeding?

    The point is that they don’t know. They are just comming up with somthingnew or controversial to get attention and more grant money. Same ol’, same ol’.

  16. PannenbergOmega wrote:

    “This is nuts. People are not chimps.
    Or chimp/human hybrids.”

    As I have already pointed out, the authors of the article we are discussing suggested nothing of the kind. Rather, they suggested (on the basis of multiple lines of genetic evidence) that the of chimps and the of humans apparently hybridized several times. This is not an uncommon event during the early stages of cladogenic divergence. Among animals in particular, the early stages of cladogenic divergence are usually mediated primarily by changes in behavior, rather than large-scale changes in the genome. Only after two diverging lines have remained separate for a considerable length of time do sufficient genetic differences accumulate to render hybridization impossible.

    The situation is very different in plants, which hybridize easily (mostly because they are relatively tolerant of changes in chromosome number). Since Darwin published the Origin of Species botanists have observed the origin of dozens of new species of plants, mostly through two genetic processes: autopolyploidy and allopolyploidy, both of which are facilitated by the tolerance I mentioned earlier.

    Fungi hybridize even easier than plants in many cases, and for probably very similar reasons: neither plants nor fungi can move around very easily, and so must retain the ability to mate with whomever is nearby.

    Bacteria don’t even have what would qualify as “species” among eukaryotes. Not only do they “interbreed” readily by exchanging genetic material, they can also exchange genetic material with viruses, and even scarf up free DNA from their environment.

    So, the whole question of the “origin of species” is mostly a question restricted to animals (i.e. members of the kingdom Animalia), and in many, many cases there is strong genetic evidence that the process of cladogenesis (i.e the splitting of one panmictic population into two or more) has happened and is happening among animals as well.

    Once again, read about the hybridization between mallard ducks and wood ducks, blue warblers and golden-winged warblers, and between coyotés and red wolves, and ask yourself if there is any empirically verifiable (i.e. not metaphysical or religious) reason why the same processes can’t have occurred between the ancestors of chimps and humans?

  17. Allen MacNeill wrote:

    “…that the of chimps and the of humans apparently hybridized several times.”

    Somehow a crucial word was dropped from this sentence. It should have read:

    “…that the ancestors of chimps and the of humans apparently hybridized several times.”

  18. Borne asked:

    “We supposedly share 50% DNA with bananas. Does that mean we also share common ancestry with them? Or toads? Or mice? Or any organism you care to mention?”

    The answer is YES. All eukaryotes share a surprising amount of genetic and phenotypic characteristics, all of which point to a common ancestor that lived somewhere around a billion years ago. Please note that the phrase “common ancestor” is not intended to refer to a single individual, but rather to a population of individuals that exchange genetic material with each other.

    The exchange of genetic material is the crucial point, here. Bacteria do it so often and so easily that there aren’t really “species” of bacteria the way we think of them among eukaryotes (especially animals). This is directly relevant to your question, because a billion years ago, virtually all living organisms were “bacteria” (or, to be more precise, prokaryotes). This means that they were just as likely to have exchanged genetic material as bacteria are today, and so yes, there is very strong genetic evidence that all living eukaryotes share a common ancestor with a group of unicellular symbiotic bacteria that lived about a billion years ago.

  19. Borne wrote:

    “How about canning Darwins’ man descending from primates and rather saying that primates descend from us?”

    This comment demonstrates a basic misunderstanding about biological classification. “Man” didn’t “descend from primates”; rather, humans ARE primates, a fact that even Linnaeus recognized (despite being a young Earth creationist). This means that the converse is equally mistaken; primates can’t “descend from man” anymore than Fords can “descend” from automobiles. Fords automobiles, just as chimps and humans are both classified as primates (i.e. members of the order Primates, within the class Mammalia, phylum Chordata, kingdom Animalia, domain Eukarya).

  20. Again, a crucial word was dropped:

    “Fords are automobiles…”

  21. 21

    Thank you Frost and Borne for clearing that up for me.

    http://www.randomhouse.com/cat.....0307396266

  22. It may quite be possible that an intelligent agent used the chimpanzee DNA as a base for his program upgrade to make us, the result of which a mind can now add concept onto matter in the form of a code or machine.

    What better way to show God’s connectedness to us, and proof of His presence in the past, then to say that all the machines and codes in all of the known universe were created by man with the exception of His created biological organisms and their genetic code and machinery. We possess His image, why not proclaim it as our established cultural TRUTH?

    Let the Darwinist tell us how a machine and a code could come into existence without a mind. If science is what we can observe, test and demonstrate, let them show us a code or machine that comes from stochastic chemical processes. Let them show us how a code or machine can come into existence without using intelligent causes. They cannot, it should be Law.

    Why does the Darwinist confuse the populace by telling us chimps can use tools?
    I think we should concentrate on the central difference rather than the cosmetic commonalities, which is that only WE can add concept onto matter in the form of a machine or code. I want to see a chimp or other simian add concept onto matter that is a code or machine. Make a bow and arrow or similar. They cannot. This is human exceptionalism, the word ‘tools’ used to describe what chimps are doing is misleading, and ABSOLUTE propaganda. The monkey will not understand grammar either (nor design for us a code) as pointed out by Denise O’Leary. Monkey don’t know John killed Betty from Betty killed John.

    I think it will be shown that humans and chimps (along with the other primates) did not in fact diverge through a hybridization event. I have to be open to the possibility that an intelligent agent interrupted/manipulated the chimp DNA code and possibly the original EGG cell as well. I think the fused chromosomes could lead to more details as to which theory is true. Are fused chromosomes unique to humans? Is this consistent with our human exceptionalism?

    If you do not believe in human exceptionalism, then please tell me why I can see machines in nature, and chemical codes represented in, and changing into other, complex shapes and know that they are such? The genetic code is holistic just like any other code that man can create, such as these very words you are reading, or the machine code that is the base of our computers. How do you not see the connection to intelligent design? How are you more likely to believe that the Earth is analogous to the greenhouse, but are not willing to make the direct inference that intelligent causes play a role in determining the origin of machines and codes every single time with no exception?

    DARWINIST*** Show me a code or machine that was not intelligently designed and I will believe in methodological naturalism as to the origin of the complexity seen in the cellular machinery and code found in nature.

  23. Borne:

    All the evidence you may wish to point to must be speculated upon, extrapolated and conjectured into Darwinian theory before any such conclusion can be made.

    The best single case I have seen to accept the common descent of chimps and humans is the phenomenon of specific point mutations which cause disease that both chimps and humans share. The most natural explanation I can find is that the point mutations happened in the common ancestor. The other options are:
    > They happened more than twice, however there are hundreds.
    > The designer intentionally inserted the disease-causing mutations. A yucky thought.

    The same data can be interpreted quite differently into the ID paradigm of a common designer.

    Please do interpret.

    Mario A. Lopez:

    First, the chromosomes are off by a couple, which will likely produce a sterile hybrid (an evolutionary dead end).

    My understanding is that the common mouse has between 20 and 40 chromosomes, depending on which one you catch, and they all pretty much interbreed. It would appear that the chromosomal barrier is not by any means infinite.

  24. 24

    bFast, didn’t you write once that you thought there was evidence of recent engineering in the creation of man?

    What do you think of Behe’s The Edge of Evolution?

  25. The best single case I have seen to accept the common descent of chimps and humans is the phenomenon of specific point mutations which cause disease that both chimps and humans share. The most natural explanation I can find is that the point mutations happened in the common ancestor. The other options are:
    > They happened more than twice, however there are hundreds.
    > The designer intentionally inserted the disease-causing mutations. A yucky thought.

    Which diseases are you talking about? Many single point mutation diseases occur spontaneously in individuals. If a particular mutation can occur independently in two humans (rather than being inherited from a common ancestor) then why should it surprise us that apes are subject to the same mutation? Or do you have in mind a particular disease which is only inherited and never arises spontaneously?

  26. Allen_MacNeill (8,9),

    I am currently operating off of the abstract, and will correct that by reading the article, tomorrow if things work out. However, in the abstract, after the authors argue that the chimpanzee-human split happened some 6.3 million years ago, they state that “chromosome X shows an extremely young genetic divergence time, close to the genome minimum along nearly its entire length.” Their implication seems to be that the X chromosomes, in contrast to the others, are markedly similar. If hybridization happened 3.15 million years ago, the X chromosomes would, by standard theory, have approximately 50% of the changes that other chromosomes do. Since the authors cite figures from 84% to 147%, I doubt that 50% would be that impressive. Let’s say that the correct figure for the X chromosome was 5% of the difference of the rest of the chromosomes. That suggests that any hybridization that could account for the X chromosome near-identity would have had to occur at 315,000 years ago. We are now talking 95% human and 5% common ancestor mating with 95% chimpanzee and 5% common ancestor.

    So your statement
    The authors of the report didn’t assert that chimps and humans hybridized. What they concluded (based on multiple lines of genetic evidence) is that the early diverging lines of primates that would eventually become chimps and primates that would eventually become humans interbred for quite a while.
    is incorrect. it is not the early but the late lines that interbred according to this scenario. That is, almost humans and almost chimpanzees would have to interbreed.

    That means that your statement
    Also, this should answer the question of how it is that chimps and humans hybridized. The simple answer is: they didn’t, their ancestors (which were almost phenotypically indistinguishable) did.
    is also in all probability incorrect. Unless one wants to say that 95% of the genetic change had to happen before humans and chimpanzees were easily distingushable, in order to explain the X chromosome similarities by interbreeding, one has to postulate fairly distinct phenotypes.

    I am aware of the possibilities of crossbreeding also, although I do not mind the lecture on ducks and coyotes, as others may not have heard it. I wasn’t even challenging whether humans and chimpanzees could be fertile together (I understand that Stalin tried it with gorillas and humans and it didn’t work, so I am doubtful, but it isn’t against my religion to believe that it might work, although it is against my religion to try it :) ), but I was simply commenting that using it as the explanation for the “extremely young genetic divergence time” of the X chromosome had serious scientific difficulties.

    When I said
    If there was hybridization, why was the X chromosome the only chromosome that got shared?
    and you answered,
    It wasn’t; it was the only one “studied” in this investigation.
    that answer was also incorrect. Note that multiple chromosomes were studied. Otherwise, the near-identicality of the X chromosomes would have been simply assumed to be the norm. One cannot note how much less divergent the X chromosomes of the two lines are until one has a standard by which to judge them. Maybe you can back up and try another explanation of why the X chromosome alone was shared during the last hybridization event, and why every individual switched over to the new X chromosome.

    It looks like you may have mistaken my criticism of the explanation given in the paper for the X chromosomes being nearly identical, with a criticism of the common descent of chimps and humans. I do have such criticisms, but for purposes of discussion was not making them. I was merely noting that the proposed mechanism did not seem to fit the facts.

  27. Allen

    I’m curious about the difference in chromosome number between humans and other primates. How is it determined that two primate chromosomes fused in the human lineage rather than one primate chromosome split to form the other primates?

    I’m not sure I buy your story about plants hybridizing so easily. Pollen travels quite a ways both airborne and via insects and I don’t know of much in the way of hybrids from different species emerging from it. Flowering plants might simply be more promiscuous as they passively get exposed to pollen from many other different species (which doesn’t result in hybrids) while at the same time they get exposed to many close variants of their own species which does result in hybrids. Animals aren’t typically so unselective about where the male germ cells come from. Polyploidy doesn’t seem like a very good example of Darwinian speciation either as it’s a saltation not a gradual divergence and there’s no new genetic material but rather just a wholesale duplication of chromosomes wherein the difference in chromosome number lowers (but doesn’t eliminate) fertility between polyploid variants.

  28. So one group of august Darwinists thinks there was hybridization and another thinks not. What a dustup! But the good news here is there can be two widely divergent interpretations of the same data—and both can be taken seriously by the science establishment! All that’s needed, apparently, is a Framework (not to be confused with an explanatory filter), a knack for the Unblushing Inference, and a Titillating Premise. Two “non-overlapping magisteria”? Not at all. These days the scientist can be just as liberated from the limitations of solid reality as any preacher or poet.

  29. Allen_MacNeill:
    1. “The answer is YES. All eukaryotes share a surprising amount of genetic and phenotypic characteristics…”
    Well that is the Darwinian version. Sorry I’m not buying your conclusions. Sharing genetic characteristics does not = Darwinism unless you already have a pre-commitment to that hypothesis.

    Calling in your mentioned evidence for bacteria to man evo requires a huge amount of faith in the Darwinian scenario. Something that has not been and cannot be demonstrated empirically.

    It all sounds so plausible when one listens to the 1000′s of just-so stories. Stories ubiquitously interspersed with complex sounding talk of genes, mutations and the almighty power of selection.

    Darwinists however, never seem to noticed that the Darwinian scenarios end up looking more and more like supernatural creation but with no god.

    “And as Darwinists and neo-Darwinists have become ever more adept at finding possible selective advantages for any trait one cares to mention, explanation in terms of the all-powerful force of natural selection has come more and more to resemble explanation in terms of the conscious design of the omnipotent Creator.”

    (Ho M-W. & Saunders P.T., eds., “Beyond Neo-Darwinism: An Introduction to the New Evolutionary Paradigm,” Academic Press: London, 1984, p.x)

    “The ‘modern evolutionary synthesis’ convinced most biologists that natural selection was the only directive influence on adaptive evolution. Today,
    however, dissatisfaction with the synthesis is widespread, and creationists
    and antidarwinians are multiplying. The central problem with the synthesis is its failure to show (or to provide distinct signs) that natural selection of random mutations could account for observed levels of adaptation.”

    (Leigh E.G., Jr, “The modern synthesis, Ronald Fisher and creationism,” Trends in
    Ecology and Evolution, vol. 14, no. 12, p..495-498, December 1999, p.495)

    IOW, When you look at the details involved in transforming bacteria into man and near simultaneously into the millions of other species – without any guidance, target, purpose or adequate mechanism, Darwinism looks totally ludicrous.

    2. “rather, humans ARE primates,”
    Thanks for your correction. You’re right, and I should have written “apes” rather than primates. I’m not a biologist. I’m an informatics specialist.

  30. bFast: ” They happened more than twice, however there are hundreds.

    Please do interpret.”
    There are a couple of problems I see in this for your interpretation.
    1. If you are ready to accept to macro-evo of ape to man you may as well buy into the whole of Darwinism because we’re talking major differences and novel creations.
    2. If you must base such a conclusion on shared diseases caused by the apparently exact same mutations you will have to look at all species sharing the same. I suggest you look first at mice/human disease. There’s tons of data on those two.
    So we descend from mice too?
    Sooner or later it’ll catch up with ya. ;-) You’ll either turn full Darwinian or make a better decision such as looking for better explanations. Such as what causes such mutations in the first place? And, whether the same cause could have been responsible for the many cases you might mention in various species in the same time period – use your imagination ;-) .

    3. Suppose you were to examine the same data before Darwin ever existed. What kind of reasoning would you use then, w/o the macro-evo paradigm in mind? And what possible alternative conclusions could you make?

  31. DaveScot asked:

    “How is it determined that two primate chromosomes fused in the human lineage rather than one primate chromosome split to form the other primates?”

    All animal chromosomes have special sequences called telomeres at each end. These telomeres are part of the process that regulates how often cells can divide. Basically, each time a cell divides by mitosis, it loses a telomere at the end of each chromosome. When they’re all gone, the cell can’t divide any more. This prevents cells from becoming cancerous (although some cancers produce an enzyme called telomerase that puts back the telomeres).

    Bottom line is: you can tell the end of a chromosome because it has telomeres.

    Now, the situation with human chromosome #2 is that it has a set of telomeres in the middle, as well as at the ends. Also, the set in the middle consists of two sets of telomeres arranged in reverse order.

    Upon closer examination, it has also been found that the genes in the two segments of human chromosome #2 (separated by the embedded telomeres) have approximatey the same genes in approximately the same order as the two unfused chromosomes found in chimps and other primates.

    There is more evidence having to do with the placement of centromeres in the chromosomes. Rather than go through a long explanation, I refer you to:

    http://www.evolutionpages.com/chromosome_2.htm

    Ergo, there are two logical interpretations of these multiple lines of empirical evidence:

    1) human chromosome #2 consists of two chromosomes found in other primates, fused together at the location of the back-to-back embedded telomeres

    2) an “intelligent designer” inserted the back-to-back embedded telomeres in the middle of human chromosome #2, arranged all the genes to look just like they should if they had come from the two unfused non-human primate chromosomes, and then inactivated the back-to-back embedded telomeres (i.e. they have no detectable function)

    Not only do I prefer the first interpretation on purely scientific grounds (i.e. it comports with all of the other evidence pointing to a common human-chimp ancestor, plus being the “simplest” explanation a la Occam’s razor), it also does not require the intervention of an “intelligent designer” who is also a deliberate prevaricator.

  32. RRE wrote:

    “…only WE can add concept onto matter in the form of a machine or code.”

    And so, before people could do this (i.e. before the middle of the 19th century or thereabouts), they were not human, nor were they different from chimps and other animals in any other way, right?

    For that matter, I only know a very few people who can perform this operation — that is, convert a concept into a line of code. Does that mean that they, too, aren’t human?

    Were you human before you learned how to code? Will you remain so when old age reduces or eliminates your ability to do so?

    Tool use is clearly not the sole criterion by which humanity is defined. My little son (now just one year old) was fully human when all he could do was lie in the crib and look cute.

    IOW, what differentiates humans from other animals is no single qualitative difference, but rather a relatively large number of quantitative differences, which when added together define what we mean by “human.”

  33. RRE asked:

    “Are fused chromosomes unique to humans? Is this consistent with our human exceptionalism?”

    Not at all. Both fused and fissioned chromosomes are common throughout the four kingdoms of eukaryotes. Indeed, the question as to why certain species have many chromosomes (such as frogs and ferns) while others have many fewer (such as humans) is a very interesting one from the standpoint of evolutionary biology. Answering it requires that one look long and hard at the patterns of chromosome number, and try to correlate those with environmental stresses, evolutionary pressures, and historical contingency.

    But one could also just say “that’s the way the Intelligent Designer wanted it” and then go do something else that also wasn’t science…

  34. RRE wrote:

    “DARWINIST*** Show me a code or machine that was not intelligently designed and I will believe in methodological naturalism as to the origin of the complexity seen in the cellular machinery and code found in nature.”

    To which I reply (shouting in response to the shouting):

    ID SUPPORTER***: Show me a way to empirically and unambiguously determine whether a code or physiological mechanism in a living organism was designed by an Intelligent Designer and I will believe in intelligent design as the origin of the complexity seen in the cellular machinery and code found in nature.

    And please make certain that the empirical evidence you provide unambiguously differentiates between the two processes in a way that can be verified using standard statistical analysis. Then publish your results and wait for the Nobel committee to give you a call (it’s virtually guaranteed).

  35. DaveScot asked about the details of speciation events and their relationship to chromosomal changes and other genetic events, especially in plants. Rather than respond to each point, I refer you to:

    http://evolutionlist.blogspot......cious.html

  36. 36

    If Darwinists want sympathy, you’ve come to the wrong place.

    Also, your holiet than thou attitude is getting a bit old. After all it was your Darwinian philosophy that helped produce Hitler.

  37. Borne asked:

    “So we descend from mice too?”

    No; once again, the answer (based on multiple lines of empirical evidence) is that mice and humans descend from a common ancestor (similar to a tree shrew) that lived in the Paleocene (or perhaps somewhat earlier in the Cretaceous.

    The phylogeny of mammals has been worked out in detail, based on mutiple lines of anatomical, genetic, and ecological evidence. I recommend checking out the following as an introduction to this fascinating topic:

    http://en.wikipedia.org/wiki/Evolution_of_mammals

    In my opinion (as a biologist who specializes in mammals, especially primates), this is one of the best articles on evolution in Wikipedia. Although there are a few inaccuracies, overall it’s amazingly concise and comprehensive.

  38. Hey moderators,
    I think it’s really time to clean out the sock drawer.

  39. Hi Allen,
    Coming on the heels of your comment my suggestion might look like it refers to you. It doesn’t, not at all.

  40. Borne wrote:

    “Calling in your mentioned evidence for bacteria to man evo requires a huge amount of faith in the Darwinian scenario.”

    On the contrary, the phylogenies you describe have only come about through the opposite of faith. Dogged hard work mostly, combined with a fierce skepticism about proposed phylogenies, especially in the absence of overwhelming empirical data. Phylogeneticists nearly get into fist fights at conferences over proposed phylogenies. The reason? Not enough evidence, or evidence that is ambiguous. And so we fight it out, subjecting each other’s proposals to the most withering storms of criticism, both publicly and (especially) privately.

    As T. H. Huxley famously said:

    “[Nature] warns me to be careful how I adopt a view which jumps with my preconceptions, and to require stronger evidence for such belief than for one to which I was previously hostile.

    My business is to teach my aspirations to conform themselves to fact, not to try and make facts harmonise with my aspirations.”

    Now that’s science!

  41. Thank you, Charlie, I appreciate your disclaimer. I’ve occasionally been accused of being a meat puppet, but never a sock puppet ;-) That’s why I always and only use my real name, both here and elsewhere, online and in print. I take responsibility for everything I write, and hide behind nothing except my reputation as a scholar and a scientist.

  42. Allen

    All you had to say was there are two telomeres in the middle of the chromosome. Theoretically the telomeres could have been inserted by random mutation into an unfused chromosome which later split in two at the convenient join. But that doesn’t seem as likely as a fusion so I’ll call myself satisfied with a fusion as the best explanation.

  43. Hmm, looks like I’m not up on the more recent definitions of “meat puppet.” I used the term to mean “an animal whose behavior can be inferred to be directed by conscious thought, rather than pure instinct”. That is, our bodies can be thought of as “meat puppets” of our minds.

    Ah, well, looks like I need to spend even more time at Wikipedia…

  44. DaveScot wrote:

    “Theoretically the telomeres could have been inserted by random mutation into an unfused chromosome which later split in two at the convenient join.”

    That would only explain the anomalous presence of two back-to-back telomeres in the middle of human chromosome #2. It would not explain why the genes in the two fused segments line up “in register” with very similar genes in the unfused chromosomes of other primates, nor why the centromere of human chromosome #2 lines up with the centromere in non-human primate chromosome 2p, nor why the remnants of the other (now non-functional centromere is located in the other segment of human chromosome #2. All of these lines of evidence point to the same conclusion: that human chromosome #2 was formed by the fusion of two chromosomes found separately in all other primates.

    An interesting question is, did this fusion event have anything directly to do with the genetic and phenotypic divergence between the two lines of primates that eventually became chimps and humans? the answer is not immediately obvious, as simply fusing together two chromosomes doesn’t change the genetic information they carry nor how it is expressed, it only changes how it’s segregated during meiosis.

    It does, however, strongly suggest that the two evolving lines of primates were sufficiently isolated from each other for long enough for such genetic differences to accumulate. So, what caused this separation, how long did it last, and what happened during it? All good questions, and all potentially answerable by evolutionary biologists, especially paleontologists. I’m looking forward to reading about what they discover as a result of their field and laboratory investigations.

  45. Is this the Mario Lopez from Saved by the Bell?

  46. Allen_MacNeill at 34 You asked:

    ID SUPPORTER***: Show me a way to empirically and unambiguously determine whether a code or physiological mechanism in a living organism was designed by an Intelligent Designer and I will believe in intelligent design as the origin of the complexity seen in the cellular machinery and code found in nature.

    See Craig Venter’s customized bacteria including a synthetic DNA watermark.


    “JCVI Scientists Publish First Bacterial Genome Transplantation Changing One Species to Another”

    ROCKVILLE, MD — June 28, 2007 — Researchers at the J. Craig Venter Institute (JCVI) today announced the results of work on genome transplantation methods allowing them to transform one type of bacteria into another type dictated by the transplanted chromosome. The work, published online in the journal Science, by JCVI’s Carole Lartigue, Ph.D. and colleagues, outlines the methods and techniques used to change one bacterial species, Mycoplasma capricolum into another, Mycoplasma mycoides Large Colony (LC), by replacing one organism’s genome with the other one’s genome.

    This appears to be a functioning bacterium or “a living organism” per your request.

    Then see: j at #40 of Ian Musgrave’s “Intelligent Design Challenge.”
    “By the way, it seems that the sequences for the watermarks that you just gave include extra leading and trailing characters. Here are the codings for the actual watermarks themselves, with quantity of characters in brackets:

    TGTCGTGCAATTGGAGTAGAGAACACAGAACGA [33]

    (CRAIGVENTER)

    GTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAG [45]

    (VENTERINSTITVTE)” . . .”
    “So there are only 33 + 45 + 24 + 39 + 39 = 180 characters = 360 bits.”

    This clearly shows a “watermark” in the genome of that organism that was caused by an intelligent designer, namely Craig Venter et al.

    QED
    Will you now take the step of: “I will believe in intelligent design “?

  47. The most important thing that we as ID advocates should take from theories like the one above is that this is the current state of Darwinism.

    Darwinian evolution has failed so many times to predict various mutations, structures in the fossil record, diversity of life, duration of diversity and time between change- etc…

    that now we have new “just so stories” that cant be proven, that are merely evolution of the gaps theories- that in them of themselves are improbable regardless of whether they are true or not.

    Can’t explain it well with mutation… well make something else up. This is the character of modern origins science.

    as Behe writes in Edge of Evolution pp. 233 – 234, in regards to the claim that Intelligent Design does not make predictions…

    “An eminent leader of the neo-Darwinian synthesis declared forthrightly a half century ago that “the search for homologous genes is quite futile.” Later work showed that “the view was entirely incorrect.”

    Homology is not something that you would expect from diversity and complexity that originated from random mutations. Apparently there is a very specific and common design plane among species and life in general yet no one is willing to attribute this to the narrow line of reasoning and design that we only see in intelligent minds.

    This is not to say that the theory proposed above is impossible or surely incorrect but the point to be made here is that science is again trying to use the old paradigm of Darwinian unintelligent design which has constantly had to change its game at ever turn. Moreover, Behe thinks that Darwinism is only responsible for about 2% of evolution.

    If a trained biologist of Behe’s caliber is willing to make such a claim and back it up with math and explanation, then you can be sure that where there’s smoke there’s fire.

    As Darwinian science continues to be the only kind of origins science taught, the “just so stories” or “theories” that mainstream science advances will very likely be just as unprosperous as the old paradigm that lead science down the blind alley to begin with.

    From interbreeding, to co-option, to lateral gene transfer- all are very much speculative in how specified complex life came into being and diversified into what the fossil record shows and what we see today.

    Meanwhile, no matter how hard scientists try, the end result is a bunch of improbable, incomplete, speculative explanations that rule out intelligence apriori. There is however another path (and only one) that science could venture down-
    “That life and the cosmos is organized via “intelligence” through the “purpose of design.” Where this line of reasoning takes origins science is at this stage hard to fathom but it certainly wont be anymore speculative than the current approach. Thus, history has shown again that there is probably a lot more to origins then unintelligent natural processes. Maybe it’s time that science should take into consideration and go to work with that familiar solitary yet forbidden mechanism that some call “purpose” and give the darwinian stuff its well deserved break.

  48. DaveScott @ 27 & Allen_MacNeill

    And the Miller Told His Tale: Ken Miller’s Cold (Chromosomal) Fusion

    Here is Ken Miller video asserting 2 fewer chromosomes as evidence for evolution not ID.

    “Chromosome #2 was formed by the head to head fusion of two chimp chromosomes 13.”

    Some key questions I have is
    1) HOW did this fusion event happen?

    2) At what stage in reproduction?

    3) Do you have One fusion event in one person?

    4) If so HOW is that reproduced into the population?

    5) Can this “human” with the fused chromosome reproduce with the primate with two separate chromosomes?

    6) If not, then does this require two chromosome fusion events?

    PS Miller tries to give a strawman saying an intelligent agent causing this fusion event would be deceptive.

    If an intelligent designer can intervene at the beginning, there can equally be an intervention to split primate to human.

    I believe that Miller is raising a strawman argument of his own making appealing to a theological narrow misinterpretation of Creation Science which he attributes to ID.

    My challenge to Miller is how he can claim to believe in “theistic evolution” and then systematically and vigorously fight against any hint of an intervention of an intelligent agent in the process of formation of life and subsequent evolution. That sounds morally deceptive to me.

  49. 49

    Ya know, I wish his holiness Pope Benedict XVI would disavow Miller’s work. I doubt that he would find Miller’s views on God and creation Christian.

    PS: I can’t wait for EXPELLED!!

  50. 50

    Don’t want to speak for the Pope though. From what I read though, his thought seems light years away from Miller.

  51. Allen_MacNeill:

    As T. H. Huxley famously said:

    “[Nature] warns me to be careful how I adopt a view which jumps with my preconceptions, and to require stronger evidence for such belief than for one to which I was previously hostile.

    My business is to teach my aspirations to conform themselves to fact, not to try and make facts harmonise with my aspirations.”

    Now that’s science!

    If you have a moment, I would be interested to know how you apply this principle in regard to the question I put to you here.

    Your insistent denial that there could be relevant empirical evidence (despite contrary statements from some who have studied it) has the appearance of giving artificial protection to “a view which jumps with my preconceptions” rather than “requir[ing] stronger evidence for such belief than for one to which I was previously hostile”.

    How should that empirical evidence against relate to the business of teaching “aspirations to conform themselves to fact”?

    [p.s. On a distinct note, since you did not contribute further in that thread, I hope you did not miss my sincere regard (in a post above that one) for your contributions and your example.]

  52. Allen_MacNeill:

    I have two questions regarding the evolution of the human brain. First, can you provide a rough, back-of-the-envelope calculation of how many mutations occurring in the human line since the human-chimp split would have had an effect on the development and/or functioning of the brain?

    Second, is there any prospect of scientists in the future being able to situate these changes in their correct chronological sequence?

    Best wishes,

    Vincent Torley

  53. “…only WE can add concept onto matter in the form of a machine or code.” Show me wrong please. Only humans.
    Humanity has always been the only organism that can add concept onto matter in the form of a code or machine. That is our uniqueness. That is the image of God. All machines are made by man, with the exception of biological organisms. Biological organisms are the only machines found in the natural world (known universe) that we did not make from scratch. The genetic code, which is a holistic sequence of information read in codons (bits of 3) is the only code we did not intelligently designed. Writing your thoughts onto this website is you using a code which you have added onto matter using English. You are using a machine, the computer, to add the matter in time to produce your thoughts. Any writing is adding concept onto matter in the form of a code. Codes are tied to languages.
    The bow is a simple machine which is a system that performs a function using at least one moveable part and one non-movable part which could be used to perform its function independent of the original agent. Only we can make one of those systems as well. Where is your monkey making machines or codes? Even a bird can intelligently design a complex round cup made of twigs, but no other species can design a machine or code.
    Allen_MacNeill said: “And so, before people could do this (i.e. before the middle of the 19th century or thereabouts), they were not human, nor were they different from chimps and other animals in any other way, right?”
    Writing is adding concept onto matter in the form of a machine or code. A monkey cannot even make an arrowhead. The bow was older than 19th century. The monkey won’t even place a rock as a pivot point against a stick to lift a big rock. Do you realize that? They can’t even make a WEDGE!
    Wiki says: “A wedge is a portable inclined plane, used either to separate two objects, or portions of objects, lift an object, or hold an object in place, by the application of force to the wide end, which the wedge converts to force perpendicular to the inclined surfaces. The mechanical advantage of a wedge depends on the ratio of its length to its thickness. Where a short wedge with a wide angle does the job faster, it requires more force than a long wedge with a smaller angle.”
    Wiki says: “The origin of the wedge is unknown, because it has been in use as early as the Stone Age. Circa 3000 BC, in Ancient Egypt quarrys, bronze wedges were used to break away blocks of rock used for construction. Wood wedges, that swelled after being wet, were also used. Some Native American tribes used antler wedges as a means of splitting and working wood to make canoes, houses, and other wood objects!”
    http://en.wikipedia.org/wiki/W....._device%29
    The origin of the wedge is unknown…perhaps because humans have always been able to make a wedge because humans were intelligently designed to develop machines, primates were not.
    Allen_MacNeill said: “For that matter, I only know a very few people who can perform this operation — that is, convert a concept into a line of code. Does that mean that they, too, aren’t human? “
    No, they are human too. Writing is a code that all other primates and animals cannot do. It’s based on the English language convention. Humans are the only species that can add concept onto matter in the form of a code or machine.
    Allen_MacNeill said: “Were you human before you learned how to code? Will you remain so when old age reduces or eliminates your ability to do so?”
    Humans as a species, is the only species that can add concept onto matter in the form of a machine or code. No — a man with his mouth shut, vocal cords ripped out, arms and legs chopped off cannot add concept onto matter in the form of a code or machine, but he’s still human don’t worry.
    Allen_MacNeill said: “Tool use is clearly not the sole criterion by which humanity is defined. My little son (now just one year old) was fully human when all he could do was lie in the crib and look cute.“
    Okay, once the human species obtains adulthood developmental stage, they become the only species on the entire planet and whole known universe to be able to add concept onto matter in the form of a machine or code. “Tools” are a useless comparative; the bird can make a tool such as a nest. Please name another species that can produce codes or machines and I’ll convert to atheism and give God the finger.

    “IOW, what differentiates humans from other animals is no single qualitative difference, but rather a relatively large number of quantitative differences, which when added together define what we mean by “human.””
    Being able to develop machines and codes IS a single qualitative difference. It’s the single biggest!—we are the only species that can do it. No other species. Your monkey can’t make a bow. Think about, all he can do is grab a stick and use it to get food, but so what, he’s not adding concept onto any matter at all, to produce a machine or code. You try to deflect and say that it’s not an important enough difference, but it is the most unique qualitative difference that can be compared when comparing any species in the ENTIRE ANIMAL KINGDOM.

  54. 54

    Is it possible that the Creator programmed everything into the early universe? Everything that would occur in cosmic/terriestrial history, the development of life and speciation. Could it all have been imputed in the begenining?

  55. In response to PannenbergOmega 54, the biggest problem is the existence of symbolic codes and symbolic information that are fundamental to living organisms.

    The association between symbol sequences and their meanings is determined by a consistent convention.

    Because it is a convention, it is not required by any laws of physics or chemistry. You could not derive it from laws.

    On the other hand, to function the association must be implemented, applied and interpreted consistently. It cannot be the product of chance.

    The only known source for symbolic conventions is choice and directed effort by intelligent agents.

    For a designer to build that into the beginning, there would have to be some storage for symbolic data and instructions from the beginning. Law and chance cannot create it later on.

  56. Allen_MacNeill said: “But one could also just say “that’s the way the Intelligent Designer wanted it” and then go do something else that also wasn’t science…”
    That’s a false condition. “That’s the way the Intelligent Designer wanted it” is trying to understand the intent of the designer, you may not be able to so scientifically, so what you said really means nothing—and no one says that in the Intelligent Design community. You are trying to confuse people — finding out how something originated and how something works are two totally separate concepts that you must explore so as to relate to the difference.

    Allen_MacNeill said: “ID SUPPORTER***: Show me a way to empirically and unambiguously determine whether a code or physiological mechanism in a living organism was designed by an Intelligent Designer and I will believe in intelligent design as the origin of the complexity seen in the cellular machinery and code found in nature.”

    Saying that people were intelligently designed at humans’ origin is an inference to the best possibility based on our observed experiences, recognizing UNIQUE qualitative differences when it comes to the origin of machines and codes versus all other structures in nature. That’s a scientific statement that can be tested against reality and falsified. All machines and codes had intelligent agency as a cause when exploring their origin. Furthermore, the genetic code is the only code that we can find that Man did not intelligently design, which also happens to build up to produce and maintain the only machines that man did not intelligently design. So we can conclude that this ‘only code’ had to have been designed as well — Simply because we find no exceptions to the rule. So empiricism and experience prevail over metaphysical naturalistic mechanisms.

  57. 57

    Hmmm. Interesting.
    Maybe we don’t fully understand what the universe is right now. Maybe it is a cosmic information processing system and we are apart of the designers computer program.

  58. And studying the causes involved in the origin of something has nothing to do with studying how something works. So there is no magic science stopper when it comes to ID because ID proponents are Intelligent Designers themselves, and studying how the genetic code or how the human body (or another other body plan) works is well within their abilities and has nothing to do with origins. Intelligent causes are ALWAYS required when we look at the origin of any machine or code. If you exclude intelligent causes as to the origin of a machine or code, you are deceitful and not practicing science, but metaphysics, simply on the basis that you have not shown anyone how a code or machine could come about without intelligent causation. Please don’t be intellectually dishonest, and instead demonstrate in reality a machine or code that came into existence without intelligent causes.

    It is up to you to to show us your code or machine without intelligence. We can show you that intelligent causes CAN produce machines and codes. You must show a purely naturalistic way. I am waiting.

  59. PannenbergOmega said: “Hmmm. Interesting.
    Maybe we don’t fully understand what the universe is right now. Maybe it is a cosmic information processing system and we are apart of the designers computer program.”

    Maybe everything is controlled by an electro-static force and gravity is an infinitesimal factor in the universe. Maybe there is a lot of electrified gas floating around the universe, who knows right? Maybe things all ride on the electro-magnetic spectrum.

  60. I have had the chance to read the entire article now, and need to make a correction.

    My statement (26) about the investigators checking on all the chromosomes was correct, and Allan’s statement in that regard is still in error.

    However, the X chromosome was not nearly as similar in humans and chimps as I inferred from the abstract. They expected 0.918 to 0.943 of the mutations they got on the other chromosomes, and in point of fact got only 0.835 (+/- 0.016), which means that if one believes the model of hybridization, it would have happened when the two populations were about 10% along to their eventual destinations.

    Thus when I criticized Allan (9) and said that it was the late ancestors rather than the early ancestors that interbred, I was wrong and Allan was correct about what the article said. Sorry, Allan.

    Given that areas on individual chromosomes could vary from 84% to 147% of expected, this value of 10% is easily within the noise range, although it is unusual for a whole chromosome to be consistently that low.

    However, the easiest explanation for this data is simply that the “molecular clock” is not all that accurate. From an evolutionary perspective, the article gives further evidence of that. Even assuming a branching of orangutangs from the eventual hominid line at 20 Ma (million years), which is considered high, humans and chimps would have diverged at some 6.3 Ma which is considered low given the date of Sahelanthropus at some 7 Ma. If one takes the, according to them, more reasonable date for the orangutan-human split of 17 Ma, the human-chimp divergence would happen at 5.4 Ma. WHy not just say that the molecular clocks aren’t trustworthy and leave it at that?

    In fact, it is interesting that the authors stated (and got past peer review without having to back it up experimentally!) that perhaps Sahelanthropus was incorrectly dated. Apparently as long as it isn’t a creationist making those suggestions, it’s okay.

    The data presented are interesting. But the speculation is fascinating, more for what it tells about the authors and editors than for what it says about what actually happened.

  61. And sorry I misspelled your name this last time, Allen.

  62. Pannenberg writes,

    Is it possible that the Creator programmed everything into the early universe? Everything that would occur in cosmic/terriestrial history, the development of life and speciation. Could it all have been imputed in the begenining?

    That’s called deism, and it’s not very popular theologically anymore: God created the universe with all the proper initial conditions and then the universe has mechanically unfolded since then.

    One problem is that the issues of quantum indeterminacy and chaos theory mean, at least to the best of our human understanding, that the initial conditions don’t deterministically lead to a fixed end. Theologically you then have a number of possibilities:

    1. Quantum indeterminacy is real, even to God, and thus the universe has a degree of freedom to become what it will in ways that God cannot foresee and does not control, or

    2. Quantum indeterminacy, while real to us, is not real to God – He somehow knows the rules behind it. Therefore true deism is possible: the initial conditions, including those beyond our comprehension, are sufficient for the world to play out exactly as God intends, or

    3. Quantum indeterminacy is real, even to God, but God can intervene at the quantum level to tweak the course of events – not with an exact ability to know where the present will lead, but at least to send it off in the desired direction, or the last possibility (for this list),

    4. God continually is active at the quantum level, tweaking every moment in ways that do not contravene any natural laws above the quantum level, and thus continuously manifesting his Will and design for the world.

    Hope this gives you something to think about, Pannenberg.

  63. 63

    Hi Jack Krebs, thank you for taking the time to answer my question. It is appreciated.

    Personally, I find number 4 the most appealing possibility. Perhaps God controls the hidden variables of quantum mechanics.

    Yet would this make design detection impossible?

  64. Re: Jack Krebs list of possibilities. I would add a fifth, and with some experimental support.

    5. God continually (or regularly) is active at the quantum level, tweaking in ways that sometimes contravene natural laws as we understand them.

    Let me present a case in point. Now, I wish I had a sitation for every good quote that I hear on television, especially documentary shows. However, it is my understanding, as gathered from one of them shows, that in the gambling halls “winning streaks” and “loosing streaks” are a real statistical phenomenon. In other words, as I understand it, they happen often enough and strongly enough to challenge the expectations of the statisticians.

    I consider the HAR1F gene — my favorite. It has 18 specific point mutations in humans that are not in chimps. It is apparently necessesary that all 18 happened at once. This one event is a chance event that probably exceeds the UPB. As such, it reallistically “contravines natural law”. As such, it is detectable. It goes down as a nice little strong case in favor of ID.

  65. PannenbergOmega,

    Design detection is axiomatic. You couldn’t get any sane person to deny the obvious design of a book, or electronic circuitry.

    The typical debate is whether this applies to biological systems. However even there it would seem obvious to most:

    Biologists must constantly keep in mind that what they see was not designed, but rather evolved. -Francis Crick

    Design is so apparent in biological systems, that according to Crick, biologists need to “constantly” remind themselves that what they see isn’t designed.

    So the issue is debatably, not whether design is apparent, but whether it is merely illusory when considering biological systems.

  66. Pannenberg asked,

    “Is it possible that the Creator programmed everything into the early universe? Everything that would occur in cosmic/terriestrial history, the development of life and speciation. Could it all have been imputed in the begenining?

    This is not necessarily Deism as Jack Krebs said. Deism says that God kicked the thing off but that he no longer intervenes in his creation leaving it to the laws of nature to work everything out. There is a distinction and problem with this view. As you all have probably read/heard Heisenberg’s uncertainty principal says that on the small scale of matter, events become increasingly difficult to predict until events become virtually impossible to predict 100% accurately. If this is related to man’s supposed free will then you have a Deist problem of consciousness right off the bat. That is since there is no law controlling what man can or cant do in essence God is having a physical law like intervention all of the time in terms of uncertainty.

    To clear up the ambiguity here, if the laws of nature just ran us through like a movie or machine then there would be no uncertainty. When we watch a movie we expect to see what is expected to happen based upon the plot and the director/scriptwriter’s vision. In a universe like our with uncertainty there is no movie like Deism. So Deism is already limited to begin with based upon the fact that if there is a god he gave us a continuous free will like ability in consciousness.

    The second problem with Deism is that it is based on a kind of problematic view of God in general. That is, God kicked off the universe with its “laws” and that is it. But what is meant by “laws.” What if on of the laws is that every 500 years he commits a miracle? What is cancer is to be naturally cured by pure chance once in a while simply due to the way he designed quantum physics. And what if a person prayed to God and it just happened that he was the guy that caught the lucky preplanned cancer remission? Only God could be a Deist in cases such as these because man just could not know the difference between a subtle Theism and a luck based Deism.

    Deism makes no sense in a universe that has a quantum physical component or interpretation inherent in its nature.

  67. to bFast:

    Contravening natural law and contravening statistical expectations are two different things. If God could manipulate quantum probabilities, he could make things happen with a different probability than they might otherwise, but that would not contravene any natural law. My first thought is that your option 5 is not a separate category.

    (However, now that I think about it, this may be a matter of interpretation: some natural laws are in fact the resulting of probability averaging out. If I understand correctly, at the level of quantum electrodynamics, even the fact that light travels in a straight line is a statistical result that is the path-integral (a type of probablistic average) of all the possible paths between those two points.

    Pannenberg asks: “Yet would this make design detection impossible?”

    This is a key question. If God is continually active at the quantum level, manifesting his will in event that will forever look like true probablistic randomness to us, then he could influence the world in ways that were never immediately detectable: there would never be an event happen which would be so unlikely that it would appear to us as an observable intervention. To an omnipotent God existing in countless quantum events in every second all over the universe, extremely minute tweaks to the probabilities would be all that was ever needed.

    Such a God would be ever-present, existing comfortably in the natural world and in harmony with the natural laws, things and forces he had created. This position (with or without the quantum mechanical explanation) is what the very badly named position of “theistic evolution” believes.

    And last to bfast: You write,

    Let me present a case in point. Now, I wish I had a sitation for every good quote that I hear on television, especially documentary shows. However, it is my understanding, as gathered from one of them shows, that in the gambling halls “winning streaks” and “loosing streaks” are a real statistical phenomenon. In other words, as I understand it, they happen often enough and strongly enough to challenge the expectations of the statisticians.

    I don’t believe this is true. I think research into hot and cold streaks show that they do conform to statistical theory. Most people’s intuition about such issues is pretty poor, and so we often ascribe cause when in fact all we have is the statistical variation.

  68. 68

    Thanks Mr. Krebs, bFast, Apollos and Frost.

    Hi bFast, at #64. I think I see what you are saying. There is a paper by Granville Sewell where he describes the idea that sometime about a million years ago an okapi mother gave birth to a giraffe. The result of a carefully designed mutation. You are suggesting that the HAR1F gene suggests something similiar?

    Hi Apollos, at # 65. I know design is obvious. For some reason I thought that if the designer worked solely through natural processes, then traces of the designer might not be evident. I probably just don’t understand design detection.

    Hi Frost, at #66. I didn’t think I was describing Deism either.

  69. 69

    More something along the lines of providential predestination of creation.

  70. 70

    “Such a God would be ever-present, existing comfortably in the natural world and in harmony with the natural laws, things and forces he had created. This position (with or without the quantum mechanical explanation) is what the very badly named position of “theistic evolution” believes.”

    Are you saying that God is guiding cosmic development from moment to moment? I find this quite palatable.

    This may be theistic evolution but it is a far cry from the blind, purposeless, Darwinian evolutionary process.

  71. Pannenberg writes,

    There is a paper by Granville Sewell where he describes the idea that sometime about a million years ago an okapi mother gave birth to a giraffe. The result of a carefully designed mutation.

    This is an unnecessary hypothesis, and is either unrealistic biologically, or shows a major confusion about the difference between the names of things and the things themselves.

    There is no reason why God would have to, or did, produce some major mutational change: He could just have easily made a number of slight modifications over many generations. There is also no reason why his presence in the world has to entail specific events that look improbable. If one believes in a God capable of making changes in the world via events that appear extremely improbable for us, he is surely capable of making changes in the world through acts that don’t appear improbable at all. The slow divergence of species that is described by evolutionary science, whether it be okapi and giraffe or pre-homind and human, could just as easily be guided by God as some hypothetical major saltational event such as an okapi giving birth to a giraffe.

    Pannenberg writes,

    I know design is obvious. For some reason I thought that if the designer worked solely through natural processes, then traces of the designer might not be evident. I probably just don’t understand design detection.

    There is an important distinction that Pannenberg is making here. To the Christian, through faith design is obvious at all levels: from the very structure and existence of the universe down to the individual events that make up one’s daily life. However, to the empirical observer, working through the methods of science, design is undetectable.

    Think about your daily life: As a Christian you undoubtedly believe that God is guiding your daily life. However, if you watch what happens to you every day you don’t see moments when all of a sudden natural processes cease to work – you can’t detect the moments when God manifests his guidance of your life, but you have faith that it is happening. Same with evolution. There is nothing antithetical to Christian faith in believing that small changes, entirely within the realm of statistical probability, are the means by which evolution happens.

    Added after Pannenberg’s last comment:

    He writes,

    Are you saying that God is guiding cosmic development from moment to moment? I find this quite palatable.

    Exactly.

    This may be theistic evolution but it is a far cry from the blind, purposeless, Darwinian evolutionary process.

    The distinction here is between philosophy and science. To the non-Christian, including the materialist, the above explanation about God is not relevant. Materialists believe in some sort of “blind, purposeless” universe (although they are major problems with this statement, but that’s far beyond the scope of this post.) The Christian and the materialist can look at the same physical world and see the same world of probability and chance, and agree on the science and yet disagree on the metaphysics.

  72. 72

    Hmm.

    I don’t think the evidence supports
    God working through “a number of slight modifications over many generations.”

    If I were to take an evolutionary view of life. I would either go with Mike Behe or Harold Morowitz and the Emergentist school. It appears that cosmic history and life is more of a series of big bangs. Rather than evolutionary gradualism.

    I think most visitors to this site would agree with me.

    I will concede however, that I the evidence points to man being descended from the apes in some sense.

  73. 73
  74. I think Behe accepts “a number of slight modifications over many generations.” The difference between him and the theistic evolutionists is, I think, that he thinks some of those changes are scientifically capable of being declared so improbable as to point to specific intelligent intervention. That doesn’t mean that thinks that evolution doesn’t proceed by slight modifications over many generations.

  75. RRE:

    You maintained (53) that humans are “the only species on the entire planet and whole known universe to be able to add concept onto matter in the form of a machine or code.” You then added that “‘[t]ools’ are a useless comparative; the bird can make a tool such as a nest.” Finally, you wrote: “name another species that can produce codes or machines and I’ll convert to atheism.”

    I see no reason why the discovery of another species of animal that could impose its own concepts upon matter would necessitate a conversion to atheism. Nor do I think that this ability is what makes us human. Before I explain why, and offer my own definition of what makes humans special, I’d like to make two comments.

    First, I think it would be helpful if you defined the term “machine.” I take it you believe that some tools are not machines. Why not? What qualities does a tool need to possess in order to qualify as a true machine?

    Second, are you aware of the remarkable feats of Betty the Crow, a remarkable bird who designed a tool from a piece of wire so she could solve a problem – pull a bucket of food out of a tube-shaped container? Betty did this by taking a straight wire, jamming it into a crack at the base of the container, and then pulling it to the side several times until it made a hook. You can see a Quicktime movie of Betty in action at http://users.ox.ac.uk/~kgroup/trial7_web.mov and judge for yourself.

    My point here is that this kind of behavior appears to qualify as imposing a concept [of a hook] upon matter [a straight wire], which was your criterion for intelligence. I don’t know whether you’d be prepared to call such a hook a machine, but it certainly seems to qualify as a manifestation of some sort of intelligence: the crow was solving a new problem, and her actions can also be described as novel, as she had no other crows to serve as models, no training with pliant objects, and very limited prior experience with wire.

    More recently, follow-up work with Betty has lent further support to the view that Betty is genuinely able to understand how hooks work. I shall quote from the abstract of a paper by Alex Weir and Alex Kacelnik (draft version available online at http://users.ox.ac.uk/~kgroup/.....unbend.pdf ), entitled “A New Caledonian crow (Corvus moneduloides) creatively re-designs tools by bending or unbending aluminium strips”, published in “Animal Cognition”, October 2007; 9(4):317-34, 17024509 (P,S,E,B,D):

    “Previous observations of a New Caledonian crow (Corvus moneduloides) spontaneously bending wire and using it as a hook [Weir et al. (2002) Science 297:981] have prompted questions about the extent to which these animals ‘understand’ the physical causality involved in how hooks work and how to make them. To approach this issue we examine how the same subject (‘Betty’) performed in three experiments with novel material, which needed to be either bent or unbent in order to function to retrieve food. These tasks exclude the possibility of success by repetition of patterns of movement similar to those employed before. Betty quickly developed novel techniques to bend the material, and appropriately modified it on four of five trials when unbending was required. She did not mechanically apply a previously learned set of movements to the new situations, and instead sought new solutions to each problem. However, the details of her behaviour preclude concluding definitely that she understood and planned her actions: in some cases she probed with the unmodified tools before modifying them, or attempted to use the unmodified (unsuitable) end of the tool after modification. Gauging New Caledonian crows’ level of understanding is not yet possible, but the observed behaviour is consistent with a partial understanding of physical tasks at a level that exceeds that previously attained by any other non-human subject, including apes.”

    Even if some animals possess a kind of means-end rationality, as Professor Alex Kacelnik suggests in a thought-provoking paper which can be viewed online at http://www.cogs.indiana.edu/sp.....nality.pdf , the fact remains that as far as we know, human beings are the only animals capable of critical thinking, which is defined (at http://www.criticalthinking.or.....inking.cfm )as “that mode of thinking – about any subject, content, or problem – in which the thinker improves the quality of his or her thinking by skillfully taking charge of the structures inherent in thinking and imposing intellectual standards upon them… Critical thinking is, in short, self-directed, self-disciplined, self-monitored, and self-corrective thinking. It presupposes assent to rigorous standards of excellence and mindful command of their use.”

    Without this meta-cognitive capacity, ethical reflection on the meaning of “right” and “wrong” would be impossible, and we would be incapable of acting morally. Reflecting on the course of one’s life and the mistakes one has made, and resolving to avoid those mistakes, also requires an autobiographical memory. Although recent studies suggest that some birds, such as scrub jays (see http://www.pubmedcentral.nih.g.....id=1088530 ) and Canadian rufous hummingbirds (see http://www.ncbi.nlm.nih.gov/pubmed/16527747 ), can remember specific episodes in their past – in particular, when and where they stored away items of food for retrieval at a later date – there is no evidence that these birds are capable of the kind of “mental time-travel” required for what theologians call an “examination of conscience” – e.g. recalling in chronological sequence the things they did between time A and time B, and asking themselves, “Where did I go wrong, and what did I do that was wrong?”

    What I am suggesting here is that rationality is not the defining attribute of human beings, but a self-critical ability for critical reflection, coupled with an ability to recall events over the course of one’s life.

  76. Jack Krebs,

    No one would be on this blog if there were any evidence that gradualism ever produced anything of consequence. It does not matter if the changes were caused by variation events to the genomes of gametes caused by naturalistic means or if God or some other intelligence caused the changes.

    Anyone who defends gradualism has to deal with the forensic evidence of which there is none. There are slight changes all the time but these are nothing more than reshuffling of the genome or restrictions of the gene pools rather than meaningful expansions of the gene pool.

    So you can speculate about what caused the small changes but there is no evidence that any ever took place.

    Jack, deal with reality. You have been asked many times to provide examples and have always avoided the question. Repeat. There has never been any meaningful changes to a gene pool that we know of. All of it has been trivial. So questions of how it was done do not make sense.

    Now if you disagree, then provide the examples and we can have a meaningful discussion. Everyone would be the better off with such a discussion.

  77. 77

    While I will concede that as of right now the evidence points to humans probably descending from apes in some respect. I think Behe and Sewell have it right. I’m no expert though.

    I still don’t believe that “hybridization can occur between a Pan & Homo”.

  78. Jerry, I think DaveScot and Behe are two people who accept “gradualism” – I’m not the only one.

  79. PannenbergOmega:

    This may be theistic evolution but it is a far cry from the blind, purposeless, Darwinian evolutionary process.

    Yet this is exactly what Ken Miller describes in his book. I still say that he, like the other postive theistic evolutionists, need to discover that they actually are IDers. (I call a theistic evolutionist “positive” if their view of God is one who actually participates at some point, even if only to tune the big bang, rather than being a silent observer.)

    I differ with Miller only in that I think there are itentifiable occasions that fall outside of realistic probability.

    The HAR1F gene is an interesting thing. It consists only of point mutations, the smallest unit of mutational modification, yet it is fully irreduceably complex. The problem I see with the flagellum is that cooption and modification can still be claimed because genes contain an average of 300 nucleotides, so are not fully reduced. I think that the HAR1F is absolute proof that NFV+NS is an inadequate explanation.

    However PannenbergOmega, these positions still seriously do not fit with a literal interpretation of the pre-Abrahamic portions of the Bible. They leave us with a very powerful God, and good evidence of his practices. They leave us with that comfortable feeling that God is in control. But they don’t leave us with a literal interpretation of the entire Bible.

  80. vjtorley,

    The other day we faced the problem that there is no good definition of life. Is there also no good definition of intelligence? There a multitude of examples of clever things animals do to overcome their environment. It is the second time in a couple days that I have read about the New Caledonian crow.

    What is it about humans that makes their intelligence different? One interesting thing is that I recently read that hominids used tools for over a million years and the tools used did not show much difference in this time frame. So hominids had the capability to make tools but did not seem to have the ability to reflect on how to improve the tools only repeat what they have been shown. So how intelligent were they?

    We certainly think there is a quality difference between us and the rest of the animal kingdom on intelligence (kind not degree). I am not proposing a full blown discussion of intelligence because that could go on for ever and get nowhere. But it is an issue that should have an easy answer but apparently doesn’t.

  81. Jack Krebs,

    Great evasive answer. Spoken like a true veteran of the never giving a straight answer community.

    I do not think Behe is a gradualist. Let Dave Scott speak for himself.

  82. 82

    bFast. Despite my sympathy for Salvador Cordova and my desire to see a young cosmos.. I believe one must try to be open minded and go where the evidence leads.

    ” these positions still seriously do not fit with a literal interpretation of the pre-Abrahamic portions of the Bible”

    True. I should mention that neither Behe nor Sewell accept t a literal Genesis account.

  83. 83

    vjtorley,

    as Dr. Dembski and others (Noam Chomsky) have patiently tried to explain time and time before. Animals are simply not on par with human beings.

  84. 84

    This is what Noam Chomsky has to say on attempts to teach sign language to apes..

    “My feeling is the same as it was 50 years ago: the questions are
    meaningless. It’s like asking whether submarines swim or humans fly — not as well as eagles, but almost as well as chickens. Or to take a closer analogy, whether humans can learn the waggle dance of the bees.

    Doubtless it would be possible to train graduate students to simulate the foraging of bees, and probably do a pretty fair job of it. If you tried to get an NSF grant for this, the reviewers wouldn’t even laugh. They might recommend psychiatric treatment. But it’s much more sane than trying to train poor
    apes to duplicate some of the superficial features of language use.

    None of this has any place in rational inquiry.”

    – Noam Chomsky

  85. Allen : ““So we descend from mice too?”

    No; once again, the answer (based on multiple lines of empirical evidence) is that mice and humans descend from a common ancestor (similar to a tree shrew) that lived in the Paleocene (or perhaps somewhat earlier in the Cretaceous.”
    It turns out to mean the same in the end analysis – ‘we all descend from some cell’ – a cell that no one knows how it came to be.
    I looked over the wikipedia article you referred to and was amazed to see the number of take-it-for-granted speculations, conjecture and bare assertions.
    I can’t understand why you fail to see the enormous amount of speculation and conjecture involved here. I mean it’s so blatant that it practically jumps off of the page.

    I find your credence to the macro-evo view to be entirely faith-based. “Like this, therefore from this” style reasoning may be great for biologists (I certainly hope not) but it goes no where in real science and constitutes a logical fallacy of the type “undistributed middle” – a fallacy that very nicely describes the very base assumptions of Darwinian theory!

    Before this therefore because of this; similar to this therefore related to this, … all these types of reasonings are almost universally logical fallacies. Logic is something that, as an information systems analyst, I know a lot about.
    And it is the fundamental reason why I can’t swallow Darwinism.

    The sharing of genetic and morphological traits has to be pushed into Darwinian theory. It is not a given, and not necessarily logical. Shared traits of whatever type you wish can be interpreted as the result of both common design rules and common environmental influences.

    “On the contrary, the phylogenies you describe have only come about through the opposite of faith.”

    ??? Surely you jest! If that were true we would see unity. We don’t. We see various trees of life built on various sub theories, some based on morphology, some on genetic similarities, some entirely at the whim of the systematist and their quaint diagrams of phylogenesis! There are are fundamental contradictions in the world of clades and systematics. This you’re surely aware of. So why paint a pretty picture when there is none?

    “Today, however, the picture is entirely different. More and more workers are showing signs of dissatisfaction with the synthetic theory. Some are attacking its philosophical foundations, arguing that the reason that it has been so amply confirmed is simply that it is unfalsifiable: with a little ingenuity any observation can be made to appear consistent with it. Others have been deliberately setting out to work in just those areas in which neo-Darwinism is least comfortable, like the problem of the gaps in the fossil record or the mechanisms of non-Mendelian inheritance. Still others, notably some systematists, have decided to ignore the theory altogether, and to carry on their research without any a priori assumption about how evolution has occurred. Perhaps most significantly of all, there is now appearing a stream of articles and books defending the synthetic theory. It is not so long ago that hardly anyone thought this was necessary.”

    (Ho M-W. & Saunders P.T., eds., “Beyond Neo-Darwinism: An Introduction to the New Evolutionary Paradigm,” Academic Press: London, 1984, p.ix)

    The “stream of articles” has grown quite a bit since hasn’t it. No wonder.

    Data, by itself, is immune to theories. It must be interpreted. Darwinists persistently force the data to fit the theory. So do a lot of other scientists in other domains. That is not science.

    Fortunately that won’t work in domains like mathematics, informatics etc. where it has to work in the real world.

    “Biologists must constantly keep in mind that what they see was not designed, but rather evolved.”

    Francis Crick
    Dawkins invented designoids for the same reason.
    I ask you this, why would these atheists make so much ado about such a necessity if the impression of design was so obviously in fact an “illusion”?

    Indeed, if the sense of wonder and awe we feel before the unspeakable depths of functional, organized complexity alive in all nature were not so fundamentally intuitive we would never have suspected and inferred design in the first place, as all wise men in all historical cultures since the beginning have done.
    Modern genetic discoveries are only making this intuition more prominent and inspiring for both designists and atheists alike! And that is the reason why the materialists must follow Crick’s precept every day or be consumed with the genius beyond genius we witness at each new discovery. Each one ever more and more complex to the point that, sooner or later, you have to give in and admit the astronomical improbability of the methodological naturalist hypothesis and seek to know the beauty and mind of the Designer.

  86. bFast:

    I still say that he, like the other postive theistic evolutionists, need to discover that they actually are IDers. (I call a theistic evolutionist “positive” if their view of God is one who actually participates at some point, even if only to tune the big bang, rather than being a silent observer.) ”

    Science cannot prove (Nor can it Disprove) God.

    I think that Miller’s objection to ID, is that it has not brought any testable science to the plate.

    Therefore, he believes that it is not science.

    This is a big problem for ID

  87. jerry at 76:

    Anyone who defends gradualism has to deal with the forensic evidence of which there is none. There are slight changes all the time but these are nothing more than reshuffling of the genome or restrictions of the gene pools rather than meaningful expansions of the gene pool.

    How can you be so sure of the contents of the gene pools for all populations of all organisms?

    What is the forensic evidence for something other than gradualism? Can you provide an example of a population which suddenly changed in the laboratory in a way that indicates that a designer intervened to change the gene pool in a nongradual way? Other than a contemporary human scientist, I mean. Venter’s work may prove that intelligent design of biological materials is possible, but doesn’t constitute evidence of any earlier designer activity.

    If not in the lab, do you have a hypothesis as to where and when was the most recent time when a designer expanded the gene pool? That would be an ID hypothesis that could be scientifically investigated.

  88. Ergo, there are two logical interpretations of these multiple lines of empirical evidence:

    1) human chromosome #2 consists of two chromosomes found in other primates, fused together at the location of the back-to-back embedded telomeres

    2) an “intelligent designer” inserted the back-to-back embedded telomeres in the middle of human chromosome #2, arranged all the genes to look just like they should if they had come from the two unfused non-human primate chromosomes, and then inactivated the back-to-back embedded telomeres (i.e. they have no detectable function)-Allen MacNeill

    How about this:

    The design called for the fusion to create reproductive isolation between two other-wise genetically similar populations.

  89. congregate,

    you said

    “If not in the lab, do you have a hypothesis as to where and when was the most recent time when a designer expanded the gene pool? That would be an ID hypothesis that could be scientifically investigated”

    You are an example of those who do not understand what the debate is about. Do you expect a video of the event several million years ago? Come on, don’t be silly. Are you of the school that you must see and feel the designer before you will believe? It is not necessary to know anything about who, when and how a design event took place to conduct research.

    There is a dominant paradigm out there with no evidence to back it up. I tease Jack Krebs because he is a leader in the movement to maintain this paradigm for the children but cannot present any evidence to support it. Can you? If you cannot, then you should join us and getting rid of this paradigm.

    And please do not give us the cliché remark that before you can replace a paradigm, you should have a replacement paradigm. There is no need to have a paradigm to do science especially one that is bogus. All you need are hypotheses. There can be several competing paradigms and if they predict and have good results, should be accepted in the house of science. If a paradigm doesn’t have a good track record like gradualism, then they should be sh** canned. Pardon my Navy talk.

  90. I think Behe accepts “a number of slight modifications over many generations.” The difference between him and the theistic evolutionists is, I think, that he thinks some of those changes are scientifically capable of being declared so improbable as to point to specific intelligent intervention.–Jack Krebs

    Designed to evolve Jack.

    Irreducible complexity can be overcome, not just via intervention, but also via planning.

    Targets, resources, algorithms, genetic information- let ‘em run.

  91. Jerry writes, “Anyone who defends gradualism has to deal with the forensic evidence of which there is none.”

    Here’s some.

    The Hawaiin Islands formed between 5 million and a million years ago. There are many example of great diversity among species and families of species, and all sorts of evidence shows that this diversity arose from a smaller number of founding species. Is this not evidence of gradualism?

    from http://www.nap.edu/openbook.ph.....38;page=20

    Many Other Species Have Undergone Adaptive Radiations in Hawaii

    While the adaptive radiation of the drosophilids in Hawaii has resulted in a remarkable number of species, other radiations have produced descendants with an even greater range of physical characteristics. The 30 species of plants belonging to what is called the silversword alliance are a superb example.

    For decades, botanists had known that all of these species are related because their leaves and flowers share certain characteristics, which is why the species are termed an “alliance.” But in other ways the plants are so different that the nature of this relationship remained obscure. The 30 members of the alliance include trees, shrubs, mats, vines, and the rare and magnificent flowering silverswords that live on the high slopes of Haleakala in Maui and Mauna Kea in the Big Island (see Figure 13). They occupy habitats ranging from near sea level to the upper limits of vegetation on mountains and from semiarid desert areas to thick rainforests.

    In the 1980s, biologists studying the genetics of these species realized that they are far more closely related than they appear. In fact, all appear to be descended from a single ancestral species that arrived on the Hawaiian islands millions of years ago (Panel 3). Today the closest non-Hawaiian relative of the silversword alliance is a small, daisy-like plant called a tarweed that grows on the west coast of North America. The fruit of this plant has sticky appendages that could easily have allowed the seeds of an ancestral plant to hitch a ride on a migratory bird.

    As with the drosophilids, the descendents of the original colonizing species diversified dramatically as they underwent multiple founder events and spread into new environments. On Maui and the Big Island, for example, several species within the silversword alliance have adapted to the drier environments of higher elevations. All of these species are able to maintain water pressure within their leaves and stems even as the water content of the plant drops, which helps them survive in drier habitats.

    Many other species of plants and animals in Hawaii also derive from adaptive radiations.

    *
    About 50 living and extinct species of the birds known as honeycreepers have been identified in Hawaii. All evolved from a single finch-like colonist species with a relatively small bill. Today, the members of this radiation have a wide variety of bill shapes that are each specialized for a particular kind of food (see Figure 14).
    *
    About 240 species of crickets have evolved from the separate arrival in Hawaii of a tree cricket, a sword-tail cricket, and a ground cricket. Among these species are several species that have adapted to subterranean life within underground lava tubes in Maui and the Big Island (see Figure 15). These species have reduced coloration, small eyes, and a clear exoskeleton.
    *
    Two genera of violets—Viola with seven species, and Isodendrion with four—derive from two separate introductions, each of which was followed by a moderate degree of adaptive radiation.

    Altogether, the approximately 1,700 species of native Hawaiian plants are descended from about 300 separate species that colonized the islands. The 10,000 species of native Hawaiian insects may be descended from only 350 to 400 separate founders. Biologists are now studying the different patterns of adaptive radiations seen in Hawaii to better understand the factors that influence evolutionary diversification.

  92. jerry at 88-

    It is not necessary to know anything about who, when and how a design event took place to conduct research.

    I’m not sure what research you have in mind. As I understand it the journal established to publish ID research has not released an issue in several years.

    In any event, it seems to me that documenting an actual design event would be convincing evidence for the ID theory. The claim that non-design is too unlikely to be true doesn’t seem to be making much headway in mainstream science. But every investigator can choose what they want to investigate.

  93. Jack

    The Hawaiian Island species should be a great test of Behe’s edge of evolution. He’d predict that all those species, if indeed they are biological species incapable of producing fertile hybrids, need little if anything in the way of new genetic material but rather all can be obtained from recombination of existing genetic material in the single ancestral genome. Does the evolutionary theory of chance & neccessity make any predictions at all in what, if any, mutations would be required for the observed phenotype variation? Here again we have a case where an ID theoretic view makes a testable prediction where chance & neccessity theorists make none. All chance & neccessity does is explain everything observed AFTER the observation is made – it has no predictive power at all and unlimited ad hoc explanatory power. It’s useless.

    And by the way, the Hawaiin island chain at least is some 65 million years old and extends for at least 5000 kilometers from the youngest island. The vast majority of the islands have weathered away below sea level and comprise what’s known as the Emperor seamounts. Life on the island chain could have arrived anytime on any of the seamounts and then hopped from island to island as new ones rose above sea level and old ones sunk below sea level. Hopping 50 kilometers from one island to another is a lot more likely than travelling many thousands of kilometers over open ocean. So what you see in the way of variation happened over as much as 70 million years if not even much longer than that. Now the salient question becomes how much in the way of novel cell types, tissue types, organs, and body plans was chance & neccessity able to cobble up in all that time or did it do none of those at all? Anyone? Bueller?

  94. Jack Krebs,

    you said

    “The Hawaiian Islands formed between 5 million and a million years ago. There are many example of great diversity among species and families of species, and all sorts of evidence shows that this diversity arose from a smaller number of founding species. Is this not evidence of gradualism?”

    Jack you are demonstrating that you do not understand the debate. ID does not have any quarrel with the evidence you have presented. Is there any evidence that any of these species contain anything truly novel. NO!!

    What you are showing is just a reshuffling of the gene pools to meet new environments. That is micro evolution via natural selection and actual great design. Now if you showed that any of those new species developed novel complex characteristics, you would have something. But what you have shown is how one aspect of good design works. You see ID does not deny that natural selection works in nature and affects how many species change over time.

    This is just the micro evolution that Darwin saw on the Beagle and represents downward evolution. He extrapolated the wrong way in his book on origins. Darwin was witnessing great design. But no one has been able to explain where the gene pools come from that natural selection can then work on.

    Keep plugging and you may come with something.

  95. congregate,

    There are thousands of ID studies done every year. They are in the mainstream biology and evolution journals. They are just not identified as such.

    Read DaveScot’s comment just above. Any research study that compares genomes of animals qualifies as an ID study despite the intentions of the researchers. ID predicts that genomes of species in the same family or genera will not have any meaningful differences that can be attributed to gradualism. This proposition is confirmed over and over again.

    So here is ID research that is on going and supporting ID. The authors just don’t know it. I find that deliciously ironic.

    I have written a lot about this in the past couple months. One brief explanation of this is at

    http://www.uncommondescent.com.....w-species/

  96. 96

    To me, the Darwinian model/s (*which there seems to be many of) fails flat with chance and necessity. In any design specifications (from computer, cars, buildings, houses etc…) you have to define input variables, functions that work with those variables and the associated output/s in one way or another. One thing is for sure, there is a goal-directed or goal-oriented specific process (*a design method) needed to create not only complex structures but complex structures that serve a particular purpose. Humans design all sorts of complexities, most of which are defined to do a particular task, some designs are discarded, some designs are improved upon. One thing is for sure, there is some sort of intelligence making those exact choices otherwise if unintelligent decisions were made amazing inventions would not have existed today. Darwinian model especially looks stupid when you start putting it to the test, trying to understand how a non-design method with absolutely no design specifications puts together the illusion of design specific functions. I think that is why I agree that it is the most failed hypothesis in history (*as JAD always say). A good idea I think would be to define a design method for both products of “intelligent designs” and “Darwinian designs” and then compare both.

    Intelligent designs:

    Design Concept (IDea) -> main design specification -> design specifications (functions/blocks/partitions) -> defined interconnections between functions/blocks (ie: design flows) -> testing or simulation of main design (output) -> implementation of design else redefine design specification (ie: error correction or complete re-design)

    Darwinian designs:

    No design concept(no idea) -> no main design specification -> design specifications (functions/blocks) -> defined interconnections between functions/blocks (ie: design flows) -> output which is part of design implementation off the bat (*logically and physically integrated) -> design simply lives or dies as part of “natural selection” acting as a filter for “bad designs” (ie: error correction or complete new designs)

    It is obvious Darwinian designs are missing `crucial` parts of the process. Any sane person could see/realize that Darwinian evolution simply doesn’t cut it. Darwinian design is not design at all, its a fairy tale is composed of magical speculations from atheists with agendas. ID to me is on track scientifically, I don’t see why any ID proponent should be intimidated by any Darwinian argument, I also don’t see why the onus is on the ID proponent to present evidence to the contrary when the contrary is completing wrong from the get-go.

  97. Vjtorley said: “I see no reason why the discovery of another species of animal that could impose its own concepts upon matter would necessitate a conversion to atheism.”

    Only humans can add concepts onto matter and produce machines and codes. Since humans are using intelligent causes to produce these codes and machines, it is only logical deduction that the genetic code and the biological machines that make up the animal kingdom were also produced via intelligent causes, simply because intelligent agency is required for ALL machines and codes based on reality and on the empirical study of the natural world. If you are to be intellectually honest and scientific, then you would have to point out a machine or code that was produced without intelligent causes in order to claim that atheism can work. I need an undirected, unguiding mechanism that can make a code or machine in order to believe that matter plus energy gives you life (without designer). This is because we ourselves fit into the definition of a machine, and we also are defined by our genetic code.

    Vjtorley said: “Nor do I think that this ability is what makes us human. Before I explain why, and offer my own definition of what makes humans special, I’d like to make two comments. ”

    Designing codes and machines is not what makes us human, but is still non-the-less, a unique characteristic of humanity.

    Vjtorley said: “First, I think it would be helpful if you defined the term “machine.” I take it you believe that some tools are not machines. Why not? What qualities does a tool need to possess in order to qualify as a true machine?”

    Since Darwinists love Wikipedia and they seem to possess some kind of slant unfavorable to ID, I will use their definition of machine.

    Wiki says: “The scientific definition of a “machine” (derived from the Latin machina) is any device that transmits or modifies energy. In common usage, the meaning is restricted to devices having rigid moving parts that perform or assist in performing some work. Machines normally require some energy source (“input”) and always accomplish some sort of work (“output”). Devices with no rigid moving parts are commonly considered tools, or simply devices, not machines.”

    Notice the last sentence, “…no rigid moving parts…considered tools…not machines.” So a quality a tool would have to possess to call it a machine is moving parts. A hook is not an example of a machine, just like an arrowhead is not, or a birds nest–they contain no moving parts. Nor is a hook a code either, so your example of the bird making a hook fails.

    Vjtorley said: “Second, are you aware of the remarkable feats of Betty the Crow, a remarkable bird who designed a tool from a piece of wire so she could solve a problem – pull a bucket of food out of a tube-shaped container? Betty did this by taking a straight wire, jamming it into a crack at the base of the container, and then pulling it to the side several times until it made a hook. You can see a Quicktime movie of Betty in action at and judge for yourself. ”

    Who cares about a bird making a hook, that is a non-issue. It’s not very remarkable either. Animals make tools all the time, and as I’ve stated previously, a birds nest is a more complex tool than a hook. None of them possess a moving part to be considered a machine.

    Vjtorley said: “My point here is that this kind of behavior appears to qualify as imposing a concept [of a hook] upon matter [a straight wire], which was your criterion for intelligence.”

    I never said anything about developing a criterion for intelligence. A hook is not a machine or code. My point was that humans possess the unique intelligence to produce codes and machines and add them onto matter while passing through time.

    Vjtorley said: “I don’t know whether you’d be prepared to call such a hook a machine, but it certainly seems to qualify as a manifestation of some sort of intelligence: the crow was solving a new problem, and her actions can also be described as novel, as she had no other crows to serve as models, no training with pliant objects, and very limited prior experience with wire”.

    No one in the whole world would classify a hook as a machine. Where’s the moving part or parts? Yes, the Intelligent Design of a hook is a manifestation of intelligence, so what? I am only interested in whether other animals can produce codes or machines. So far, you give no example that any other animal can produce them.

    Vjtorley said: “More recently, follow-up work with Betty has lent further support to the view that Betty is genuinely able to understand how hooks work. I shall quote from the abstract of a paper by Alex Weir and Alex Kacelnik (draft version available online at http://users.ox.ac.uk/~kgroup/…..unbend.pdf ), entitled “A New Caledonian crow (Corvus moneduloides) creatively re-designs tools by bending or unbending aluminium strips”, published in “Animal Cognition”, October 2007; 9(4):317-34, 17024509 (P,S,E,B,D):”

    This is exactly how materialists confuse you. Other animals can make tools (because they possess a mind, and a mind can intelligently design tools) and use them. But no other animal other than humans can make codes or machines. Please give me an example of Betty the crow making a machine or code. All animals that have a mind, have cognition. So what? I want to see another primate or animal make a WEDGE, or other simple machine.

    Vjtorley said: ““Previous observations of a New Caledonian crow (Corvus moneduloides) spontaneously bending wire and using it as a hook [Weir et al. (2002) Science 297:981] have prompted questions about the extent to which these animals ‘understand’ the physical causality involved in how hooks work and how to make them. To approach this issue we examine how the same subject (’Betty’) performed in three experiments with novel material, which needed to be either bent or unbent in order to function to retrieve food. These tasks exclude the possibility of success by repetition of patterns of movement similar to those employed before. Betty quickly developed novel techniques to bend the material, and appropriately modified it on four of five trials when unbending was required. She did not mechanically apply a previously learned set of movements to the new situations, and instead sought new solutions to each problem. However, the details of her behaviour preclude concluding definitely that she understood and planned her actions: in some cases she probed with the unmodified tools before modifying them, or attempted to use the unmodified (unsuitable) end of the tool after modification. Gauging New Caledonian crows’ level of understanding is not yet possible, but the observed behaviour is consistent with a partial understanding of physical tasks at a level that exceeds that previously attained by any other non-human subject, including apes.””

    Again, tools are a useless criterion, already, the bird can build a nest that is more complex and specified than the hook, so who cares about a hook. I am aware that animals can Intelligently Design tools, so what? The point I was making was that they cannot Intelligently Design machines or codes. That’s a unique ability of humans.

    “Even if some animals possess a kind of means-end rationality, as Professor Alex Kacelnik suggests in a thought-provoking paper which can be viewed online at http://www.cogs.indiana.edu/sp…..nality.pdf , the fact remains that as far as we know, human beings are the only animals capable of critical thinking, which is defined (at http://www.criticalthinking.or…..inking.cfm )as “that mode of thinking – about any subject, content, or problem – in which the thinker improves the quality of his or her thinking by skillfully taking charge of the structures inherent in thinking and imposing intellectual standards upon them… Critical thinking is, in short, self-directed, self-disciplined, self-monitored, and self-corrective thinking. It presupposes assent to rigorous standards of excellence and mindful command of their use.””

    This professor Alex Kacelnik says nothing about machines and codes, so it this plays nothing into what I said in any of my posts on this blog article.

    Vjtorley said: “Without this meta-cognitive capacity, ethical reflection on the meaning of “right” and “wrong” would be impossible, and we would be incapable of acting morally. Reflecting on the course of one’s life and the mistakes one has made, and resolving to avoid those mistakes, also requires an autobiographical memory. Although recent studies suggest that some birds, such as scrub jays (see http://www.pubmedcentral.nih.g…..id=1088530 ) and Canadian rufous hummingbirds (see ), can remember specific episodes in their past – in particular, when and where they stored away items of food for retrieval at a later date – there is no evidence that these birds are capable of the kind of “mental time-travel” required for what theologians call an “examination of conscience” – e.g. recalling in chronological sequence the things they did between time A and time B, and asking themselves, “Where did I go wrong, and what did I do that was wrong?””

    I don’t care much about morality, only interested if you can name another animal that has produced a code or machine.

    Vjtorley said: “What I am suggesting here is that rationality is not the defining attribute of human beings, but a self-critical ability for critical reflection, coupled with an ability to recall events over the course of one’s life.”

    I agree, rationality is not unique to humans, but the production of machines and codes is a unique attribute of human beings. I am waiting for you to prove me wrong.

  98. congregate,

    Experience tells us it matters a great deal to any investigation whether or not that which is being investigated arose via agency involvement or nature, operating freely.

    Also ID is based on two premises:

    1) We know what agencies are capable of.

    2) We know what nature, operating freely, is capable of.

    Our experience tells us that only agencies create constructive machinery and nature, operating freely, tends to wreck things.

    Our experience also tells us that living organisms are full of constructive machinery and only life begets life.

    Conclusion-

    If we want to know how things get wrecked things we turn to Darwin.

    If we want to know how things get constructed we turn to ID.

  99. DLH asked:

    “Will you now take the step of: “I will believe in intelligent design “?”

    I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.

    Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.

  100. vjtorley asked:

    “…can you provide a rough, back-of-the-envelope calculation of how many mutations occurring in the human line since the human-chimp split would have had an effect on the development and/or functioning of the brain?”

    Nope; not my area of expertise. Sorry.

  101. vjtorley also asked:

    “…is there any prospect of scientists in the future being able to situate [the changes that produced the human brain] in their correct chronological sequence?”

    That’s an interesting question. We are right at the very beginning of the scientific investigation of the development of the nervous system via homeotic gene regulation. There doesn’t seem to be any reason in principle why such an analysis should be impossible, as far as I know. There are many laboratories working on precisely this problem (among others), so I would watch the journals for reports of their progress.

  102. Frost122585:

    As most of your post(s) consist of assertions without any evidence, I cannot address them. Sorry.

  103. ericB:

    If I understand your question about Huxley’s criterion correctly, I do indeed require more evidence for the origin of life from non-living materials, precisely because such an origin is closer to my other beliefs about how nature works. This is why I am pretty skeptical, not only of the current state of OOL research, but of the entire enterprise.

    I hope I have made it clear that this skepticism has no bearing whatsoever on most of the rest of evolutionary biology, which after fifty years of study (by me) has provided enough evidence that I accept the general outlines of the theory in principle. However, as should be the case with any good scientist, I am ready to revise this viewpoint, but only the basis of new, very convincing empirical evidence to the contrary. So far, I haven’t seen (or read about) any.

    And yes, I’ve read virtually everyting that Michael Denton, Michael Behe, and William Dembski have published. None of them has done a single empirical test to verify or falsify even the most trivial prediction that would unambiguously distinguish between current evolutionary theory and intelligent design. Theoretical speculation yes, but empirical research no, not one bit.

  104. Pannenberg Omega asked (in #54):

    “Is it possible that the Creator programmed everything into the early universe? Everything that would occur in cosmic/terriestrial history, the development of life and speciation. Could it all have been imputed in the begenining?”

    If this were, indeed, the case, how could one distinguish empirically between this and a universe that operates without such input? Once again, an omnipotent, omnipresent, omniscient Intelligent Designer could certainly have created a universe with a set of universal laws which could produce everything we see around us with no further input. That was, in fact, exactly what Darwin believed, and wrote explicitly into the last paragraph of the Origin of Species:

    “There is grandeur in this view of life, with its several powers, having been originally breathed into a few forms or into one; and that, whilst this planet has gone cycling on according to the fixed law of gravity, from so simple a beginning endless forms most beautiful and most wonderful have been, and are being, evolved.”

    http://darwin-online.org.uk/co.....ageseq=508

  105. RRE wrote (#58):

    “We can show you that intelligent causes CAN produce machines and codes. ”

    Yes, but have you shown (using empirical tests), that we can show you that intelligent causes DID produce machines and codes? And if you would be so kind to cite journal references in the primary literature, please?

  106. That is, the “machines and codes by which living organisms assemble and operate themselves. I can look up when the earliest computers were engineered by humans.

  107. Paul Glem:

    Re comment #60: apology accepted. Thank you, Paul, for making it, and conducting yourself as a gentleman during our discussion. This is what a “community of scholars” does, IMHO. It’s easy to be generous to people with whom you agree. The test of a true gentleman is his generosity to people with whom he vehemently disagreed. I hope to live up to your example.

  108. Paul Glem wrote (#60):

    “WHy not just say that the molecular clocks aren’t trustworthy and leave it at that?”

    Personally, I don’t necessarily put a lot of stock in “molecular clocks”. They require that the processes that produce mutations tick along at an almost unvarying rate. As a person who was a late, but full convert to Stephen J. Gould and Niles Eldredge’s theory of punctuated equilibrium, I find such assumptions to be unwarranted.

    That said, one can often determine the sequence of events such as these, without necessarily knowing anything about when they occurred. This is analogous to the difference between absolute and relative dating in historical geology. The sequence of strata in the geological column were worked out nearly a half century before the publication of the Origin of Species. Darwin’s book didn’t change anything in this sequence at all. He (along with Lyell) simply provided an alternate explanation as to how the strata were deposited (and especially over what period of time), and what they implied about descent with modification.

  109. bFast wrote (in #66):

    “…in the gambling halls “winning streaks” and “loosing streaks” are a real statistical phenomenon. In other words, as I understand it, they happen often enough and strongly enough to challenge the expectations of the statisticians.”

    Actually, just the opposite is the case. My friend, Tom Gilovich at Cornell, has published extensively on precisely this phenomenon. We perceive “streaks” in many such activities, including “hot hands” in basketball and “winning streaks” in gambling. However, if one applies fairly simple statistical analysis to such “streaks”, they disappear. I recommend Tom’s book, How We Know What Isn’t So: The Fallibility of Human Reason in Everyday Life (1993) Free Press, ISBN 0029117062, 224 pages.

  110. DaveScot asked (in #93):

    “Now the salient question becomes how much in the way of novel cell types, tissue types, organs, and body plans was chance & neccessity able to cobble up in all that time or did it do none of those at all?”

    The salient question is not about novel cell types, tissues, organs, or body plans. The salient question is what kinds of processes are necessary to produce the kinds of reproductive isolation we observe among the various clades in the Hawaiian archipelago. And the answer is, most of those processes involve relatively slight behavioral and genetic changes, sometimes so slight as to be undetectable upon superficial examination.

    Speciation, in other words, doesn’t take a whole lot of change. All it takes is something that prevents interbreeding for long enough that a population that was originally panmictic has slit into one or more populations between which there is little or no genetic exchange.

  111. jerry wrote (in #94):

    “Now if you showed that any of those new species developed novel complex characteristics, you would have something.”

    This statement demonstrates a fundamental misunderstanding of what constitutes biological species. What separates closely related species is not “novel complex characteristics”; indeed, it may not be a genetic difference at all, as demonstrated by the breakdown of species boundaries between coyotés and red wolves (see my earlier comments in this thread for a more detailed discussion of this point). What separates species is often extremely minor behavioral and/or genetic differences, or even something as obvious as geographical separation, without any behavioral or genetic divergence.

  112. Allen_McNeill wrote (#105):

    “I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.”

    That’s a very good start. Thank you for admitting genomes can be generated by genetic engineers (whether artificial or not does not even matter) — which are intelligent designers who have successfully added concept onto matter to make a machine work, in this case, a cell by manipulating its code. This genetic code coupled with the mitochondrial DNA code is the complete set of instructions for all the cell lines of the species and is especially important when placed inside of the female reproductive cell (I believe it’s the master cell — curiously it’s the biggest in every species) of the same species.

    Allen_McNeill wrote (#105):

    “Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.”

    It’s already been shown to you. How do you not see it? Microtus pennsylvanicus is a MICROSCOPIC MACHINE with an even smaller genetic CODE or INSTRUCTION SET to BUILD proteins from scratch.
    The bacterium fits the standard definition of a machine; you can look it up yourself. All machines when studying their origin were intelligently designed. So it takes intelligent causes to produce them.

    “a device with moving parts, often powered by electricity, used to perform a task”
    “… device used to overcome resistance at one point by applying force at another point…”
    “An engine-driven means of transportation” (the flagellum in biology)
    Encarta
    “an assemblage of parts that transmit forces, motion, and energy one to another in a predetermined manner”
    Merriam-Webster
    “A device consisting of fixed and moving parts that modifies mechanical energy and transmits it in a more useful form”
    American Heritage

    What does a code mean? Here you go.
    “a system of signals or symbols for communication”
    “a systematic statement of a body of law” or the systematic statement of a cell.
    Merriam-Webster

    Show me any machine or code that can be produced without intelligence. You cannot do it. Only human intelligent designers make machines and codes, with the very real exception being biological organisms, which are more complex machines with a more complex code than we can make today with our own intelligent designing skills. So the finger goes back to you—YOU must empirically demonstrate a code or machine that has been caused into existence without using intelligent causes– purely naturalistic mechanisms as you say. Since you are excluding intelligent causes from your origins hypothesis a priori, as well the scientific realm when it comes to machines and codes, then YOU must provide and demonstrate empirically, a CODE and a MACHINE from some OTHER MECHANISM. If you can’t produce a machine or code by excluding intelligent causes then you are intellectually dishonest when you say that the bacterium, which manages to reproduce itself and contains molecular machines and instructions to communicate, can originate from just natural causes. You are BS-ing and tap-dancing around the issue. Machines and codes require intelligent design; it’s been empirically tested and confirmed in every instance. Show me otherwise or admit that it does require intelligent agency to make a code or machine, so as to keep your intellectual honesty.

  113. Allen_MacNeill wrote (#110):
    “The salient question is not about novel cell types, tissues, organs, or body plans. The salient question is what kinds of processes are necessary to produce the kinds of reproductive isolation we observe among the various clades in the Hawaiian archipelago.”

    Admit that you’ve never empirically observed a species create a new cell type, tissue, organ, or body plan. That is why you are dodging that question from DaveScot.
    The salient question for you is what kinds of processes are necessary to produce a cellular machine or a genetic code? Does one of the processes used involve intelligent design just like all of the other machines and codes observed in nature? Or is there some other purely natural mechanism that can produce a code or machine?

  114. 114

    Allan_MacNeill wrote:
    Yes, but have you shown (using empirical tests), that we can show you that intelligent causes DID produce machines and codes?

    There is a difference between intelligent causes more likely produced machines and codes vs. intelligent causes did produce machines and codes. I don’t think you can empirically test the latter. What I think you can do is begin scratching out non-intelligent causes as a by-product of design x, is that scientific and testable?
    If that is testable, then the inverse of that must also be true (ie: intelligent causes)
    I distinguish non-intelligent (* ` causes` that are best known for not producing complicated interacting parts built for a specific task) from anything intelligent (* `intelligent causes` as the best known `phenomena` for producing complicated interacting parts built for a specific task).

    {DLH deleted typo per following post}

  115. 115

    (Edit: sorry for the typo in the first line, forgot to delete in wordpad from a previous document)

  116. Allen MacNeill,

    you said

    “This statement demonstrates a fundamental misunderstanding of what constitutes biological species”

    You have been a terror at the keyboard tonight but you have failed to pick up the irony in what I was saying. I have read, heard and watched discussions of “what is a species.” So I am well aware of the various definitions. What I am saying to Jack Krebs and others here who support Darwin is that what is held up as Darwinian evolution such as what Darwin himself saw is really a trivial reshuffling of the gene pool and not anything of consequence in terms of evolution.

    Jack Krebs was a leader in defending Darwin at the Kansas school science standards discussions. And Jack doesn’t really understand the basics of Darwinian evolution but has lead a cause to preserve it in the schools. So I find it quite ironical.

    What Jack offered as samples of evolution are just the reshuffling of the genes in the members of a population such that they can adapt to a new environment or ecology. The net result is to probably reduce the gene pool in each new population. The so called variants that are formed are probably not new species but maybe over time will develop slight differences so that they will not inter breed with the original population. And thus, over time be classified as a separate species.

    But Darwin’s theory predicts over time that new novel complexity is formed by these slight changes and what I am saying is that examining all these populations will not support that. So what we are seeing is an evolution down to more restricted gene pools (order => family => genera => species=> variant or subspecies) and not up according to Darwinian theory which predicts the following species => genera => family => order. Darwin had it backwards.

    So I am quite comfortable with your observations and have you know that you support a basic tenet of ID.

    I just started to read Jablonka and Lamb and hope you are around in a few weeks when I have digested some of it.

  117. Jerry writes,

    Jack Krebs was a leader in defending Darwin at the Kansas school science standards discussions.

    I was not “defending Darwin.” I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted by a Board who ignored the very processes for writing curriculum that they had established.

    Darwin has been dead for 150 years, and the ideas he started have been modified and expanded upon tremendously. It is entirely inaccurate on multiple counts to say that in Kansas I was “defending Darwin.”

    And Jack doesn’t really understand the basics of Darwinian evolution

    Jerry may not think so, but I can assure you that Jerry’s idea that all evolution does is re-shuffle genes is not supported by the evidence nor supported by the vast majority of the world’s scientists knowledgeable about these matters. It is fine with me if Jerry wants to disagree with the mainstream view, but he is wrong to say that I don’t understand the basics of evolution just because I don’t agree with his minority perspective.

  118. Allen_MacNeill at 99

    I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.

    Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.

    Thanks for your clarification of your actual beliefs versus your previous statement.

    I understood the identification of the human engineered genomes to be “empirical” – they did not ask the authors.

    How do you define “empirical” besides looking at the observable evidence without asking the “author” or without “revelation”?

  119. Allen_MacNeill, (108)

    We apparently agree that the term “molecular clock” is an exaggeration if not a misnomer. And you seem quite willing to disregard it as an accurate measurement of absolute time.

    You then go on to say, “That said, one can often determine the sequence of events such as these, without necessarily knowing anything about when they occurred. This is analogous to the difference between absolute and relative dating in historical geology.” I think we are on much shakier ground when we use molecular clocks to tell relative time than we are when we use geological strata to do the same. In geology, we can often find stratum A lying partly on top of stratum B, and thus be quite sure that, whatever their absolute ages, A must be younger than B. That, as I understand it, is relative dating.

    But when we get to chromosomes, there is no analogous way of being able to determine that chromosome A has a younger divergence in two species than chromosome B. We simply don’t have chromosome A lying on top of chromosome B. We can’t tell relative age in that way. The only way (AFAIK) that we can attempt to say that A’s divergence is younger than B’s divergence is if if A has significantly fewer mutations per unit length than B. And here we run into a problem.

    For, if the molecular clock is not accurate, we have to ask why. There are two possibilities. Either some organisms mutate faster than others (more, or perhaps fewer, generations of cells per unit of time, or perhaps less efficient DNA repair mechanisms, or perhaps living in a high radiation environment), or mutations are not actually effectively random. The latter seems highly likely. Exons, for example, mutate more slowly than introns. In fact, this has been documented in the eta-pseudoglobin genes in chimpanzees versus humans, where neither the “exons” nor the “introns” code for anything.

    The mutations themselves may or may not be random. Perhaps some sites in DNA are relatively protected, perhaps by being tightly coiled most of the time. Or mutations in certain areas may cause the death of the cell, or of the organism made from that cell, so mutations in certain areas of DNA are less likely to occur in offspring even if they are just as likely to occur in cells. We have no theoretical warrant for believing that all parts of a genome should have the same mutation rate, and some evidence against that belief.

    if there is a variable mutation rate within a genome, it is not appropriate for us to assume a constant rate and create stories to explain variations in mutation densities based on this assumption, thus interpreting mutation densities as time, even relative time. If we do create such stories, we must appropriately label them as speculation, and note that they have minimal foundation. IMO the article that was cited at the beginning of this thread failed to be cautious enough.

    The problem is analogous to that of the canals on Mars. They just didn’t have the resolution to test the hypothesis in Percival Lowell’s day. Lowell would have been better off if he had said, there might be canals on Mars, but if so, my telescope just isn’t good enough to see. Ironically, there does appear to be a giant erosion feature near the equator of Mars, so Lowell wasn’t completely wrong. But by trying to go to the edge of resolution, he actually went beyond it, and serves as an example to us.

  120. RRE @ 112 –

    Microtus pennsylvanicus is a MICROSCOPIC MACHINE with an even smaller genetic CODE or INSTRUCTION SET to BUILD proteins from scratch.
    The bacterium fits the standard definition of a machine; you can look it up yourself.

    When you’re accusing someone else of BSing (as you do further down 112), it really doesn’t help your case if you’re unable to distinguish between a bacterium and a cute furry mammal.

  121. bfast

    The HAR1F gene is an interesting thing. It consists only of point mutations, the smallest unit of mutational modification, yet it is fully irreduceably complex. The problem I see with the flagellum is that cooption and modification can still be claimed because genes contain an average of 300 nucleotides, so are not fully reduced.

    I am lost: Do admit that flagella are not irreducible complex? Or do you mean that they were not irreducible complex directly after having been designed and are still on their way to irreducible complexity? When will they accomplish this state? Once they are encoded by a single codon?

  122. Wow.
    Some of these ID proponents don’t seem like proponents at all, now do they?

  123. Mr Krebs:

    I must take you up on a claim you made in 117, above. One that is very relevant to the overall context of this blog and which reveals a lot of what has gone wrong with science, science education, the media and public policy:

    [JK, 117:] I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . .

    1] What reasonable science definitions look like:

    Did you use non question-begging, generally and reasonably acceptable “definitions” of science such as:

    science: a branch of knowledge conducted on objective principles involving the systematized observation of and experiment with phenomena, esp. concerned with the material and functions of the physical universe. [Concise Oxford, 1990 -- and yes, they used the "z" Virginia!]

    scientific method: principles and procedures for the systematic pursuit of knowledge [”the body of truth, information and principles acquired by mankind”] involving the recognition and formulation of a problem, the collection of data through observation and experiment, and the formulation and testing of hypotheses. [Webster's 7th Collegiate, 1965; I have deliberately chosen definitions from dictionaries that were published before the current controversies.]

    2] What happened in Kansas, circa 2005 – 2007:

    . . . or, was it that you and others, acting as advocates for in effect evolutionary materialism in the name of science, imposed a “standard” that in effect attempts to redefine “science” as the best materialistic [or, “naturalistic”] explanation of the cosmos from hydrogen to humans?

    I therefore contrast the then [circa 2005] standards you evidently object to:

    Science is a systematic method of continuing investigation that uses observations, hypothesis testing, measurement, experimentation, logical argument and theory building to lead to more adequate explanations of natural phenomena. Science does so while maintaining strict empirical standards and healthy skepticism. Scientific explanations are built on observations, hypotheses, and theories. A hypothesis is a testable statement about the natural world that can be used to build more complex inferences and explanations. A theory is a well-substantiated explanation of some aspect of the natural world that can incorporate observations, inferences, and tested hypotheses.

    Scientific explanations must meet certain criteria. Scientific explanations are consistent with experimental and/or observational data and testable by scientists through additional experimentation and/or observation. Scientific explanation must meet criteria that govern the repeatability of observations and experiments. The effect of these criteria is to insure that scientific explanations about the world are open to criticism and that they will be modified or abandoned in favor of new explanations if empirical evidence so warrants. Because all scientific explanations depend on observational and experimental confirmation, all scientific knowledge is, in principle, subject to change as new evidence becomes available. The core theories of science have been subjected to a wide variety of confirmations and have a high degree of reliability within the limits to which they have been tested. In areas where data or understanding is incomplete, new data may lead to changes in current theories or resolve current conflicts. In situations where information is still fragmentary, it is normal for scientific ideas to be incomplete, but this is also where the opportunity for making advances may be greatest. Science has flourished in different regions during different time periods, and in history, diverse cultures have contributed scientific knowledge and technological inventions. Changes in scientific knowledge usually occur as gradual modifications, but the scientific enterprise also experiences periods of rapid advancement. The daily work of science and technology results in incremental advances in understanding the world.

    With the following highly significant and ideologically loaded changes you apparently supported (circa 2007, from the same link):

    Science is a human activity of systematically seeking natural explanations for what we observe in the world around us. Throughout history people from many cultures have used the methods of science to contribute to scientific knowledge and technological innovations, making science a worldwide enterprise. Scientists test explanations against the natural world, logically integrating observations and tested hypotheses with accepted explanations to gradually build more reliable and accurate understandings of nature. Scientific explanations must be testable and repeatable, and findings must be confirmed through additional observation and experimentation. As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes.

    I object!

    3] here are my reasons . . .

    a –> Since there is a clear context in which “natural” in effect in context means evolutionary materialist [i.e. “the best materialistic explanation of the cosmos from hydrogen to humans”], the second excerpt clearly and improperly begs a lot of big questions.

    b –> It is indoctrination, not education – and I say that as one who has taught in science and technology at high school and college level and has had a hand in curriculum and programme development. [You may wish to examine my discussion of science education here, which includes my own working out of a semi-definition of science (science, like many major activities and key concepts, is very hard to exactly define, i.e. I allude to the vexed debate over demarcation in phil of sci) and scientific methods in the context of briefing teachers on basic science education, a discussion I developed years before I had anything to do with debates over design.]

    c –> Further to this, I observe that statistics is a major tool used in observational and experimental studies in science, and that in hypothesis testing, it in fact articulates several tools that are precisely useful for distinguishing [I] chance, [II] law-like natural regularities and [III] design/intent/agent action as possible causal factors, in the context of situationally plausible alternative hypotheses.

    d –> Indeed, these tools are commonly used in the design of experiments, e.g. the use of control cases and various treatments, leading to ANOVA to analyse the impact of various factors to appropriate levels of confidence. So it is simply falsehood backed up by slanderous allusion, to say that “science currently has no tools to test explanations using non-natural (such as supernatural) causes.”

    e –> For: [a] non-natural has a very relevant meaning, i.e “[intentional, intelligent] agent,” and [b] all of this is in the unacknowledged context of the too often INTENTIONAL misrepresentation of Intelligent Design as being about claimed scientific inference to the supernatural, where [c] in fact ID and a lot of pure and applied science works in a context where agent-cause is a relevant consideration and methods have been developed for addressing agent action – which is in this context a very relevant meaning of “non-natural.”

    f –> I say “too often intentional,” as: if you and others of your ilk don’t know the basic context of the design inference across chance law-like regularity tracing to mechanical necessity and design, that is because of willful refusal to do basic homework on the nature and context of design theory. Sorry if that sounds harsh, but it is time to call you and your ilk to basic intellectual duty.

    4] On what ID is . . .

    I therefore, also, for purpose of basic illustration, cite Dr William A. Dembski, a leading Design Theorist, on this [in a context where he was precisely addressing the false charge that ID is principally about inference to the supernatural]:

    intelligent design begins with a seemingly innocuous question: Can objects, even if nothing is known about how they arose, exhibit features that reliably signal the action of an intelligent cause? . . . Proponents of intelligent design, known as design theorists, purport to study such signs formally, rigorously, and scientifically. Intelligent design may therefore be defined as the science that studies signs of intelligence.

    FYI, inference to intelligent action based on empirical evidence as traced through an explanatory filter is not at all the same as inference to the supernatural. (If you take time to look at my always linked, Section A, you will see that for instance the inference to intentional message, not lucky noise in communication science, is inherently an inference to design, and one that is strikingly relevant to the case of DNA studied as a code-bearing storage medium, i.e Section B. This in turn sets up the issue of body-plan level biodiversity such as may be seen in the case of the Cambrian life revolution, and thereafter the broader issue of cosmogenesis.)

    Furthermore, supernatural entities are logically possible agents that may act into certain situations that may have empirical consequences that science may study.

    That is, there are conceivably possible worlds in which such entities exist, and on critical examination of such possible worlds, we do not end in logical contradictions that reduce the world models to absurdity. So, it is improper question-begging to a priori rule out the inference to intelligent action on the grounds that it may possibly implicate supernatural agents or make them seem more plausible. For, we have no good grounds for concluding before we examine evidence and competing explanations on comparative difficulties, that this is not such a world.

    __________

    I therefore call upon you to help undo the harm you and your ilk have done.

    GEM of TKI

  124. PS: I should add that the proposed 2007 version’s words “[a]s it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause” are an indirect acknowledgement that the proposed materialistic standards are a historically unwarranted redefintion of science. [At least they don't make Judge Jones' blunder that this redefinition is centuries-old.]

    Also, given the — sadly — too often encountered evolutionary materialist, closed minded objectionism rhetorical tactic of red herrings leading out to strawman misrepresentations burned to cloud and poison the atmosphere leading to a breakdown of civil discourse and nasty power plays, it may be helpful to put this FAQ on the 2005 standards on the table too.

    In particular, given the objection on violation of procedure in 117, I note the balancing FAQs:

    Q: What is the scientific basis for the changes?

    A: Most of the changes reflect common sense and all have a solid scientific basis. They were crafted by eight members of the Writing Committee (the Authors), three of which hold doctoral degrees in the life sciences (biochemistry, entomology and medicine). They were then scientifically and educationally validated by 23 experts during 3 days of hearings in May, 2005 by 5 PhD biologists/ molecular biologists, 4 PhD biochemists, 3 PhD Chemists (2 with expertise in theories of chemical evolution – origin of life), 1 PhD Geneticist (the inventor of the Gene Gun), 1 PhD Quantum Physicist, 3 Philosophers of Science (two with PhD’s), 1 PhD Professor of Education, 3 biology teachers, a Muslim journalist and an attorney.

    Q: Why do we get conflicting reports about the changes to the
    standards?

    A: Organizations that oppose the changes are unwilling to publicly debate evolution because they falsely claim it is not scientifically controversial. To avoid a discussion of the real controversy they unfairly demean those who seek it. See http://www.KansasScience2005.com for an explanation of the strategy of the media and public relations officer of Kansas Citizens for Science: our “strategy” is to “portray” those who seek an objective discussion of evolution “in the harshest light possible, as political opportunists, evangelical activists, ignoramuses, breakers of rules, un-principled bullies, etc.” The boycott of hearings that discussed key issues of science and education is an example of this strategy – to demean rather than to discuss.

  125. Jack Krebs,

    You said

    “Jerry may not think so, but I can assure you that Jerry’s idea that all evolution does is re-shuffle genes is not supported by the evidence nor supported by the vast majority of the world’s scientists knowledgeable about these matters. It is fine with me if Jerry wants to disagree with the mainstream view, but he is wrong to say that I don’t understand the basics of evolution just because I don’t agree with his minority perspective.”

    All you or any of the world’s scientists have to do is provide some evidence. Is it too much to ask. All I have seen is micro evolution in any study that has ever been presented. The rest is speculation. All you have to do is prove this claim wrong. But all you do is commit the same fallacy over and over again, the argument to authority.

    When pressed you most often defer to some unknown experts. When you finally produced some information, it was of a trivial nature (micro evolution) that ID does not disagree with. What the scientists are doing is presenting micro evolution and then without any evidence extrapolating that to macro evolution. And you fall for it. The embarrassing thing is that you are the one who is defending science standards and who does not understand the basics of the science being debated.

    Jack, next time you should excuse yourself from the evolution debate in Kansas or anywhere else because you do not understand what it is about. Prove me or the other ID proponents here wrong. That is all we ask. There is a whole world out there that mocks and disdains those who support ID. Use them as resources. We would welcome the discussion.

  126. Allen

    During the course of evolution there ostensibly appeared many novel cell types, tissue types, organs, and body plans. Any theory of evolution must account for the origin of those. If it does not then it’s only a partial theory which avoids the most difficult questions. How is it NOT a salient question to ask if any of these occurred over 70 million years on the Hawaiian islands? I understand why you’d wish to change the subject back to microevolution. But we aren’t really concerned about microevolution. We accept that species change over time due to recombination and natural selection. What we don’t accept is random mutation & natural selection building complex structures from scratch. Not in 5 million years, not in 70 million years, not in 500 million years, and not in 3 billion years.

    I offered a testable hypothesis based on an ID theoretic view that the clades in the Hawaiin islands can all be derived from a common ancestor by rearranging genetic information that was already present in the ancestor. That you want to change the subject instead of addressing the hypothesis speaks volumes about this whole debate. We are asking for explanations about macroevolution and you change the subject to microevolution. Answer the question or admit that you can’t.

  127. I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.

    Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.–Allen MacNeill

    Voles contain the genetic information for producing not only the necessary molecules that direct the construction of other molecules but also the differentiation of cell types.

    We have NEVER observed non-telic processes doing anything like that. We have observed telic processes directing the construction of useful machinery.

    Just the processes of transcription and translation alone SCREAM of intelligent design.

  128. Allen_MacNeill at 99
    See DLH at 46, 118
    May we explore further to see if we are communicating and to find further basis for common understanding. You stated at 99:

    I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.

    1) Explanatory Filter
    It appears you may have applied the Explanatory Filter:
    1.1) Law. e.g. there is no known physical law that would cause the “(CarlVenter)” copyright;
    1.2) These characters do not appear to be caused by “chance”.
    1.3) The characters correspond to a copyright “specification”.
    1.4) The probability of these 39 characters occurring by chance is remote.
    i.e. it appears sufficiently “complex” to satisfy your perception of chance vs being caused by an intelligent agent –

    “there are only 33 + 45 + 24 + 39 + 39 = 180 characters = 360 bits.”

    Would you in principle accept the more stringent criteria of Dembski’s “Universal Probability Bound” (UPB) of about one in 10^120?
    If not, is there a probability boundary criteria that you would generally accept?

    2) Type of Intelligent Agent:
    We earlier explored assumptions of Neo-Darwinism. e.g.
    Allen at 69
    DLH at 79
    DLH at 81

    To find further common ground and communication, let me explore
    Intelligent Design Assumptions
    i.e. what assumptions I would use for a theory of Intelligent Design that you could recognize a a basis (-whether or not you personally believed them).
    Can we clarify how/why you accept intelligent causation in this case of the “artificial” genome containing “(CarlVenter)”.

    2.1) You apparently accept that a class of intelligent agents exist and that humans are included in that class.
    For an Intelligent Design Theory,
    2.2) May we accept that ID would hold:

    1) Intelligence: Direct and indirect intelligent causes exist, including human beings and intelligent systems made by them.

    2) Design: Intelligent causes design, build, and/or operate systems.

    Kairosfocus at 118 #4) states:

    I therefore, also, for purpose of basic illustration, cite Dr William A. Dembski, a leading Design Theorist, on this [in a context where he was precisely addressing the false charge that ID is principally about inference to the supernatural]:

    intelligent design begins with a seemingly innocuous question: Can objects, even if nothing is known about how they arose, exhibit features that reliably signal the action of an intelligent cause? . . . Proponents of intelligent design, known as design theorists, purport to study such signs formally, rigorously, and scientifically. Intelligent design may therefore be defined as the science that studies signs of intelligence.

    Kairosfocus further notes:

    FYI, inference to intelligent action based on empirical evidence as traced through an explanatory filter is not at all the same as inference to the supernatural. “

    If you wish to reply, could you comment further:
    2.3 Can a theory of Intelligent Design focus on detecting evidence of intelligent causation WITHOUT identifying the intelligent agent?
    i.e. Does the ORIGIN of the intelligent causation matter to you?
    2.3.1 Is it “scientific” to accept evidence of “extraterrestrial” intelligent agents?
    e.g.SETI searching for “aliens”,
    or the obelisks in 2001? Would you allow ID to examine and model such evidence?

    2.2.2) Would “science” or some “scientists” or you accept evidence of intelligent agents where the source was unknown?
    e.g., would objective empirical evidence be sufficient without knowing the identity or abilities of the causation source?

    2.2.3) Would “science” or you reject clear evidence of intelligent causation by ID as per 2.2.2, IF anyone alleged the source to be non-natural or “super-natural”?
    Or does “science”, or some “scientists” or do you have a commitment to “philosophical naturalism” regardless of the evidence?
    Can evidence of intelligent causation be recognized if the means of forming it is NOT know? OR if the capabilities of the intelligent agent are unknown or beyond what we understand?
    OR would such evidence and inference of such “aliens” or “supernatural” agents be rejected regardless, from a commitment that such do not exist or cannot be accepted?

    3) Acceptable evidence

    Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.

    3.1) Probability
    Would “science”, some “scientists” or you accept the concept in principle of the stringent Upper Probability Bound of one in 10^120 sufficient to distinguish between what is likely to have occurred by “chance” vs by intelligent causation?
    (e.g., considering that you have recognized the Venter copyright, as caused by human intelligent agents, where this has a much higher probability than this more stringent UPB)

    3.2) Specification
    Is the issue of an independent “specification” an issue?
    i.e., what constitutes acceptable “specification” vs “painting a target around the arrow”?

    3.2.1) Does the specification have to be independently specified?
    3.2.2) Does it have to be specified BEFORE the experiment? or can it be recognized after as in the Venter case?
    3.2.3) Would a precise biotic function suffice?
    e.g. defining a matching or docking pair of proteins with the boundaries of allowable variations or SNPs.

    PS See also my comments under
    Does neo-Darwinian Theory Include the Origin of Life?, particularly

    DLH @ 88
    on the distinction between OOL and neo-Darwinian evolution.

    On evidence, is “science”, or “some scientists” or are you looking for or will accept evidence for
    4.1) Irreducible Complexity
    4.3) Self reproducing organisms?
    4.2) Macroevolution?

    5) Small Free living bacteria
    One option may be to select a bacteria with a small genome that is well studied. If there are enough studies on it, one example is:
    Ocean bug has ‘smallest genome’

    Small but perfectly formed, Pelagibacter ubique is a lean machine stripped down to the bare essentials for life. Humans have around 30,000 genes that determine everything from our eye colour to our sex but Pelagibacter has just 1,354, US biologists report in the journal Science. . . . There are organisms with smaller genomes – Mycoplasma genitalium has about 400 genes. But these are all obligate parasites or symbionts, relying on other organisms to do the jobs they have abandoned. Pelagibacter is entirely self-sufficient. . . .But Pelagibacter on the other hand, accounting for a quarter of all organisms in the ocean, is a shining example of Darwin’s principle, the survival of the fittest.

    Again I provide the caveat that you can take the “scientific 5th” of not answering – if you perceive that overzealous colleagues could take you comments and damage your career.

  129. sparc,

    bfast: The HAR1F gene is an interesting thing. It consists only of point mutations, the smallest unit of mutational modification, yet it is fully irreduceably complex. The problem I see with the flagellum is that cooption and modification can still be claimed because genes contain an average of 300 nucleotides, so are not fully reduced.

    sparc: I am lost: Do admit that flagella are not irreducible complex? Or do you mean that they were not irreducible complex directly after having been designed and are still on their way to irreducible complexity? When will they accomplish this state? Once they are encoded by a single codon?

    An IC machine cannot, by definition, be the result of a Direct Darwinian pathway. Direct means that the gradual steps are selected for the improvement of the same function we find in the final machine. IC makes a direct Darwinian pathway impossible. So, only two possibilities are left: either sudden appearance of the complete machine (practically impossible for statistical considerations, unless intelligence is involved), or step by step selection for different functions, and with the target function completely inactive for natural selection. This is called an Indirect Darwinian pathway (co-option). The reason a Direct Darwinian pathway is not an option is due to Irreducible Complexity since a Direct Pathway requires that a component have positive selective pressure for its FINAL function every increment.

    Now that the basics are out of the way, sparc, your misunderstanding of bfast’s statement is based upon the mistaken belief that the mere potential for an Indirect pathway somehow makes an object “not IC”.

    Also, I believe that bfast prefers HAR1F as an example for IC since the flagellum has components with standalone separate/different functionality. Thus there is the potential for an Indirect Pathway. I don’t know much about the HAR1F gene but I’m assuming that none of the point mutations provide separate/different functionality that could be positively selected in an indirect stepwise/gradual pathway?

  130. Bob O’H wrote (#120):
    “When you’re accusing someone else of BSing (as you do further down 112), it really doesn’t help your case if you’re unable to distinguish between a bacterium and a cute furry mammal.”

    Hilarious and egregious. I apologize. My mistake still does not change my argument. Indeed the Microtus pennsylvanicus is still a machine by definition, which you conveniently ignored discussing. The vole still contains a genetic code. He’s still BS’ing if he or you or anyone else for that matter cannot come up with a purely natural cause or causes for how machines and codes come into existence. So tell me Bob O’H, what naturalistic explanation do you have that can produce a code and machine? I still pointed out that intelligent causes DO produce machines and codes EMPIRICALLY, however, you have yet to explain how a purely naturalistic cause or causes can explain such structures. Biological organisms are a type of a machine Bob O’H, with a code and transcription communication. You cannot ignore that. I showed you the definitions of code and machine.

    Come on Bob O’H, real simple for you, show me a code or machine that can come into existence without the aid of intelligent causes.

    Explain to me what causes are involved in the origin of machine and codes.

  131. RRE:

    Thank you for providing a definition of “machine”, as opposed to “tool”. On the basis of what we know, it is fair to say that your statement that other animals are incapable of producing machines and codes is empirically correct. I don’t know of any chimp or crow that has come close to making a mcahine.

    However, I find it interesting that you are willing to allow that non-human animals possess an intelligence of sorts (especially those capable of making tools). Evidently you recognize the existence of at least two tiers of intelligence in nature: Type 1 or “animal-grade” (capable of tool-making and means-end reasoning) and Type 2 or “human-grade” (capable of making machines and codes). Are there any other grades that you recognize? For you, then, ID is evidence of Type 2 intelligence.

    Finally, I have to respectfully disagree with your assertion that making a nest requires more intelligence than making a hook. As Encyclopedia Britannica puts it, “Some types of instinctive behaviour, while showing a rigid core of fixed action pattern, are still modifiable by conditioning and other learning processes… A good example is provided by the nest-building behaviour of many birds…” In other words, the process is largely innate, but requires some learning. No genuine insight, however, is required. Making a hook, as I have argued above, is novel behavior requiring a genuine insight on the bird’s part, to solve a problem that it has never previously encountered.

  132. The vole still contains a genetic code. He’s still BS’ing if he or you or anyone else for that matter cannot come up with a purely natural cause or causes for how machines and codes come into existence.

    I can tell you how machines come into existence. It’s called reproduction. I’m told there are even videos of it available on the web.

    Now, what mechanism do you have that brings machines as complex as like voles into existence? And what evidence do you have for it?

  133. Hi Leo: Welcome Back. Sorry about my misattribution on the other thread.

  134. Bob

    re; reproduction

    Like produces like. We knew that already. Anything else?

  135. Dave, I’m confused. You accept common descent, and I think you lean towards front-loading as the ID explanation. And yet you say here that “like produces like.” How do you reconcile these two? If “like produces like” then there is no way we could have life diversify and change over time. Is there something I am missing about your position?

  136. Bob O’H:

    Now, what mechanism do you have that brings machines as complex as like voles into existence? And what evidence do you have for it?

    We have historical evidence that “intelligence” can bring extremely complex machines into existance. We have historical evidence that the machines available today are much more complex than the machines available just 10 years ago. There is good reason to believe that machines much more complex than exist now will be developed via the process of “intelligence” in the near future. So “intelligence” has the recognized ability to produce extremely complex machines.

    NFV+NS has been proposed by the scientific community as a mechanism which, given enough time, can also produce extremely complex machines. There has never been a third proposed mechanism. Therefore, any serious challenge to the viability of the NFV+NS hypothesis is, by right of the fact that only two options are on the table, evidence in favor of the “intelligent causation” hypothesis.

  137. sparc:

    I am lost: Do admit that flagella are not irreducible complex? Or do you mean that they were not irreducible complex directly after having been designed and are still on their way to irreducible complexity?

    The bacterial flagellum is absolutely irreduceably complex — by definition. There are many parts to the flagellum which, if removed, render the flagellum totally incapable of flagelling, of propelling a bacterium. The definition of irreduceably complex is a series of parts which, if any one is removed, cease to perform its original task.

    However, Behe notes that it is not “totally inconceivable” that Irreduceable Complexity can evolve. It remains subject to “just so” stories, as illustrated by Matzke’s tale. I am quite convinced, however, that the flagellum, and anything else ingenious within nature, did not evolve via NFV+NS.

    The HAR1F, on the other hand, produces a ring. There is a straight segment, a loop, and another straight segment. The two straight segments are stuck together because the nucleotide* on the first is attracted to the nucleotide on the second. It does so because the pairs of nucleotides that are lined up attract each other. Its like a lock and key. We have about 50,000 species worth of proof that this is an unevolvable mechanism. The HAR1F exists in all birds and mammals, I am not sure about reptiles. In every species but man, the portion of the gene that produces this lock-key system IS EXACTLY THE SAME. Yet in man, a sequence of 18 point mutations invites the two bonding segments to allign differently, creating a larger loop **. Because of the lock-key effect, all 18 had to happen at once. REMEMBER WE HAVE 50,000 SPECIES WORTH OF PROOF THAT THE THING IS UNEVOLVABLE!

    * This is an RNA gene, rather than a protein generating gene, so it works w/ nucleotides rather than aminos.

    ** Though the specific effect of this change has not yet been determined, the gene is involved in brain development. It is believed that the larger loop makes a positive difference to the human brain.

  138. bFast, Thanks for sharing HAR1F example. Quite impressive. I wonder what an evolutionist would counter-propose.

    Two other factors that become significant in this case are the population size and rate of reproduction for large bodied organisms. As Dr. Behe examined at length in The Edge of Evolution, both of these limit how many attempts are available to an undirected process for an organism.

    For humans (or hypothetical pre-humans), both of these are far more restricting than for bacteria.

  139. ericB, “Two other factors that become significant in this case are the population size and rate of reproduction for large bodied organisms….For humans (or hypothetical pre-humans), both of these are far more restricting than for bacteria.”

    This is the core of ReMine’s claim that there has been far too much mutational change between humans and chimps to be accounted for by the theory. He has the support of the famous evolutionist Haldane. To make matters worse, he works on a calculation of 1% difference between human and chimp. The latest estimate is more like 5%. I think he has a convincing argument.

  140. Paul Glem wrote (in #119):

    “But when we get to chromosomes, there is no analogous way of being able to determine that chromosome A has a younger divergence in two species than chromosome B.”

    Actually, there is a surprisingly analogous way to do exactly that. If we find a certain sequence of nucleotides that is very similar across several individuals or groups, we can use it to construct a “consensus sequence” which can then be compared with other sequences (i.e. we can perform “inter-genomic” comparisons). If in a new individual (or species, or whatever) has a new sequence inserted into the known consensus sequence, then the simplest explanation is that this insertion took place after the consensus sequence became established. This method is quite similar to the one used by Biblical scholars to determine the order of writing of the four Gospels, BTW). By using a series of side-by-side comparisons, it is relatively easy to determine the sequence of insertions (and also of later deletions), and thereby construct an empirically verified and logically plausible chronological sequence for the construction of any well-known genome.

    The kicker is, of course, the phrase “well known”. We are only in the very beginning stages of this enterprise (equivalent to the interpretation of the sequence of strata in the geological column in, say, 1830), and only a relatively few genomes are mapped well enough to apply this method rigorously and widely. However, with increasing amounts of data derived from genome mapping experiments (such as the human genome project), it should be possible to build up a chronological sequence of the construction of genomes over many species in many different taxa.

    As to correlating this with absolute dates, that’s much harder to do. Comparing the sequences generated by such inter-genomic analyses with the data provided by molecular “clocks” has been one of the sources of skepticism about the latter, as the timing of insertions and deletions using molecular “clock” data shows an number of anomalously fast (and slow) insertions and deletions when compared with “background” mutation rates.

    Note also that the best comparisons are between non-coding (i.e. “junk”) sequences, as they are neither conserved nor altered by selection, but rather “drift” in ways that are relatively well-understood (and can be verified by standard mathematical and statistical analyses).

  141. Paul Glem wrote (in #119):

    “…or mutations are not actually effectively random.”

    As Jablonka and Lamb (among many others) have repeatedly pointed out, most mutations are clearly not random, at least not if by “random” one means “likely to happen anywhere in the genome.” As just one example, mutations are much more likely to happen in sequences of nucleotides (i.e. genes, etc.) that are actively being transcribed. This, in turn, means that environmental inputs (especially those that cause physiological stress) are likely to induce more mutations in precisely those gene sequences that are responding to that stress. Therefore, rather than being “random”, mutations tend to happen in those parts of the genome that code for structures and functions that are currently undergoing selection.

    This process is the basis for what C. H. Waddington called “genetic assimilation”, an area of extremely hot research in evo-devo at the present time.

  142. Bob O’H (in #120):

    I wondered if someone would stick their finger into that particular “mousetrap ;-) “.

    As I learned long, long ago as a teacher, never try to bluff your way through something you don’t understand. Some of your students will see right through it (and a few will deliberately set traps to destroy your credibility — these usually graduate to law school).

  143. Patrick (in #129):

    The “indirect” process you briefly describe is precisely the mechanism by which most, if not all, evolutionary adaptations are produced. As Elizabeth Vrba and Stephen J. Gould explained in “Exaptation—a missing term in the science of form” (Paleobiology 8: 4-15 (1986), many if not all “adaptations” are the product of cooptation of other structures adapted for other functions. That many evolutionary biologists and virtually all ID supporters are “pan-adaptationists” explains why this viewpoint is still misunderstood by a very large number of people.

    For more on this question, see my blog at:

    http://evolutionlist.blogspot......-real.html

  144. Allen_MacNeill (103):

    “If I understand your question about Huxley’s criterion correctly, I do indeed require more evidence for the origin of life from non-living materials, precisely because such an origin is closer to my other beliefs about how nature works. This is why I am pretty skeptical, not only of the current state of OOL research, but of the entire enterprise.”

    Thanks for responding. Sorry, I don’t think my question on Huxley was clear enough.

    Applying Huxley’s principle to the proposal of abiogenesis, it would seem to me difficult to get farther away from the spirit of Huxley’s principle than to deny the very existence of any empirical evidence against that “view which jumps with my preconceptions”.

    One doesn’t need to look to ID advocates to know there is relevant empirical evidence being produced in that field. Ask any of the OOL advocates in that field how the empirical evidence applies to (i.e. against) someone else’s theory and they will be glad to tell you. Metabolism-first will tell you the strong empirical evidence against RNA-first, and RNA-first gladly returns the favor. Ditto for every earlier proposal.

    Yet, in the thread “Does neo-Darwinian Theory Include the Origin of Life?”, you repeatedly denied that there was any relevant empirical evidence.

    To go a step further removed from the spirit of Huxley’s injunction, one could claim that evidence against abiogenesis not only does not exist but will not exist, perhaps even cannot exist. One way to render abiogenesis immune from scientific criticism would be to maintain that (unless positive evidence appears) it is a question that, as you put it, “must remain in the realm of metaphysics, rather than science“.

    So, as long as there is only evidence against abiogenesis, it is just a metaphysical question. If positive evidence appears, then it becomes truly scientific. But until then, abiogenesis is not falsifiable. It can never be disqualified as a normal scientific proposal could. It might eventually win, but until then it is effectively immune to actually losing. It can keep trying without fear of disqualification, since no amount of evidence against it is considered evidence at all. But even while trying and failing, scientists are free to confidently proclaim in public that life did arise spontaneously from non-life, we just don’t know how yet (and may never know how).

    I cannot right now think of a position on abiogenesis more distantly removed from the spirit of Huxley’s injunction than that.

    As far as I can tell, you have not allowed for any real skepticism about the “view which jumps with my preconceptions”, i.e. whether it is true that undirected processes created the life we see.

    Please correct me if I am mistaken, but it seems the skepticism only extends to whether the OOL enterprise will be able to show that that view is true, not to whether people should believe it is true. Else why insist “that there is no empirical evidence either way, nor is it likely that such evidence will eventually be forthcoming“?

    [Additional new post on the recent OOL thread.]

  145. On HARF1:

    I’ve reviewed as much of the published information on this RNA gene as I could find online (it’s spring break here at Cornell and the libraries close early). As far as I can tell, the 18 differences that have been mentioned evolved over a period of several million years. Furthermore, according to a recent report in Nature, most of those changes probably do not significantly alter the function of the gene. Rather, they fine tune the three-dimensional structure of the RNA for which it codes in such a way as to allow it to continue to form stable base-pairs within its own structure.*

    This is a very long way from the assertions made by several commentators here that “all 18 changes had to happen simultaneously” and that it would therefore be impossible for such changes to have come about in a way that conforms to the “standard evolutionary model.” On the contrary, as long as selection continued to operate on the HARF1 genetic locus, all it would take to evolve its current structure and function is a maximum of three to four minor changes in nucleotide sequence per million years. Even that estimate is probably too high, as it assumes that all of the changes that have occurred significantly alter the function of the RNA for which the gene codes, an assumption which is not supported most of the available information on the gene’s function.

    Furthermore, as we learn more about how this gene operates (right now we don’t really understand exactly what it does, only that it is correlated with changes in the structure of the cerebral cortex), it is quite possible that a sequence of evolutionary changes consistent with empirically verified functions for the gene can be worked out. It seems to me to be the height of presumption to pass judgment on these issues at the present time…unless, of course, one wants to forestall the very kind of investigations that might reveal the details of its evolutionary origins.

    *By the way, the so-called “ring” structure that some have mentioned doesn’t actually exist in the three-dimensional structure of this RNA (or any RNAs, including the rRNAs found in ribosomes). Rather, its a common convention in the schematic depiction of such RNAs in a two-dimensional diagram, intended simply to show that the “ring” sections do not base-pair with other parts of the molecule. It would be much more accurate to refer to such unpaired regions as “flattened hairpin loops”, as that’s the shape they actually have in three-dimensions.

  146. DLH posed a series of questions in post #128. However, before I can begin to answer any of them, I believe that we need to agree on exactly what we mean by “intelligent.” How can one identify whether something is “intelligent” in a way that is not simply a form of argument by analogy? That is, would someone please propose an operational definition of “intelligence” in such a way that its presence or absence can be empirically and statistically verified?

    Otherwise, arguing about “intelligent design” simply reduces to arguments from hidden premises.

  147. ericB wrote (in #145):

    “Yet, in the thread “Does neo-Darwinian Theory Include the Origin of Life?”, you repeatedly denied that there was any relevant empirical evidence.”

    Perhaps I did not make myself clear. What I asserted was not that there was no empirical evidence, but rather that all of the empirical evidence to date has been quite indirect. That is, there is no direct evidence for the OOL because no rocks from that period remain at the Earth’s surface, and even if they did, molecules (and even cells with no “hard parts”) do not fossilize.

    Ergo, all of the empirical evidence to date has been obtained via experimental and observational tests performed today. Although the results of such research are quite fascinating, there is no guarantee that the actual origin of life occurred in the way suggested by such tests.

    To use a legal term, all such evidence cannot rise above the level of “circumstantial” evidence, and although such evidence has sometimes led juries to convict suspected criminals, I honestly don’t see how it could, in scientific terms, amount to being “beyond a reasonable doubt.”

    So what? I grow tired of saying this, so this will be the last time: verification (or lack thereof) of any of the current hypotheses about the origin of life have literally no bearing on the overwhelming majority of the topics subsumed under the term “evolutionary biology”, including the “origin of species” and the evolution of humans. Darwin didn’t write about the OOL of life at all (for good reasons); who am I to gainsay him?

  148. ericB also asked:

    “Please correct me if I am mistaken, but it seems the skepticism only extends to whether the OOL enterprise will be able to show that that view is true, not to whether people should believe it is true.”

    Precisely: I’m not interested in “belief” at all. Science isn’t about “belief”, it’s about evidence obtained via empirical investigation. So far, there is an accumulating body of indirect evidence that does not contradict the abiogenetic hypothesis. I am not aware of any empirical evidence (indirect or otherwise) to the contrary. Hence, indirect evidence will almost certainly be all we will ever have. As that evidence indirectly supports the abiogenetic hypothesis, it is the only one I would currently support, lukewarm as that support is (and probably always will be).

    As to the relevance of any of this to that huge and growing body of knowledge known as evolutionary biology, I have already posted my last words on that subject. And, as it is late and this is spring break, I will probably not be returning to this venue for a while. Thank you all for a stimulating exchange of views; the only thing missing was a pint of Dublin’s best, a lack that I intend to rectify at my first opportunity. Slán agaibh!

  149. Thanks to Allen for all his thoughtful and informed posts.

  150. Allan_MacNeill (144):
    I followed into your interesting link.

    not all of the characteristics of living organisms are adaptations (i.e. some of them are the result of pure “chance,” not necessity), and

    If I understand correctly, one such contingent feature that Gould specifically mentions in 8 Little Piggies is pentadactile phenomenon. Thought the first quadrupeds had more than 5 digits per limb, since 5 was settled on, it has not been exceeded by any known species. This phenomenon rightly baffled Gould. He felt that it should be seriously studied because there was no reason for this restriction within his field of expertise. To some extent it has been studied. We know that polydactilism occurs naturally on occasion in at least 4 species: humans, dogs, cats and mice. In all cases it is caused by a single point mutation. I suggest that this is an example where nature has actively avoided an available solution without natural explanation. I suggest that it is evidence that the laws of randomness and contingency are not in control of nature.

    the surprising outcome has been that even some gene sequences that were thought to have been very important in selection (due to having been “conserved” over deep evolutionary time) are apparently insiginificant or even useless. We know this because knocking them out of the genome has no discernible effect on the survival or reproduction of the “knock-out” progeny. If one is the kind of “pan-adaptationist” that Lewontin and Gould criticized, this outcome should come as a severe shock, as it should to every IDer.

    Oh contrair. This is absolutely predicted by the front-loading hypothesis. It is certainly within the scope of what we would expect witin the ID framework. As far as fitting with the NFV+NS definition of evolution, well, it doesn’t! Within materialistic evolution there is only one DNA pereservative, natural selection. If a modification to DNA can occur without producing an inferior organism, the theory says that it will be tried.

    This position was made very clear when I debated this issue at telic thoughts. I debated with a biologist who suggested that the current studies did not go far enought to prove that the sequences in question offered no selectable advantage. However, he agreed, rightly, that if it were so established, the universality of the theory would have to be abandoned — that there must be something more than NFV+NS to explain these results.

    You said:

    But, if one is a true “Darwinian” (i.e. a devotee to that tradition which questions absolutely all assumptions, including the very existence of “adaptations” and “species”), it should come as no surprise at all.

    I would say that you are absolutely correct in this statement, if what you mean is:

    A true Darwinian is one who accepts the Darwinian religion unquestioningly. Evidence to the contrary be damned!

  151. Allan_MacNeill at 147 per DLH at 128
    Re: Definition of Intelligence You asked:

    we need to agree on exactly what we mean by “intelligent.” How can one identify whether something is “intelligent” in a way that is not simply a form of argument by analogy? That is, would someone please propose an operational definition of “intelligence” in such a way that its presence or absence can be empirically and statistically verified? Otherwise, arguing about “intelligent design” simply reduces to arguments from hidden premises.

    Good question on exploring for hidden presuppositions.

    Please start by reviewing:
    ID Assumptions
    These begin with:

    Intelligence
    Direct and indirect intelligent causes include intelligent beings, and systems formed by intelligent beings. Humans exercise and describe actions they ascribe to intelligence. E.g., communicating, interacting with issues and problem solving, and use objects designed and built by intelligent beings.

    Are these “ID Assumptions” necessary – and sufficient?

    I would pragmatically state that “intelligence” is a common characteristic of the class of “intelligent beings” as demonstrated by activities of the subclass of human beings. In particular, intelligence is demonstrated by: communicating, interacting with issues, and problem solving, and using objects and systems designed and built by intelligent beings.

    Does this definition satisfy you?

    (If it would help, I would add that: “Intelligence is distinct from the operation of natural law and chance.” (following the Explanatory Filter).
    However, some complain that doing so results in a tautology or circular argument.)

    Following are some further links on Intelligence & ID:
    Defining Intelligence at ResearchID
    This further discusses: awareness, self awareness, foresight, imagination, knowledge, thought experiments, understanding, volition, and wisdom.

    Intelligent Design ISCID Encyclopedia

    Intelligent Design New World Encyclopedia

    Mathematician and philosopher William A. Dembski rejects Sober’s criticism and defends the analogy. “We infer design regularly and reliably,” Dembski wrote, “without necessarily knowing the characteristics of the designer or being able to assess what the designer is likely to do… We do not get into the mind of designers and thereby attribute design. Rather, we look at the effects in the physical world that exhibit clear marks of intelligence and from those marks infer a designing intelligence. This is true even for those most uncontroversial of embodied designers, namely, our fellow human beings. We recognize their intelligence not by merging with their minds but by examining their actions and determining whether those actions display marks of intelligence” (Dembski 2004, pp. 192-193).

    As Dembski put it in The Design Revolution (2004): “The fundamental claim of intelligent design is straightforward and easily intelligible: namely, there are natural systems that cannot be adequately explained in terms of undirected natural forces and that exhibit features which in any other circumstance we would attribute to intelligence.”[17]

    #17 Dembski, W. A., The Design Revolution: Asking the Toughest Questions About Intelligent Design (Downers Grove, IL: InterVarsity Press, 2004), 27.

    PS As an example, since you asked about it, I consider you to be an instance of the subclass of human beings and to demonstrate intelligence by your communications here. Similarly, the computer, software, communications system and internet that you are using are further evidences of humans applying intelligence.
    PPS Thanks for your marathon fortitude in posting and interacting.

  152. bFast @ 137:

    We have historical evidence that “intelligence” can bring extremely complex machines into existance. We have historical evidence that the machines available today are much more complex than the machines available just 10 years ago. There is good reason to believe that machines much more complex than exist now will be developed via the process of “intelligence” in the near future. So “intelligence” has the recognized ability to produce extremely complex machines.

    So, a vole will be designed in the future. Will this be before or after the invention of the time machine? :-)

    More seriously, I think you’ve made my point – we don’t know of any intelligence that is capable of designing something as complex as a vole. Unless one wants to claim knowledge of one of the many revealed religions.

  153. Bob

    we don’t know of any intelligence that is capable of designing something as complex as a vole

    Yeah but intelligence is the only thing we know of that remotely approaches designing things as complex as a vole. A space shuttle along with all the associated manufacturing and support facilities may not be as complex as a vole but it approaches it.

    The laughable thing here, Bob, is that you are asking design engineers to agree that a recursive, mechanical trial and error mechanism bounded in time and space can produce things more complicated than the space shuttle and all its manufacturing and support infrastructure. Any design engineer who uncritically accepts that without demonstrable proof should have his head examined. The problem isn’t with the mechanism but rather in the bounds. Given an infinite number of trials the mechanism is adequate but the number of trials isn’t infinite. It’s bounded by the size and age of the universe.

  154. Allen

    For our purposes we need two definitions: intelligence and intelligent agency.

    I propose that intelligence be defined as the ability to conceptualize patterns of matter and energy that aren’t known to exist in the real world. In other words intelligence is the ability to form abstractions or perhaps more apt is the ability to imagine things. Intelligent agency is the ability to translate what’s imagined into physical reality.

    For instance we humans have long been able to imagine walking on the moon and eventually our ability as intelligent agents translated our imagination into reality.

  155. Participants (esp. Mr Krebs and Dr MacNeill):

    Interesting onward exchanges.

    I further intervene for two reasons.

    1] Mr Krebs:

    Above, you made a serious accusatory statement regarding those on the other side of a curriculum dispute in Kansas.

    I responded, at what is now 124, challenging you to substantiate your claims in light of certain considerations on the objective definition of science and related observations on rhetorical and regulatory tactics.

    You have further interacted at 150, and I see that there is silence on a situation where you have asserted serious accusations; accusations that cannot just be left to stand on one’s say-so.

    That silence, sir, if deliberate, is telling — and not in your favour.

    So, I think you need to respond, and respond cogently on the substance.

    2] A private contact

    One of the lurkers has contacted me and suggests that I [and/or others] should raise a point on the main focus of the blog.

    I will do so, without endorsing the remarks, to see what the more biologically oriented participants have to say:

    +++++++

    From Lurker X, as excerpted and re-organised:

    First, a context:

    Allen_MacNeill: “An interesting question is, did this fusion event have anything directly to do with the genetic and phenotypic divergence between the two lines of primates that eventually became chimps and humans? The answer is not immediately obvious, as simply fusing together two chromosomes doesn’t change the genetic information they carry nor how it is expressed, it only changes how it’s segregated during meiosis.

    It does, however, strongly suggest that the two evolving lines of primates were sufficiently isolated from each other for long enough for such genetic differences to accumulate. …”

    X’s remark on its underlying significance as he sees it:

    [E1] . . . the problem for ‘modern evolutionary theory’ is that the best scientific and medical knowledge tells us that at the critical juncture, the logically necessary individuals to “explain” the difference of the human karyotype [in effect, chromosome set] from the ape karyotypes will have a reduced fertility.

    Furthermore, the only way to even *get* the human karyotype in the first place is by the breeding together of such relatively infertile individuals (in which crossings their individual infertility is multiplied).

    [E2] this particular hypothetical (and necessary, if humans are related to apes) chromosomal fusion … according current scientific and medical knowledge … will serve to reproductively isolate the two species of proto-humans and hypothetical-parent-species.

    BUT . . . this reproductive isolation *also* applies at the proposed (and necessary for ‘modern evolutionary theory’) beginning of the formation of the proto-human species as a distinct breeding population.

    What I mean is: the same facts that would explain why the (assumed) proto-human species and hypothetical-parent-species are reproductively isolated at some time after the hypothetical chromosomal fusion event *also* explain that the very first proto-humans (and indeed, the very first single individual proto-human) are reproductively isolated from the hypothetical-parent-species.

    Dr MacNeill, just on a point of interest [for, to me, the issue of speciation and chromosome fusion events of humans relative to chimps is of relatively little significance relative to the origin of the information that makes us so different from our alleged chimp cousins, much less the overall origin of biofunctional, complex information challenge that is best illustrated by the macro-level diversity in the Cambrian revolution and in OOL], what is your response?

    +++++++++

    Okay,

    GEM of TKI

  156. Allen

    the surprising outcome has been that even some gene sequences that were thought to have been very important in selection (due to having been “conserved” over deep evolutionary time) are apparently insiginificant or even useless. We know this because knocking them out of the genome has no discernible effect on the survival or reproduction of the “knock-out” progeny. If one is the kind of “pan-adaptationist” that Lewontin and Gould criticized, this outcome should come as a severe shock, as it should to every IDer.

    No shock to me. I’d already settled on a front loaded genome as the best explanation for phylogenesis. I called it a phylogenetic stem cell. My hypothesis required something other than natural selection that could preserve genetic information. It needs a mechanism for preserving unexpressed genome content over very long spans of time. Given the common mantra that “evolution is cleverer than you are” and given that I’m clever enough to devise ways to insure data integrity well beyond what’s required for my hypothetical front loaded genome (see here) it’s not a problem from a design theoretic view to preserve unexpressed genomic information for billions of years.

    So it came as not a shock but rather a pleasant surprise that evidence of such a mechanism was discovered. It was a shock to the neo-Darwinists but not to me. I wrote about it over a year ago here.

    I followed what the researchers have done since the shocking finding that deleting 2 million base pairs containing 1000 highly conserved non-coding sequences in a mouse genome produced GM mice with no detectable abnormalities. One might have thought they’d want to know what the hell conserved all that genetic code but they didn’t. The problem, Allen, is that no one is interested in testing natural selection anymore. It’s moved beyond theory to dogma. No one tests dogma. So instead of testing the theory that natural selection is the only force working to conserve genetic information they simply assumed there must be some unobserved selective advantage in the deleted code and left it at that. Dogmatic belief in chance & neccessity was a “science stopper” in this case, Allen. The researchers were interested in using conserved sequence knockouts to identify function of the sequences. Finding none in non-coding sequences highly conserved between man and mouse over some 180 million years of reproductive isolation, instead of asking why those sequences had no evident function they instead just brushed it off and decided to go further afield and do knockout experiments with sequences conserved between man and amphibian, man and reptile, and man and fish. So one of the most startling findings I’ve ever seen, a finding that would negate everything we think we know about natural selection and conservation of genomic information, was set aside as not interesting enough to investigate further. In the immortal words of the Saturday Night Live church lady “isn’t that just precious?” :-)

  157. kairos

    Good point. The fusion event in a primate ancestor ostensibly happened in a single offspring. A haploid 24 parent birthed a haploid 23 offspring. How was this rare mutation propagated? Anyone? Allen?

    One hypothesis that I really like is that endogenous retroviruses cause the same mutation to happen in a large number of individuals in the same generation. Individuals in contagious contact are also in breeding contact. Greg Bear in the science fiction work “Darwin’s Radio” used this hypothetical mechanism as a plot element. He spun a story (in grand Darwinian fashion) of a network of endogenous retroviruses being activated by an environmental stimulus to spawn Homo sapiens sapiens from Homo sapiens neanderthalensis in a saltation and then the same mechanism was triggered again in the present to saltationally produce a new species from H.sapiens sapiens. The new species of human was incapable of lying to other humans of the new species. What set them apart from their parents is they involuntarily communicated thought and emotion through pheromones and skin color changes. In more poetic language they wore their hearts on their sleeves. Imagine a world where lies can’t be told. Or better yet read what Bear imagined that world would be like… Lest one pooh-pooh this because it’s science fiction one should first read the review of it written by accomplished geneticist Michael Goldman and published in Nature.

  158. Dave:

    I see your:

    One hypothesis [BTW -- any specific testable evidence for it?] that I really like is that endogenous retroviruses cause the same mutation to happen in a large number of individuals in the same generation. Individuals in contagious contact are also in breeding contact

    Where this gets real interesting for me is, where does this retrovirus get its human-making, functionally specified and highly complex information from?

    But also, Lurker X was raising an issue of lowered fertility, compounded through interbreeding.

    So, I’d love to hear more on it . . .

    GEM of TKI

  159. All right; so let’s concede (just to be nice–it is Sunday, after all) that the indirect evidence does not absolutely contradict abiogenesis. How then do we get, within a couple of short sentences, to the bold assertion that the evidence supports abiogenesis? There is quite a wide chasm between these two stances. We know that the gap between them cannot be bridged by direct empirical evidence. What could possibly be strong enough to hold them together in the same paragraph? Gosh, this is a tough one. I’ll have to think about it this morning in church.

  160. Hi Allanius

    I too gotta be getting up to go face the day [and will doubtless have occasion to reflect on Rom 1:1 9 – 20] — actually I had to go off to the local puddle-jumper-only airport already to see someone off. (It was interesting to sit by the a/p cafe, and hear Santo Domingo Spanish all around me, in a nominally anglophone territory!)

    I note your:

    . . . let’s concede (just to be nice–it is Sunday, after all) that the indirect evidence does not absolutely contradict abiogenesis

    Similarly, per Sir Fred Hoyle’s famous remark, the logical and physical evidence does not ABSOLUTELY contradict the idea that a tornado passing through Seattle can assemble a flyable 747 from the various parts in a local junkyard.

    Indeed, on the foundation of the 2 LOT, my favourite Russians have this to say, as I report and comment in my Appendix A to the always linked:

    Yavorski and Pinski, in the textbook Physics, Vol I [MIR, USSR, 1974, pp. 279 ff.], summarise the key implication of the macro-state and micro-state view well: as we consider a simple model of diffusion, let us think of ten white and ten black balls in two rows in a container. There is of course but one way in which there are ten whites in the top row; the balls of any one colour being for our purposes identical. But on shuffling, there are 63,504 ways to arrange five each of black and white balls in the two rows, and 6-4 distributions may occur in two ways, each with 44,100 alternatives. So, if we for the moment see the set of balls as circulating among the various different possible arrangements at random, and spending about the same time in each possible state on average, the time the system spends in any given state will be proportionate to the relative number of ways that state may be achieved. Immediately, we see that the system will gravitate towards the cluster of more evenly distributed states. In short, we have just seen that there is a natural trend of change at random, towards the more thermodynamically probable macrostates, i.e the ones with higher statistical weights. So “[b]y comparing the [thermodynamic] probabilities of two states of a thermodynamic system, we can establish at once the direction of the process that is [spontaneously] feasible in the given system. It will correspond to a transition from a less probable to a more probable state.” [p. 284.] This is in effect the statistical form of the 2nd law of thermodynamics. Thus, too, the behaviour of the Clausius isolated system above is readily understood: importing d’Q of random molecular energy so far increases the number of ways energy can be distributed at micro-scale in B, that the resulting rise in B’s entropy swamps the fall in A’s entropy. Moreover, given that FSCI-rich micro-arrangements are relatively rare in the set of possible arrangements, we can also see why it is hard to account for the origin of such states by spontaneous processes in the scope of the observable universe.

    In short, there are two senses of exclusion: something may be outright logically absurd or physiucally impossible relative to our observed cosmos. But also, we may see something that as far as bare possibility is concerned, is not forbidden, but is so utterly improbable that it — reliably — will not be observed to occur.

    In the case of things that exhibit functionally specified, complex information beyond the Dembski-type universal probability bound, we see complexity [i.e low inherent probability, or high contingency/ large information storage capacity] and tight functional specification of the observed configuration which combine to make intelligent agency a better explanation than chance + necessity only. For, whenever we directly know the origin of an item that exhibits FSCI, it is the product of an agent. [E.g. the long enough posts in this thread are the product of agents not lucky noise.]

    So spontaneous origin of life by chem evo etc does not meet absolute logical or physical roadblocks, but is so utterly complex and specified that it falls into a class of entities that we know through experience and observation are the routine product of agents. But, that is plainly cutting across some “preferred” – i.e materialist — scenarios on origins so it is being resisted by power holders in a lot of relevant institutions.

    GEM of TKI

  161. Allen,

    Science has demonstrated that only life begets life.

    So where does that leave non-telic abiogenesis?

    Bob O’H:
    I can tell you how machines come into existence. It’s called reproduction.

    Production is also how machines come into existence.

    As for reproduction, if you want to use that then you have to demonstrate how it came into exitence.

    Bob O’H:
    More seriously, I think you’ve made my point – we don’t know of any intelligence that is capable of designing something as complex as a vole.

    We don’t know of ANY mechanism capable of creating a vole.

    So we go with what we do know- that is every time we observe complex specified information and know the cause it is ALWAYS via some agency- always. And until someone can come along and demonstrate that CSI can arise without an agency it is safe to infer all CSI requires agency involvement at some level.

  162. I grow tired of saying this, so this will be the last time: verification (or lack thereof) of any of the current hypotheses about the origin of life have literally no bearing on the overwhelming majority of the topics subsumed under the term “evolutionary biology”, including the “origin of species” and the evolution of humans.-Allen MacNeill

    That’s false. Again if living organisms were designed then most likely their subsequent evolution was part of the design.

    If humans, or any organism, was a target- an intended outcome- then the current ToE would require a major overhaul.

    Darwin didn’t write about the OOL of life at all (for good reasons); who am I to gainsay him?–Allen MacNeill

    Darwin didn’t know any better. You should.

    I would go even further to say had Darwin known what was in that black box called a living organism he would not have written “On the Origins of Species….” or it would have been a pro-ID book if he had.

  163. Kairofocus writes,

    Above, you made a serious accusatory statement regarding those on the other side of a curriculum dispute in Kansas.

    I responded, at what is now 124, challenging you to substantiate your claims in light of certain considerations on the objective definition of science and related observations on rhetorical and regulatory tactics.

    You have further interacted at 150, and I see that there is silence on a situation where you have asserted serious accusations; accusations that cannot just be left to stand on one’s say-so.

    That silence, sir, if deliberate, is telling — and not in your favour.

    In unrealistic of you to be drawing inferences based on lack of response – people are often busy (I was yesterday), and the fact that I threw in a little cheerleading post doesn’t mean that I had time to respond to your lengthy post earlier. So I suggest you lighten up a bit.

    I also am not quite sure what “serious accusatory statement” I made “regarding those on the other side of a curriculum dispute in Kansas.” The part of my post that you quoted was

    [JK, 117:] I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . .

    Where is the “serious accusatory statement” here? Everyone of the points in that quote is a factual statement (except for the word “good”, which is my and many others judgment about the standards.) I know I disagree with what the minority did, but disagreement isn’t accusation.

    Now the substantive topic that you want to discuss is the description of the nature of science issue in the Kansas standards, and I do intend to respond to that, as it is an important topic. So just stay cool and I’ll try to get something written today.

  164. So we go with what we do know- that is every time we observe complex specified information and know the cause it is ALWAYS via some agency- always.

    Can you show me the calculation of CSI in the vole, please? Just the reference will do.

  165. The OOL life issue has been traditionally not part of the evolution debate from the start. One can decry this but it is a fact that those who were involved in the debate did not discuss OOL.

    Pasteur’s study which eliminated spontaneous generation as a cause of life’s origin happened after Darwin published the “Origin” when his work was publicized in 1864. The cell as the basic structure for life itself was only discovered about 20-30 years before the “Origin” and it took till the 1880′s to discover mitosis or almost 30 years after the “Origin.” During this time the evolution debate was in high gear without any consideration of the cell.

    Even in the 20th century the complexity of the cell was not fully understood and the ubiquitous term, protoplasm, was used to describe the contents of the cell. By this time the modern synthesis was formed and genetics well established but no understanding of DNA was known.

    Now you can argue from retrospect that the debate on evolution should include biogenesis but traditionally the evolution debate had no need for it. When the debate moved into the micro-biology era maybe OOl issues should have been considered but the evolutionary biologists were more interested in a system that explained the evolution of life not the creation of life so it never became an issue for them.

    So we here can take pop shots at the current dichotomy but the evolutionary biologist can claim they are quite different issues and that people in the two fields really study different processes. And for the most part I agree. What I have read in both areas, there is usually little in common in what they study or the type of research they do.

    A lot of ID looks mainly at the issue of the creation of DNA as well as evolutionary biology issues. Evolutionary biology looks only at the expansion or reorganization of the DNA. ID looks at both issues. I consider most of Dembski’s work at one end of the life debate, namely its creation. Behe’s work is at the other end or the naturalistic changes of DNA once it is there examining the effect of point mutations or more complicated mutations and do they really exist.

    So even if we do not agree with the distinction between the two areas, we should understand why they exist. It is not a conspiracy.

  166. Bob

    Can you show me the calculation of CSI in the vole, please? Just the reference will do.

    The whole vole is intractibly complex and it’s unneccessary to consider the whole animal. We can take just one tiny bit of the vole and analyze the CSI of that bit. How about we use the vole’s ATP synthase as the bit to analyze? As a bonus we get to apply the same analysis to every other living thing on the planet.

  167. DaveScott at 157 & Allen et al.

    even some gene sequences that were thought to have been very important in selection (due to having been “conserved” over deep evolutionary time) are apparently insiginificant or even useless. We know this because knocking them out of the genome has no discernible effect on the survival or reproduction of the “knock-out” progeny.

    This sounds suspiciously alike evidence for large scale robust design that can tolerate major damage and still function. e.g. by redundant or duplicate or parallel pathways.

    See Peter Borger Genetic Redundancy: The Ultimate Evidence of the Design of Life

    Over the past two decades scientists have observed the peculiar biological phenomenon of genetic redundancy, which pertains to genes or genetic systems that seem to have no obvious function. Indeed, genetic redundancy is now defined as the situation in which the disruption of a gene is selective neutral. Genetic redundancy is the resultant of cooperating scale free genetic networks that provide robustness to organisms. One of the biggest surprises of modern biology genetic redundancy terminates Darwin’s era of natural selection.

  168. That seems reasonable. Can you show the calculation of the CSI in the vole’s ATP synthase?

  169. Jack

    One of the other authors here (DLH?) who’s a fan of ATP synthase as an icon of intelligent design can insert himself here.

    Allen

    I feel your weariness over saying that OOL has no bearing on evolutionary biology. I’m just as weary in pointing out that if your assertion is true then evolutionary biology should have no objection to a very complex beginning wherein all the diversity of life today existed as unexpressed genomic information in one or several common ancestors hundreds of millions or billions of years ago.

    Either say evolutionary biology has no problem with an uber-complex genome as the starting point for descent with modification or admit that OOL does indeed figure prominently into evolutionary biology. Actions speak louder than words, Allen. The mere mention of descent with modification beginning with complex intelligently designed forms invariably brings on shouts of protest from evolutionary biologists. Prove to me first that you’re an exception to the rule then most importantly prove to me that it isn’t a rule at all.

  170. Jack, you took the words right out of my keyboard!

    Joseph and Dave – let’s see your calculations!

  171. Bob & Jack,

    let’s see your calculations!

    Very well.

    ATP synthase:

    Complexity > 500 bits

    (I couldn’t quickly find the number of amino acids in ATP synthase but hope you’ll agree it’s greater than 100 residues at 5 bits per residue)

    Specification = storage of energy for use by other sub-cellular machines

    It should be mentioned that this needs to run through the explanatory filter which adds the requirement that no known physical laws make the CSI in the ATP synthase machine much more probable than any other similarly complex pattern of residues.

  172. But this assumes that all parts of the ATP synthase came together simultaneously and by pure chance, which is an unverified assumption and is certainly not a hypothesis made by any one studying this topic.

  173. Jack

    You asked me to calculate the CSI of ATP synthase. I did that. It’s my turn now to ask you for a calculation. Show me a plausible and likely path for law and chance to assemble an ATP synthase molecule. The ball is now in your court. Failing that we can then analyze the CSI of a lead acid battery and show that intelligent agency is a mechanism which can produce similarly complex means of energy storage. Or you can just concede the point right away and save us both the effort of belaboring the obvious.

  174. The crux of the matter here is that intelligent design proponents can point to a mechanism (intelligent agency) which can demonstrably create specified complexity but we can’t point to a known instance of such agency in the prehistoric past. On the other hand chance & neccessity proponents can point to a mechanism which did exist in the distant past (mutation & selection) but can’t demonstrate it has the capacity to produce specified complexity. It would seem we’re at a stalemate for the time being. If your side would admit the stalemate and give intelligent design a fair hearing alongside chance & neccessity I’d have no further objections. Let the ideas speak for themselves. Of course that’s not acceptable because you very rightly fear that your explanation has little credibility compared to ours.

  175. Dave, I don’t understand your calculation. First, where does the 500 bits come from? And secondly, how does the specification fit in?

  176. The 500 bits comes from 5 bits per amino acid in the molecule. There are 20 possible amino acids. 5 bits is the smallest possible container size that can specify one of twenty possibilities. If you don’t understand that I suggest you brush up on binary arithmetic.

    The specification fits in where one possible arrangement of 500 bits of information can be independently described. If you don’t understand that we need to talk about Granville’s example in statistical mechanics. Take all the possible arrangements of matter that can be made out of that which comprises a space shuttle. The vast majority of such arrangements won’t meet the specification of being able to carry passengers to earth orbit and return them safely. That specification is for all practical purposes statistically impossible for law and chance alone to assemble from the vast number of other arrangements of matter which don’t meet the specification.

    If you can’t describe how law and chance can assemble an ATP synthase molecule from the 10^150 (or more) other possible arrangements of 100 (or more) amino acids then we have a problem in that statistical mechanics says it’s practically impossible for this to happen by law and chance alone.

    The ball is in your court. I’m quite willing to hear you describe how law and chance work together to make the composition of ATP synthase much more probable than any other possibility.

    Of course that’s far less than just the tip of the iceberg in the vole, Bob. The next problem is paradoxical. Which came first, the cellular machinery that relies on ATP to function or the machine that makes ATP for them? Modern knowledge of the nanometer scale complexity in living cells has really brought intelligent design into focus. Story telling about how the camera eye might have formed by gradual improvements is easy compared to explaining how the carbon based nanotechnology in the simplest living cell formed out of inanimate chemicals.

  177. bFast (140):

    “This is the core of ReMine’s claim that there has been far too much mutational change between humans and chimps to be accounted for by the theory. He has the support of the famous evolutionist Haldane. To make matters worse, he works on a calculation of 1% difference between human and chimp. The latest estimate is more like 5%. I think he has a convincing argument.”

    It seems that matters would be even worse than worse, if we consider two other qualifications that don’t even show up in the X% figure.

    1) The traditional X% figure only considered differences in protein coding sequences in DNA, not the rest of DNA, which now is known to be able to influence interpretation.

    2) Even in regard to coding DNA, the traditional X% figure ignores sections where chimps and humans have nothing in common. It only measures differences in shared coding regions.

    More here: re: Speaking of Comparisons, Two Common Huge Oversimplifications

    Now I wonder if evolutionists who complain that IDers don’t do more research would support giving science grants to fund research by those who would investigate the limits of evolutionary change? (Not holding my breath. ;-)

  178. 178
    irreducible_complacency

    Dave do you think that it is possible to systematically use taxonomic characters in calculation of CSI? If species are related to each others like the evolutionists say then surely it is possible to use comparisons between things like voles and analyze them in terms of how much information is shared and how much is different between these supposedly related species of voles.

    If instead we look at DNA as a program, the question of whether or not it had a designer has no bearing on our view of how it functions and is expressed. It seems that one could compare these things across taxa without even making the evolutionary assumptions. this means not drawing the trees that darwinists always point at and say see this proves you are just an animal, but the hard math is the same. Just no hidden metaphysical assumptions. Wouldn’t this standardize our observations of CSI added or subtracted between species?

  179. Re: “where does 500 bits come from?”

    One small point. Some may not know the connection between “500 bits” and “10^150″.

    There are 2^500 different possibilities with 500 bits. If you use Google’s handy calculator feature by typing in 2^500 in the search box and pressing return, you will see that 2^500 equals 3.27339061 × 10^150.

    So they are two different ways of expressing essentially the same number and the same probability bound. One in 2^500 is about one in 10^150.

  180. The 500 bits comes from 5 bits per amino acid in the molecule. There are 20 possible amino acids. 5 bits is the smallest possible container size that can specify one of twenty possibilities. If you don’t understand that I suggest you brush up on binary arithmetic.

    You still haven’t explained where it comes from. Is it the probability that a random sequence of 100 amino acids would have one particular sequence? i.e. 20^-100? If so, I’d like to see your response to Jack’s point.

    The specification fits in where one possible arrangement of 500 bits of information can be independently described. If you don’t understand that we need to talk about Granville’s example in statistical mechanics. Take all the possible arrangements of matter that can be made out of that which comprises a space shuttle. The vast majority of such arrangements won’t meet the specification of being able to carry passengers to earth orbit and return them safely. That specification is for all practical purposes statistically impossible for law and chance alone to assemble from the vast number of other arrangements of matter which don’t meet the specification.

    Your specification was of the form “it does something”. It said nothing about the range of possible amino acid sequences that could accomplish this task.

  181. Just a few questions: How would a designer design the DNA encoding ATP Synthase? Two separate strands that he later annealed? Would he synthesize a single strand 5′–>3′ or 3′–>5′? Would he put in introns early or late? And what about codon usage?

  182. Dave,

    Either say evolutionary biology has no problem with an uber-complex genome as the starting point for descent with modification or admit that OOL does indeed figure prominently into evolutionary biology. Actions speak louder than words, Allen. The mere mention of descent with modification beginning with complex intelligently designed forms invariably brings on shouts of protest from evolutionary biologists. Prove to me first that you’re an exception to the rule then most importantly prove to me that it isn’t a rule at all.

    Allen “sort of” answered that question back in these 2 comments:

    My suggested “middle ground”.

    The response

    Essentially it sounds like he wants a long-term ID research program established before he’d consider accepting it.

  183. DaveScott at 177
    A refinement on the calculations is incorporate the “degeneracy” (or “redundancy”)* or duplications in the DNA coding resulting from 20 amino acids out of a 4^3 or 64 bit coding space. This amounts to about 4.139 bits per codon rather than 6 bits. However, we then have overlapping DNA coding as Yockey calculates:

    As I have shown in Table 6.3, sites that have functionally equivalent amino acids have information content lower than 4.139 bits.

    Hubert P. Yockey (2005 p 92) Information Theory, Evolution, and the Origin of Life, ISBN 978-0-521-80293-2.

    Let’s use 4.139 bits/codon for such ballpark estimates.

    * PS. Yockey (2005, Sect 5.2 p 42) vehemently insists on describing the genetic code as “redundant” rather than “degenerate”. I am unpersuaded and believe “degenerate” better describes reality.

  184. Five observations about Allen_MacNeill’s OOL response.

    1) Allen defeated his own argument about OOL when he clarified the meaning of the main premise.

    2) The rosy picture Allen painted of the state of OOL research does not correspond to reality.

    3) Allen failed to really engage the issue that he was ignoring empirical evidence against abiogenesis (thereby violating the spirit of Huxley’s principle).

    4) Instead, Allen reemphasized points that were not in dispute.

    5) Nevertheless, among evolutionary biologists who engage in dialog, Allen is exemplary as a scholar and gentleman.

    My overall observation is that, under the influence of the materialism’s blinders, the possibility that undirected material processes may be insufficient tends to not even enter into consideration. It is not rejected so much as invisible.

    For the details on each observation, please see the post Observations on Materialism’s Ideological Blinders Impeding Science.

    p.s. Does anyone have any good links to information on the metaphysical basis that supported the expectation that alchemy was true? Thanks in advance.

  185. Bob O’H (153):

    More seriously, I think you’ve made my point – we don’t know of any intelligence that is capable of designing something as complex as a vole. Unless one wants to claim knowledge of one of the many revealed religions.

    It is true that we don’t know of any intelligence that is capable of designing something as complex as a vole. It is true that we don’t know of any intelligence capable of designing something as complex as any living organism. We certainly don’t know of any intelligence capable of designing something as complex as the highly tuned big bang event.

    Our inference of design in all of these instances is an extrapolation from what we know. The “fact” of a naturally occurring OOL is also an extrapolation. The fact that bacterial flagellum evolved via NFV+NS is also an extrapolation. As speciation has never been truly observed, even speciation is an extrapolation.

    I suggest that ID’s inference in this matter is much less of an extrapolation than materialism’s.

  186. Participants:

    First, I see that Mr Krebs, sadly has shown us all [164 – and note how he leaves off reference numbers so it becomes hard for typical readers to check him . . .] that he, on the evidence of what he did overnight, has a challenge in reading text accurately and fairly, and in responding to issues on the full balance of the merits:

    GEM, 156: Mr Krebs: Above [i.e. 117], you made a serious accusatory statement regarding those on the other side of a curriculum dispute in Kansas.

    I responded, at what is now 124 [cf 123 – 4], challenging you to substantiate your claims in light of certain considerations on the objective definition of science and related observations on rhetorical and regulatory tactics.
    You have further interacted at 150, and I see that there is silence on a situation where you have asserted serious accusations; accusations that cannot just be left to stand on one’s say-so.

    That silence, sir, if deliberate, is telling — and not in your favour.
    So, I think you need to respond, and respond cogently on the substance.

    JK, 164: In unrealistic of you to be drawing inferences based on lack of response – people are often busy (I was yesterday) . . . . I also am not quite sure what “serious accusatory statement” I made “regarding those on the other side of a curriculum dispute in Kansas.”

    Of course, in excerpting his own remarks at 117, he then proceeded to a telling ellipsis that makes it appear that I am making up a strawman to attack:

    I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . . [LEFT OUT, the immediately following words: by a Board who ignored the very processes for writing curriculum that they had established . . . ]

    So, sir, there is an answer to your: Where is the “serious accusatory statement” here? YOU LEFT IT OUT THROUGH USING A MATERIALLY MISLEADING ELLIPSIS. That tells us a lot about how you reason and argue, and — sadly — none of it good. But, let us trust that in your onward response, we will see a better, more fairly put case. (Sigh . . .)

    It is worth pausing to point out that in fact, between about 1999 and 2007, there has been a considerable back-forth in Kansas, in which the side Mr Krebs represents – what we may appropriately term, “the party of Darwin”cf. Jerry at 116] — has inserted an unfortunately question-begging, ideologically loaded, historically, logically, educationally and philosophically unjustifiable, indoctrination agenda-serving materialist [re-]“definition” of science. The other side, which he and others of his ilk have vilified, has tried to stand up for a more objective definition and approach, which I noted on at 123 – 4 above. I of course also paused to take time to follow up the other side of the claim, and met with the following FAQs cited at 124 above, in addressing the procedure violation issue he claims – and BTW, to go with a well-justified minority report, ever since the days of the 12 spies in Canaan, has often been wise [though, typically not popular, of course] :

    In particular, given the objection on violation of procedure in 117, I note the balancing FAQs:

    Q: What is the scientific basis for the changes?

    A: Most of the changes reflect common sense and all have a solid scientific basis. They were crafted by eight members of the Writing Committee (the Authors), three of which hold doctoral degrees in the life sciences (biochemistry, entomology and medicine). They were then scientifically and educationally validated by 23 experts during 3 days of hearings in May, 2005 by 5 PhD biologists/ molecular biologists, 4 PhD biochemists, 3 PhD Chemists (2 with expertise in theories of chemical evolution – origin of life), 1 PhD Geneticist (the inventor of the Gene Gun), 1 PhD Quantum Physicist, 3 Philosophers of Science (two with PhD’s), 1 PhD Professor of Education, 3 biology teachers, a Muslim journalist and an attorney.

    Q: Why do we get conflicting reports about the changes to the standards?

    A: Organizations that oppose the changes are unwilling to publicly debate evolution because they falsely claim it is not scientifically controversial. To avoid a discussion of the real controversy they unfairly demean those who seek it. See http://www.KansasScience2005.com for an explanation of the strategy of the media and public relations officer of Kansas Citizens for Science: our “strategy” is to “portray” those who seek an objective discussion of evolution “in the harshest light possible, as political opportunists, evangelical activists, ignoramuses, breakers of rules, un-principled bullies, etc.” The boycott of hearings that discussed key issues of science and education is an example of this strategy – to demean rather than to discuss.

    So, it seems to me that, on the evidence of what the party of Darwin has done, my own call to Mr Krebs at 123 above is well-warranted: I therefore call upon you to help undo the harm you and your ilk have done.

    Now, too, I took some time to look back on the thread, and see a crucial and very general point by Dr MacNeill, at 99, which leads to a key chain of reasoning:

    1] Dr MacNeill:

    I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.

    Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.

    2] To this, RRE at 112 first responded:

    Thank you for admitting genomes can be generated by genetic engineers (whether artificial or not does not even matter) — which are intelligent designers who have successfully added concept onto matter to make a machine work, in this case, a cell by manipulating its code. This genetic code coupled with the mitochondrial DNA code is the complete set of instructions for all the cell lines of the species and is especially important when placed inside of the female reproductive cell . . .

    –> In short, Dr MacNeill acknowledges, appropriately, that it is empirically well-supported that intelligent agents can make genes and insert them into living organisms.

    –> Further to this, it entails that he accepts that complex codes are in at least some cases an empirical sign of such agents at work.

    –> Now, can he identify a case within our observation that shows that such codes [beyond 500 – 1,000 bits of information] can be made by non-intelligent forces, i.e . by chance + necessity?

    –> We know as a commonplace that intelligent agents are capable of developing such FSCI, and even that we are able to make more and more complex systems which if arrayed in a temporal line will show an apparent evolutionary development but one by design [cf here Berra's infamous blunder on the Corvette's evolution]

    [ . . . ]

  187. 3] RRE then went on to a mostly-correct point (sadly, somewhat spoiled by failing to accurately refer to the cited species as a vole; which was rhetorically exploited in a way that unfortunately distracted from what he got right, crucially right):

    –> I therefore adapt his remarks slightly:

    . . . Microtus pennsylvanicus is [a complex bio-system based on the cell, i.e. on] a MICROSCOPIC MACHINE with an even smaller genetic CODE or INSTRUCTION SET to BUILD proteins [its key parts] from scratch.
    The bacterium [cell, thus also the animal built up from cells organised in tissues, organs and body plans,] fits the standard definition of a machine [AmHD: “A device consisting of fixed and moving parts that modifies mechanical energy and transmits it in a more useful form”]; you can look it up yourself. All machines when studying [for which we directly know] their origin were intelligently designed. So [from repeated and so-far exception-less empirical observation, we reliably know] it takes intelligent causes to produce them . . . .
    Show me any machine or code [M-WD: “a system of signals or symbols for communication”] that can be produced without intelligence. You cannot do it [or you would have dome so already]. Only human intelligent designers [have been observed to] make machines and codes, with the very real exception being biological organisms, which are more complex machines with a more complex code than we can make today with our own intelligent designing skills. So the finger goes back to you—YOU must empirically demonstrate a [functioning, complex] code or machine that has been caused into existence without using intelligent causes– purely naturalistic mechanisms as you say. Since you are excluding intelligent causes from your origins hypothesis a priori, as well the scientific realm when it comes to machines and codes, then YOU must provide and demonstrate empirically, a CODE and a MACHINE from some OTHER MECHANISM.

    –> In short, the onus of demonstration, once — through the discovery of DNA and the nanotechnology of proteins, ribosomes, enzynmes etc that give effect tot he information so encoded — the bridge has been opened from the molecular scale biology of the cell to issues of the design and functioning of complex codes and machines, properly lies on those who have advocated that functionally specified, complex coded information and the machinery that executes such can originate by chance + necessity only.

    –> As for Bob O’H at 165: Can you show me the calculation of CSI in the vole, please? Just the reference will do.

    Actually, we need not calculate specifically for the vole, nor do we need to go to a journal article to find the calculation; it is within reach of a 6th former who knows how to do log calculations on a scientific calculator. For, we long since know that the minimal bio-functional genome of 300 – 500 k base pairs, has complexity of 150 k bits up, or a config space in excess of 4^300k ~ 9.94 *10^180,617. If there are for the sake of argument 10^1000 relevant islands of functionality in the genome space, say of size 10^150 each, the non-functional space would be well in excess of 10^180,000 cells. That is, just to get to minimal life, we are already well into complexity of an order that makes the islands of functionality so isolated that a random walk starting from an arbitrary initial point is maximally unlikely to find any functional forms. And, since a vole as a complex animal probably has a genome of order 100′s millions to billions of base pairs, what holds for the minimal cell holds a fortiori for the vole. Indeed, the point of Meyer’s justifiably famous PBSW article was in material part, that there is a serious leap in CSI to achieve the dozens of new phyla and subphyla in the Cambrian revolution, and that for instance to get to a modern arthropod you are looking at 180 mn base prs, up from the mere millions in typical unicellular organisms. Just 500 – 1,000 bits of information storage puts us into the range where chance + necessity find themselves running out of probabilistic resources to create functionally specified, complex information bearing structures.

    –> to date, the burden to show that such FASCI can originate by chance + necessity only has not been clearly met by the evo mat advocates, and instead we see turnabout burden of proof-shifting tactics as just rebutted, or the cordoning off of the potentially decisive OOL issue as if it were not germane to the question, or — far worse – rhetorical, indoctrination [as opposed to education] and political spin tactics like trying to redefine science in such a way that the known cause of complex codes and machines is excluded from the outset.

    –> Such tactics do not lend us confidence in the theories that are being defended by using such plainly questionable means.

    4] What about the chimp-man issue?

    First, both chimps and men are made from cells, so the same issue just raised obtains. Also, there is need to credibly account on chance + necessity only, for how one gets to the complex body plan shared in common to a great extent by humans and chimps, even before we explain the observed differences. Plainly, that has not been done.
    Now, we may turn to the issues of genetic links and differences and body-plan differences:

    a –> We speak, vocalising ideas in spoken words in sound-based languages; chimps etc. evidently cannot (though of course parrots can verbalise words and in some cases may possibly understand some of what they say). How is this accounted for on the known claimed small percentage DNA differences between us and our “cousins” [was it 1%, 2%, or – per ericB at 178, 5%, and BTW where does that figure come from, and to what phenotypical significance, chromosome by chromosome?]? How has this been accounted for in terms of chance + necessity only, working through random variation and natural selection, beyond ad hoc just-so stories, i.e. on an empirically testable “scientific” basis? I see here ericB’s telling remark:

    The traditional X% figure only considered differences in protein coding sequences in DNA, not the rest of DNA, which now is known to be able to influence interpretation . . . . Even in regard to coding DNA, the traditional X% figure ignores sections where chimps and humans have nothing in common. It only measures differences in shared coding regions.

    b –> We express ourselves in complex, arbitrary verbal codes that embrace concepts of identity, action, effect, purpose, past, present, future, abstract concepts etc. The various apes etc do not. How is this accounted for on the same terms?

    c –> We have fully opposable thumbs, apes etc — as a rule — evidently do not. That seems a simple enough modification, and is plainly highly useful – it is critical to the capability of the human hand. If our populations diverged in similar environments at the same time [and were close enough to hybridise with ancestral chimps], why did we develop such full opposability fairly rapidly, while our ape “cousins” as a whole did not? Conversely, if our ape cousins did not need it to survive and thrive in evidently similar environments, why and how did we develop the fully opposable thumb? [I am here speaking to the issue of mutations, environmentally driven selection and change vs stability of organism architecture.]

    d –> In short, I am speaking to two key differences between us and our cousins: (i) the verbalising, conceptualising mind-brain system, and (ii) the hand that gives effect to what is conceived. That is, the issue is: how do we account for these key differences within the allegedly small genomic changes, and the time available and the similarity of environments in which the change vs stasis are claimed to have happened?

    e –> Further to this, how do we account for the issues on fertility and reproductive isolation vs hybridising that are associated with this thread, in the context of the key changes noted?
    _______________

    I think that these five points help put issues over chromosome 2 or the X-chromosome, etc in context.

    Namely, when we have an empirically well-supported, coherent, non ad hoc account of macroevolution and its capacity to account for complex codes, machines, body plans, mind-brain systems, language-based speech and the hand, then we will see reason to take its claims more seriously as scientifically well-established.

    GEM of TKI

  188. 188

    Karios, do you accept common ansestry or no?

  189. ERRATUM: I forgot to check myself at point 3, 10^178,000 not 10^180,000. Of course, it makes no material difference, as both are utterly beyond 10^150.

  190. Hi Frosty:

    You ask about a matter [common descent] that is irrelevant to the empirical observation of design based on FSCI.

    Accordingly, I hold no public brief either way. (And my personal views on scientific models of the projected deep past, especially here on earth, are just that — I only note that they are open to change, and have changed across my lifetime. Currently, I am far more impressed by astrophysical models than by much of what I see going on in the provinces of Biology and Geology. And, even so, I note that scientific explanations and associated theory-embedded fact claims are open to correction and even abandonment. So, I recommend critically aware open-mindedness, as scientist, educator, sci-tech oriented curriculum developer, consultant and under whatever other hats I occasionally wear. That is what gets me annoyed when I see antics by those who shape young minds through dangerously distorted and misleading educational curricula such as those I just sharply critiqued above. [Cf here Rom 1:19 - 22 in its context.])

    My interest, as the always linked will show, is that information is a critical constituent of the cosmos as we observe it in the present. When that information rises to the level of FSCI, we have good observational and theoretical grounds for inferring to agency as the decisive cause.

    That is IMHBCO, sufficient to decisively undercut evolutionary materialism [which is also logically incoherent via reductio ad absurdum], and once that is done, it is sufficient to address other matters of import.

    GEM of TKI

  191. PS: Sigh: I just looked up IMHBCO, and see that this too has been taken up with “correct.” I mean CONSIDERED. I guess I have to use IMHBCSO or the like.

  192. 192

    So basically your on the fence. Thanks for entertaning my question.

  193. Bob O’H and Jack,

    You don’t need a calculation to falsify ID.

    What you two should concentrate on is finding something- anything- that supports your PoV.

    IOW demonstrate that ATP synthase can come into existence via non-telic processes.

    THAT is what it will take to falsify ID- actual scientific data.

    To Leo,

    Until universal common descent can be objectively tested it does not belong in a science classroom- to date all the data that supports UCD can also be used to support alternative scenarios.

  194. Leo:

    1] You will first observe, kindly, that I have long since pointed out the underlying material but too often overlooked issue that scientific theories and knowledge claims are inherently provisional.

    2] Indeed, above, I linked on how I once taught TEACHERS on the nature of science and science education, including on Lyellian Geology and Darwinian Biology, in that context.

    3] I excerpt, FYI:

    During the nineteenth century, the two Sir Charleses — Lyell and Darwin — led similarly sweeping revolutions in Geology and Biology, respectively building modern Uniformitarian Geology and [Macro-]Evolutionary Biology. Mendel’s peas and Pavlov’s salivating dogs were foundational for Genetics and Experimental Psychology. Mendeleev’s Periodic Table of the Chemical Elements (1869 – 1871) transformed Chemistry, and John Meynard Keynes’ Aggregate (Macro-) analysis of the 1930′s in his General Theory radically shifted the classical tradition of thought in Economics, which grew from Adam Smith’s 1776 book: The Wealth of Nations. Gauss’ pioneering work on non-Euclidean Geometry — also in the nineteenth century! — forever changed Mathematics, and thus helped provide the analytical tools (such as Riemannian Geometry, Matrix Algebra and Boolean Algebra) needed for modern scientific theories and technologies. And in our computerised era, we look to Charles Babbage’s magnificent failure, the Analytical Engine, as the dawn of the Computer Age.

    4] You will further note that I pointed out the field of science which IMHBXO — using chi for “considered” — has the most credible dating estimate on an old cosmos: astrophysics.

    5] Also, please observe that I have argued that presently observable evidence, even on the conventional — and not at all properly “consensus” as if that were decisive on truth — is sufficient to show that information that is functionally specific and complex is a key constituent of the universe as we see it. The observation that such FSCI credibly traces to agency is sufficient to highlight that intelligent agency is the best explanation for OOL, body plan level biodiversity and the organised complexity of the cosmos. And that is more than enough for my purposes, scientific, philosophical and educational.

    6] Now as to my opinion, perhaps I can beg to remind you that a healthy agnosticism or even skepticism based on specific technical questions on methods and results and assumptions is itself an opinion and a serious option? [This too is my response on say Climate Change. When I wear the sustainability consultant hat, I am a "skyptical environmentalist." That means that on a least regrets basis, I will recommend only actions justifiable on a least regrets basis that is independent of the accuracy or otherwise of the IPCC's projections.]

    7] So, Leo, I HAVE given my opinion, and with my reasons in outline. Just, they do not neatly line up with the usual pigeonholes.

    8] And, I would advise you to see the specific “antics” I rebuked above at 123 – 4 before making comments as you have.

    9] For, science is not properly to be “defined” as in effect applied materialism — that is question begging as a matter of philosophy, is historically demonstrably false and is educationally manipulative. Nor is that manipulative redefintion properly the consensus view of the relevant discipline, philosophy of science.

    10] As to the claimed consensus paradigm, evolutionary materialism (and its associated belt of theories and models), I have never advocated not teaching it, but that it should be discussed in a properly balanced historic, philosophical and scientific context, i.e shown warts and all.

    11] To do less than that is to violate principles of education, and to slide instead into indoctrination and in some cases — where one is sufficiently educated and responsible to know better or where one should know better — outright deception by suppression of material truth.

    __________

    As the justly revered Jewish Mother [and I have one as yet another adoptive "mother"!] says: a half-truth is a whole lie.

    GEM of TKI

  195. Kairsofocus today at post 187 makes a serious accusation about my behavior, writing,

    Of course, in excerpting his own remarks at 117, he [Krebs] then proceeded to a telling ellipsis that makes it appear that I am making up a strawman to attack:

    “I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . . [LEFT OUT, the immediately following words: by a Board who ignored the very processes for writing curriculum that they had established . . . ]”

    So, sir, there is an answer to your: Where is the “serious accusatory statement” here? YOU LEFT IT OUT THROUGH USING A MATERIALLY MISLEADING ELLIPSIS. That tells us a lot about how you reason and argue, and — sadly — none of it good. But, let us trust that in your onward response, we will see a better, more fairly put case. (Sigh . . .)

    Now I have been working on a post on the substantive issue of the description of science in the Kansas Science standards, but now I feel I must respond to this accusation because kairosfocus is DEAD WRONG, and if he in fact had read the posts in question he would understand that it was he himself who left out the phrase in question and inserted the ellipsis. I had no idea what “serious accusatory statement” he was accusing me of making because he didn’t quote the part of my post that he felt was a serious accusation! How was I to know that he was referring to a part of post 117 that he didn’t quote. I’m not a mind-reader, and so I assumed that the statement that he was concerned about was in fact contained in the part of my post he quoted.

    So now, in the interest of an evidence-based approach to research, I need to take the time to establish what happened. So here we go.

    ——————
    In post 117, I wrote,

    I was not “defending Darwin.” I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted by a Board who ignored the very processes for writing curriculum that they had established.

    ——————
    In post 123, kairosfocus wrote,

    Mr Krebs:

    I must take you up on a claim you made in 117, above. One that is very relevant to the overall context of this blog and which reveals a lot of what has gone wrong with science, science education, the media and public policy:

    [JK, 117:] I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . .

    Note very well that here he omitted the phrase about the Board and that he inserted the ellipsis.

    ——————-
    In post 164, I wrote,

    I also am not quite sure what “serious accusatory statement” I made “regarding those on the other side of a curriculum dispute in Kansas.” The part of my post that you quoted was

    [JK, 117:] I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . .

    Where is the “serious accusatory statement” here? Everyone of the points in that quote is a factual statement (except for the word “good”, which is my and many others judgment about the standards.) I know I disagree with what the minority did, but disagreement isn’t accusation.

    Note that I clearly point out that I am quoting his quote of me! – and since he had left out the phrase in question, so did I. I also made it clear that I didn’t know what he was accusing me of. Now we see that the reason I didn’t is because he never included the statement that he was concerned about.

    So kairosfocus is quite wrong to say to me that “YOU LEFT IT OUT THROUGH USING A MATERIALLY MISLEADING ELLIPSIS.” He left the phrase out, and he inserted the ellipsis.

    It would be nice if kairosfocus acknowledged his error.

  196. Onlookers:

    Note, again the sadly commonly encountered Darwinista [and fellow-traveller] tendency to closed-minded, irrelevancy-laced objectionism; in this case following red herrings away to convenient strawmen soaked in oil of ad hominem, that can be ignited. (Notice the sneering reference to a live instance of just how I have taught TEACHERS on Lyell and Darwin, in response to an accusation that I would suppress such “consensus views” in teaching.)

    Meanwhile the main matter of substance [cf 187 - 188 just above] is dodged and dismissed in the hypnotic light of the resulting inferno.

    FYI, Leo, first, at a reading rate of 300 wpm [which is marginal for a College-educated person; and can easily be doubled with a basic speed reading course] the comment would take just over 2 minutes to read. That is a lot less time than it took to scoop it out, put it into a word processor, do a word count, then compose several ad hominem laced distracting remarks.

    Especially, in a context where you have not addressed a material misrepresentation of another person that you unfortunately committed. Much less, the matters in the main.

    Onlookers, instead, let us address the substantial and serious matters above, on the merits.

    GEM of TKI

  197. On universal common descent.

    Perhaps the most compelling thing in support of universal common descent is called the law of biogenesis. In every observed case (billions of observations) life is only seen coming from other life. When so many observations are made without exception this promotes theory to law as far as science is concerned. With perfect infallibility we can predict that any living thing we see, when its origin can be determined, came from another living thing very much like itself.

    This is a double-edged sword for Darwinian evolutionists however. It makes any hypothetical origin of life from a non-living source have to violate what appears to be a law of nature. Also, since all observed instances of life come from something very similar to itself it makes the story of bacteria morphing into men a bit hard to swallow. It’s only the fact that new forms aren’t quite an exact copy of the parent that gives the over arching morphogenesis theory any legs to stand on.

    Personally I hold the law of biogenesis as inviolable until such time as there’s overwhelming evidence to the contrary. For that reason (among others) I believe the best explanation for the origin of life on earth is that it originated from another living thing not of the earth and moreover it was placed here purposefully. This is called “directed panspermia” and was perhaps most famously described and supported by the Nobel prize winning discoverer of DNA – Francis Crick.

  198. ===============
    P.S. to the above post.

    Let me emphasize that in 164 I asked, after quoting his quote of me, “Where is the “serious accusatory statement” here?” If kairosfocus would have noticed and responded to that question, he could have avoided the error he made in 187 of accusing me as he did.

  199. Oops – intervening post problem: I mean P.S. to post 198:

    Let me emphasize that in 164 I asked, after quoting his quote of me, “Where is the “serious accusatory statement” here?” If kairosfocus would have noticed and responded to that question, he could have avoided the error he made in 187 of accusing me as he did.

  200. Mr Krebs:

    I will note on points, on your remarks at 198:

    1–> Notice, I gave the thread-number of your original remarks, and also stated in summary that you had accused the Kansas Science education Board circa 2005 of procedural violation, in 123 – 4. Note this from 124, repeated in 187 just before excerpting again the FAQ : In particular, given the objection on violation of procedure in 117, I note the balancing FAQs . . . [FAQs cited] . That is, had you been concerned to see what I was objecting to, there was more than enough evidence to show just what I found to be a serious accusation. [One that by virtue of your diversion to red herrings, strawmen and ad hominems as just seen, seems to be very likely without proper justification on the merits. Of course, Mr Krebs, you may take time and show [a] why the Board circa 2005 violated procedure in a materially significant way, and [b] how that made their work on identifying what science is like and how students should be taught about it, in dangerous error warranting [c] the public castigation they suffered at your hands and that of your ilk, which was then [d] spread to the world through the mass media. Failing that, I will have reason to conclude that you and others of your ilk willfully neglected a serious duty of care. So, sir, please make your case.]

    2 –> So, the claim that you didn’t understand that I was spaking of how you accused the Board circa 2005 of being “. . . a Board who ignored the very processes for writing curriculum that they had established . . .” than that is hardly my fault.

    3 –> In short, now you are materially misrepresenting me, the better to set up and ignite a strawman laced with oil of ad hominem. That is, onlookers, this its the same rhetorical challenge of objecitonism that I remarked on, only a few moments ago for Leo.

    4 –> Onlookers, observe as well how Mr Krebs has taken a lot of time to misrepresent me and what I have had to say, all the while utterly failing to even initially address or just link on the substantial issue of an unwarranted, ideologically loaded re-definition of science as in effect applied materialism, taught to students in Kansas as if it were the unchallengeable truth.

    ___________

    What does this tell us about what is really going on with science education in Kansas and elsewhere?

    GEM of TKI

  201. Dave:

    Serious points.

    Life only from life. And functionally specified, complex information only from intelligent agency. [Per observations and the issue of finding islands of functionality in vast config spaces.]

    Directed (presumably front-loaded) panspermia is indeed an option; albeit a bit sci fi-ish for some (but that would nmean that the space-folding problem has been solved so long distance rapid space travel is possible . . .). I’d love to visit a few star systems before I pass on . . .

    BTW: Could you give a cite on how Crick advocated DIRECTED, not just simple panspermia?

    On common descent, one issue is that much of it can be accounted for on common design, too; cf Berra’s blunder. [And design is not necessarily optimal design as we would do it . . . design optimisation is relative to the purposes of hte designer, and what seems bad work to one is sound relative to the situations and constraints to another . . . the general theory of second best, . . . ]

    GEM of TKI

  202. Leo:

    Please look at my corrections to Mr Krebs’ remarks, at 203.

    You will see that there was adequate information in 123 – 4 for him to see exactly what I was speaking of; were he seriously concerned to be accurate. That is, he has constructed a strawman, which he soaked in ad hominem oil and ignited. One may do that through careless thinking, but it also can be a deliberate tactic when one does not have a good case in the main on the merits. [Kindly cf 187 - 8 where I address the issues in the main in this thread as I see them; and my always linked where I give my general discussion.]

    So, please, don’t get caught up in the trap — or rhetorical game — of distractions, misrepresentations and ad hominems while dodging the issue in the main. (Also, I have already taken time to correct your own particular remarks that, unfortunately, fall into that trap.)

    Now, can we return to dealing with the issues in the main?

    GEM of TKI

  203. PS: I am not taking any position on either the age of the earth or common descent as such. I am taking a position on the difficulties faced by such models, and on the issues faced by giving the impression that the dominant school in any given discipline of science at any time — especially on matters of a distant unobserved past — is in effect “Truth” or a near approximation thereto.

  204. Thanks to Leo for supporting my point on the omitted phrase and insertion of the ellipsis. And I’ve probably gotten all the response I’m going to get from kairosfocus on the issue.

    Now, however, kf says,

    Onlookers, observe as well how Mr Krebs has taken a lot of time to misrepresent me and what I have had to say, all the while utterly failing to even initially address or just link on the substantial issue of an unwarranted, ideologically loaded re-definition of science as in effect applied materialism, taught to students in Kansas as if it were the unchallengeable truth.

    Let me note that I have said several times that I am working on a post about the description of science in the Kansas science standards. In fact, that was my morning project today until the business about the missing phrase came along, which I felt I needed to respond to. And now, because of the accusation kairosfocus has made, I want to respond to and support my claim that the state Board “ignored the very processes for writing curriculum that they had established,” further delaying my post on the description of science.

    So hang in there, kf, and I’ll get around to the description of science.

  205. Mr Krebs:

    I see further pummelling of a strawman, a misrepresentation I have already long since corrected at 203.

    FYFI, Mr Krebs, this, from is my response at 203, on the matter of the ellipsis in 123 – 4 in response to 117:

    I will note on points, on your remarks at 198:

    1–> Notice, I gave the thread-number of your original remarks [i.e. 117], and also stated in summary that you had accused the Kansas Science education Board circa 2005 of procedural violation, in 123 – 4. Note this from 124, repeated in 187 just before excerpting again the FAQ : In particular, given the objection on violation of procedure in 117, I note the balancing FAQs . . . [FAQs cited] . That is, had you been concerned to see what I was objecting to, there was more than enough evidence to show just what I found to be a serious accusation. [One that by virtue of your diversion to red herrings, strawmen and ad hominems as just seen, seems to be very likely without proper justification on the merits. Of course, Mr Krebs, you may take time and show [a] why the Board circa 2005 violated procedure in a materially significant way, and [b] how that made their work on identifying what science is like and how students should be taught about it, in dangerous error warranting [c] the public castigation they suffered at your hands and that of your ilk, which was then [d] spread to the world through the mass media. Failing that, I will have reason to conclude that you and others of your ilk willfully neglected a serious duty of care. So, sir, please make your case.]

    2 –> So, the claim that you didn’t understand that I was spaking of how you accused the Board circa 2005 of being “. . . a Board who ignored the very processes for writing curriculum that they had established . . .” then that is hardly my fault.

    Observe, had you simply been concerned to see what I actually said in 123 – 4, instead of scooping an excerpt out of its proper context, to turn it into a strawman, you would not have made the mistake.

    I have now pointed your mistaken attack on a strawman of your own making [the claimed misleading ellipsis on my part] out and corrected it, and you insist on being wrong but strong.

    Sorry, but on that evidence, you are now being closed mindedly insistent on a material misrepresentation, compounded by labelling me as making “accusations” in a classic turnabout rhetorical tactic. No Mr Krebs, I simply correctly described and cited what YOU did, in 117, calling on you to address the matter properly. It is you who have an “accusation” to back up with cogent facts.

    And, all the while the long since asked for response on the actual merits of your redefinition of “science” languishes, unaddressed — even while a lot of time is taken up on an atmosphere-poisoning side issue off a secondary, distracting point.

    Onlookers

    What does that tell us about what is likely to have happened in Kansas; circa 2005 – 7? [Notice the major complaint cited by JK in 117 is on a claimed procedural violation, not on the substantial issue: was the materialism-laced redefinition put forward by his side of the dispute and which now obtains for Kansas circa Feb 2007, well-warranted?]

    Let us wait and see if there will be an actual response on the merits of this secondary but important issue.

    Not to mention, the general response on the issue in the main for the thread, for instance as I summarised in 187 – 8.

    GEM of TKI

  206. Leo:

    FYI, many ID thinkers hold to common descent with front loading or something like that.

    GEM of TKI

  207. After some confusion about what he was concerned about, I now understand that kairosfocus feels I have made a serious accusation when I wrote

    I was defending those standards against changes that were inserted by a minority on the committee and that were adopted by a Board who ignored the very processes for writing curriculum that they had established.

    {DLH ended blockquote per Krebs below at 214.}

    So in answer I will explain why I think the statement in bold is accurate.

    There have been two science standards situations in Kansas, the first in 1999-2001 and the second in 2004-2007. In both cases, the following occurred:

    1. The state Board appointed a committee to work on the standards. Following established procedures, the Board appointed some of the committee members and the Department of Education appointed others, that committee prepared drafts to present to the Board, and the public, including the scientific and education communities, was invited to comment.

    2. Instead of following the recommendations of the committee they had appointed, creationist members of the state Board worked with various Intelligent Design/creationist advocates, in ways that are not part of the established procedures, to revise the committee’s recommended standards and eventually adopt standards which the committee disowned and rejected.

    Let’s look briefly at the details.

    In 1999, the committee had written a draft of the standards that included a mainstream view of evolution and the nature of science. However, the Board was made up of a majority of conservatives who were all young-earth creationists. One of them, Steve Abrams, worked with a group led by Tom Willis of the Creation Science Association of Mid-America to write a secret draft of the standards that omitted most of the material on the history of the universe, the earth, and life on earth, including the evolutionary mechanisms responsible for that diversity. Abrams used this secret draft to revise the committee’s draft and presented his draft to the Board as if it were his own work. In August 1999 the first set of creationist-influenced standards were passed. At the meeting in which Abrams submitted his revisions, he lied to the Board about the existence of the secret draft.

    Only later, following detective work by myself and others did it become clear that Abrams had copied 98% of what he inserted in his revisions from the secret draft written by Tom Willis et al. (By the way, I used a design inference and a probability argument in doing so! :-) )

    I think in this case it is clear that the Board ignored their own procedures: they not only ignored the recommendations of the committee, they let a private citizen’s group secretly revise the standards, and the creationist members deceived their fellow Board members about the source of those revisions.

    2004

    Again, the duly-appointed committee wrote a draft and submitted it to the Board. A Minority (about 8 out of 26) of the committee were ID/creationism supporters, and they had brought a number of changes to the committee, all but one of which the committee democratically voted down.

    The Minority was led by lawyer John Calvert, head of the Intelligent Design network. Calvert was not a member of the committee, and yet, working once again with Abrams who was now Board president, Calvert was allowed unprecedented access to the Board: he wrote most of the Minority Report which brought the Minority’s changes to the Board, at times he had access to the Board equivalent to the committee’s chair, Steve Case, and he was allowed to arrange the 2005 Science hearings which were designed to showcase the Minority revisions. See here for a history of how those hearings came about.

    After March 2005, the Board ignored and effectively disbanded the committee, and eventually adopted standards which incorporated the Minority revisions. The committee (of which I was a member) voted to have our names taken off the standards: we renounced them.

    So again the Board ignored established procedures: they rejected the work of the very committee they established to work on the standards, and they (the Board) allowed a private citizen power and control over the process.

    Therefore, I stand by my original statement:

    I was defending those standards against changes that were inserted by a minority on the committee and that were adopted by a Board who ignored the very processes for writing curriculum that they had established.

    Note well that the issue here is not whether one thinks the revisions made by the ID/creationists deserved to be made: I don’t think they did, obviously, but that is not the issue I am addressing.

    The issue is whether the Board ignored established procedures, and on that I think the evidence is abundantly clear that indeed they did ignore said procedures.

  208. 208

    kairosfocus, I’ve reviewed this thread and think that Jack is right. The first person to mention the ellipsis as a supposed evasion was you, in 187:

    Where is the ‘serious accusatory statement’ here? YOU LEFT IT OUT THROUGH USING A MATERIALLY MISLEADING ELLIPSIS.

    Wow. An accusation serious enough to merit ALL CAPS. But the ellipsis in question was provided by you in 123, quoting Jack in 117. Jack was quoting your quotation of him. When called on it you didn’t say “My goodness, you’re right! How careless of me to accuse you of providing an ellipsis that was my invention in the first place!” Instead, you refer to “following red herrings away to convenient strawmen soaked in oil of ad hominem, that can be ignited.”

    Why parody your own writing in this way? Why not just admit your error and apologize?

  209. Damn, and my apologies: I didn’t proofread well and got and end-blockquote wrong.

    Only the part that says,

    I was defending those standards against changes that were inserted by a minority on the committee and that were adopted by a Board who ignored the very processes for writing curriculum that they had established.

    is actually a quote in post 212. The rest is new material.
    {DLH ended blockquote in Krebs above in 212.
    PS Jack you might be able to edit by clicking the “e” below your name.}

  210. Dave

    A haploid 24 parent birthed a haploid 23 offspring. How was this rare mutation propagated? Anyone? Allen?

    You should have heared about balanced translocations and how they arise during meiosis. Didn’t Allen explain this issue to you about a year ago in the 1n Jesus thread? For those who are interested: Allen later wrote a post on the impact of chromsomal aberrations on speciation on his own blog ( Island Mice May Evolve Faster: From one Species To Six In 500 Years).

  211. sparc

    Haven’t you read John Davison’s Semi-Meiosis hypothesis? It’s on the sideboard. He and Allen should get together for a meeting of the minds. Saltationists of a feather should stick together. I note that in the island mice thread on Allen’s blog the first commenter is “Martin” who is either a creation of Davison’s (as many suspect) or is Davison’s biggest fan as Martin appears everywhere Davison does.

    But thanks for spurring me to read about the genetic effects of Robertsonian translocations. I was under the mistaken impression that mismatched chromosome counts are pretty bad news for fertility such as the horse/donkey which leads almost always to an infertile mule. I see now that isn’t always the case. In some cases fertility is merely reduced and not disastrously so (meiosis trying to sort 3 chromosomes into 2 gametes is going to result in some unviable gametes but also some possibly viable ones if there are no bad side effects from the fusion) so that the fused chromosome can propagate enough for two individuals heterozygous for the fusion to find each other, mate, and produce offspring homozygous for the fusion. The homozygous individual would suffer no loss of fertility with another homozygote. But if that’s the case it still doesn’t result in two separate species because the homozygote can still breed successfully with animals without the fusion. This would imply that man and chimp can produce fertile offspring. Can they?

  212. Bob

    500 bits is a measure of complexity. You must understand this to understand CSI. Do you understand the difference between a set with two members and a set with eight members? Do you understand that to number the members of the first set requires a 1 bit number assigned to each member of the set where to number the second set requires assigning each member a 3 bit number? The set of proteins with 100 residues has 2^500 members. To number the set you need a unique 500 bit number assigned to each of them. The number of unique members in a set is a measure of the complexity of the set. A specification is an independently given description that identifies some subset of the larger set. In this case the specification is “energy storage”. Some members of the set of all possible 100 residue sequences (I believe ATP synthase is much larger than 100 residues but that’s beside the point) will meet that specification but the vast majority will not so any random sample taken from the set will be unlikely to meet the specification just as any random assembly of the matter that makes up a space shuttle won’t likely be able to meet the specification of carrying passengers to space and back. The combination of a specification and greater than 500 bit complexity defines CSI. But CSI alone doesn’t warrant a design inference. There may be laws at work that prefer some patterns over another. For instance some snowflakes exhibit specified complexity but there are physical laws which prefer certain patterns in snowflakes so it doesn’t qualify for a design inference.

  213. sparc

    The fact that ATP synthase is composed of multiple protein products which must fit together precisely and be structured so that conformational changes result from external stimuli can be done by designing all components at once in the abstract then building them and fitting them together. How this is accomplished without planning is the essential question. This is difference between cellular machines and metabololic pathways. In the metabolic pathway independent proteins have separate inputs and outputs. The output of one is the input to another. There is a lot of flexibility in metabolic pathways. Not so in machines where the proteins operate together in unison.

  214. Bob

    It said nothing about the range of possible amino acid sequences that could accomplish this task.

    Correct. We also don’t how many possible different combinations of the atoms in a space shuttle will carry passengers to space and back. We know from experience that most of them will not as it’s a lot harder finding arrangements that meet the specification versus finding arrangements that don’t meet it. A moron can build a space shuttle that doesn’t work. It took hundreds of man years of effort from very bright engineers to build one that does.

    A physicist can explain to you precisely why most combinations of matter won’t fly to space and back but most people have a well enough developed sense of intuition to know this without invoking statistical mechanics.

    I think we know from experience that the vast majority of combinations of amino acids won’t meet the specification of energy storage. ATP synthase is highly conserved in all forms of life. This is indicative that even small changes in sequence result in something that doesn’t fit the specification. If small random changes result in catastrophic failure that’s pretty compelling evidence that very few of all the possible polymer sequences meet the specification.

    I suppose this could be better characterized by replacing the genes that specify the protein components in ATP synthase with random strings of codons and see how many of the random sequences still result in a working ATP synthase molecule. What I don’t suppose is anyone will bother doing it because the result is almost certain – no amount of effort will find a randomly generated sequence that works.

  215. Jack

    Are you going to respond to my request for a plausible and likely pathway for chance & neccessity to build an ATP synthase molecule?

    See how easy it was for me to force you into a situation where your reliance on dogma is exposed? The only answer you can give is based on an informal fallacy. You hold a dogmatic belief that chance & neccessity is the only possibility so there must be a plausible likely pathway even if you can’t describe it. Is that how your brand of science works? Is that reflected in the science standards you were promoting? Things taken to be true without evidence are called articles of faith, Jack. Faith has no place in science. Faith’s place is in religion. The origin and diversity of life as explained by neo-Darwinian theory rests on articles of faith. It’s a religion, not a science. You, Jack, are as guilty as any young earth creationist of inserting your articles faith into science classrooms. I have no tolerance for articles of faith, yours or anyone else’s, in science.

  216. 216

    I for one really like the current science standards in Kansas. What I especially like is that they make a case for materialism not as dogma but as a reflection of current scientific practice. They don’t try to define science once and for all but only for now:

    Science is a human activity of systematically seeking natural explanations for what we observe in the world around us. Throughout history people from many cultures have used the methods of science to contribute to scientific knowledge and technological innovations, making science a worldwide enterprise. Scientists test explanations against the natural world, logically integrating observations and tested hypotheses with accepted explanations to gradually build more reliable and accurate understandings of nature. Scientific explanations must be testable and repeatable, and findings must be confirmed through additional observation and experimentation. As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes. (Emphasis added)

    As a Christian, I don’t see anything wrong with that. It even opens the door to some return of non-natural explanations for natural events in the future. It just says they’re not a part of science now.

  217. Hi Dave. I’m on spring break, so I have more time to participate here than usual. I’m working on the description of science post in response to kairosfocus right now, but I do have some response to you that I’ll try to get around to making soon.

  218. For illustrative purposes:

    ATP Synthase

  219. larrynormanfan:

    Science is a human activity of systematically seeking natural explanations for what we observe in the world around us.

    So archeology isn’t a science in Kansas. Fascinating.

    Where would my area of professional expertise, computer science, fit in here? We definitely aren’t seeking natural explanations.

  220. Kairosfocus has brought up the issue of the description of science in the Introduction to the Kansas Science standards, stating that, in post 123,

    or, was it that you and others, acting as advocates for in effect evolutionary materialism in the name of science, imposed a “standard” that in effect attempts to redefine “science” as the best materialistic [or, “naturalistic”] explanation of the cosmos from hydrogen to humans?

    I’d like to explain what he is talking about, outline the history of the issue, and explain why I support the Kansas Science standard’s description and why I rejected the changes made by the Intelligent Design advocates.

    A brief history of the description of the nature of science

    The sentence in question occurs as the first sentence in a paragraph in the Introduction to the standards.:

    The Nature of Science: Science is a human activity of systematically seeking natural explanations for what we observe in the world around us. Throughout history people from many cultures have used the methods of science to contribute to scientific knowledge and technological innovations, making science a worldwide enterprise. Scientists test explanations against the natural world, logically integrating observations and tested hypotheses with accepted explanations to gradually build more reliable and accurate understandings of nature. Scientific explanations must be testable and repeatable, and findings must be confirmed through additional observation and experimentation. As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes.

    1999-2001: In 1999 a committee was formed by the state Board to completely revise the science standards. The previous 1995 standards had been merely an old-style list of topics to teach. The new standards were to be more in keeping with current curriculum practices, outlining with greater specificity what fundamental facts, concepts and skills students students should learn.

    Along with many other topics, the first drafts from the committee had more specific statements about evolution than the 1995 standards. The committee’s draft also included the sentence in question about “natural explanations”.

    In response to this, a group of young-earth creationists led by Tom Willis of the Creation Science Association of Mid-America conspired (literally and not just figuratively) with Board member Steve Abrams, also a young-earth creationist, to produce a secret draft of the standards that omitted most of the material on the history of the universe, the earth, and life on earth, including the evolutionary mechanisms responsible for that diversity, as explained in post 212.

    At the same time both national and local Intelligent Design advocates, led by lawyer John Calvert and the Intelligent Design network (IDnet), became involved. Their one contribution to the secret draft was to substitute the word “logical” for “natural” in the description of science.

    After the elections, which assured that a moderate majority would overturn the 1999 standards and adopt the committee’s recommended standards, Abrams worked with Calvert to make one last attempt to add ID-influenced changes to the standards. KCFS responded to the Board, explaining clearly why the IDnet’s suggested revisions should not be included. On February 14, 2001, the Board adopted standards based on the committee’s draft, rejecting both the 1999 standards and the IDnet’s suggested revisions.

    At this point, the sentence “Science is a human activity of systematically seeking natural explanations for what we observe in the world around us” was officially a part of the Kansas science standards.

    2004-2007: In 2004, the standards came up for revision, and as explained in post 212, the Intelligent Design Minority succeeded in getting their revisions into the standards in 2005. It was in these standards that the description using the phrase “adequate explanations” was substituted for the sentence from the 2001 standards using “natural explanations.”

    However, the science standards were again an issue in the 2006 elctions for state Board members, and again several creationists were voted out and the moderates regained the majority. Upon taking office, in February 2007 the moderates adopted standards based on the committee’s recommended draft, and once again science as the activity of seeking natural explanations was established in the standards.

    Note well that “seeking natural explanations” has been the phrase written and adopted by the duly appointed committees charged with writing the standards in 1999 and then revising them in 2004. Note also that in both cases the ID/creationists worked around established processes in order to get their changes into the standards.

    Why did the ID/creationists want to change the description of science, and why were they wrong to do so.

    The main reason the ID/creationists wanted to change the description of science is because they believe that limiting science to seeking natural explanations is equivalent to saying that science is an atheistic, materialistic enterprise – one that denies the existence of God. They believe that that teaching evolution essentially teaches students that they are meaningless accidents in a purposeless world.

    For instance, in the Minority report, Calvert wrote,

    .It [the "natural explanations" phrase] requires that evidence and criticisms that challenge Darwinian evolution (the primary theory that supports the philosophy of Naturalism) not be permitted.

    It is reasonable to expect that this viewpoint discrimination will necessarily have the effect of causing students to reach an uninformed, but “reasoned” decision that they, and all other human beings, are merely natural occurrences, accidents of nature that lack intrinsic purpose.

    and

    The current definition of science is intended to reflect a concept called methodological naturalism, which irrefutably assumes that cause and effect laws (as of physics and chemistry) are adequate to account for all phenomena and that teleological or design conceptions of nature are invalid. …

    This can be reasonably expected to lead one to believe in the naturalistic philosophy that life and its diversity is the result of an unguided, purposeless natural process.

    and

    Methodological naturalism effectively converts evolution into an irrefutable ideology that is not secular or neutral. Naturalism is the fundamental tenet of non-theistic religions and belief systems like Secular Humanism, atheism, agnosticism and scientism.

    I know that many here would agree with many of Calvert’s statements, but I, and the majority of the writing committee, believe these statements are quite wrong. More importantly, a large majority of the world’s scientists would disagree with them also.

    The second, related reason that the ID Minority wanted to change the description of science is to allow supernatural causes in scientific explanations.

    For instance, in an editorial in the Wichita Eagle/Beacon, Calvert wrote in regards to this issue,

    Nontheistic religions such as secular humanism, atheism, agnosticism and scientism are quite happy with science that seeks to remove any “supernatural” influence from its explanations.

    In numerous places Calvert makes it clear that science seeking natural explanations is antithetical to theistic religion, clearly implying that explanations that invoke God are what are ruled out by science.

    So what is wrong about this:

    1. Science as described in the Kansas standards does not say that science is the only way of knowing, or that all things, and all types of valid explanations, have to be scientific. It merely says that science is limited to a particular type of explanation that explains the relationships between various parts of the material world.

    In fact, there is a line in the standards (which I wrote) that says that the student

    understands there are many issues which involve morals, ethics, values or spiritual beliefs that go beyond what science can explain, but for which solid scientific literacy is useful.

    Furthermore, it is a true fact that there are billions of people who accept science as seeking natural explanations and who also have religious beliefs, including many Christians, other theists and people of other religions. Irrespective of whether you agree with such people or not, their religious beliefs show clearly that believing that science is atheistic and materialistic is a sectarian viewpoint and not a fact about science itself.

    So the arguments advanced by Calvert et al for removing the word “natural” from the description of science are fallacious, and meant to advance a particular religious viewpoint (that God’s presence in the world is scientifically detectable) over all other religious and non-religious that do not see the limitations of science as in conflict with their metaphysical beliefs.

    2. There are also educational reasons for resisting the change to the description of science.

    Science standards are meant to summarize current fundamental mainstream concepts. They are conservative, descriptive documents meant to provide beginning students with the basics so that at least some of them will be prepared to move further in science. It is not the role of science standards to present or make a case for ideas that have not yet “earned their wings”, so to speak, in the scientific community.

    If ID concepts and arguments, including ID-influenced thoughts on the nature of science, ever do become the consensus view in the world of science, then they will have a place in public education science standards. Until that time, they don’t. Trying to insert ID-influenced concepts into the standards before convincing the scientific community is like trying to cut to the head of the line. The ID movement’s are with the adult scientific community: trying to prematurely insert these concepts into the state standards is an abuse of the educational system.

    Some facts; and my opinion, for what it’s worth.

  221. To Dave: The Kansas science standards are about physics, chemistry, biology and earth and space science, not archaeology, psychology, anthropology or other sciences about people.

    However taking the broader view of science in general, are not the observable actions of human beings, and the consequences of their actions, natural events?

  222. Dave, as long as you are waiting on Jack, can you answer a question he posed to you earlier? He asked:

    You accept common descent, and I think you lean towards front-loading as the ID explanation. And yet you say here that “like produces like.” How do you reconcile these two? If “like produces like” then there is no way we could have life diversify and change over time. Is there something I am missing about your position?

    I thought about this alot today and haven’t been able to figure it out.

  223. Jack

    Computer science isn’t about people. Neither is rocket science. But I get your point. Excluding artificial constructs in biology however is based upon dogma not evidence. Humans are the only known source of artificial constructs. Humans are intelligent designers. If humans are something that nature produced then does it not follow that intelligent design is also something that can be considered a natural force in the universe? What excludes from the universe other instances of intelligent design to such an extent that hideously complex machines that almost everyone acknowledges appear to be designed are definitely not designed?

  224. 224

    Archeology is a social science, not a natural science. The Kansas science standards don’t speak to social sciences but only to physical, life, and earth/space sciences. Anybody who reads the standards knows full well that they’re not about archeology. They’re not about sociology or economics either. Big deal.

  225. 225

    Computer science and rocket science are technologies, not basic sciences. When rocket science projects a path for a space probe, it assumes — crazy, I know — that the only intelligent forces intervening are going to be the folks what done shot it up. Technologies derive from basic sciences which presume materialism. Materialist science is why technologies are so darn stable.

  226. larry

    Computer science isn’t a social science. It’s a machine science closely related to information science. Molecular biology is quite unlike any other “natural” science. Many aspects of it are machine and information science. The days when biology was more like stamp collecting than computer science are in the past. See that illustration of ATP synthase? That’s a machine, my friend. Its specifications are written in an abstract code. Abstract codes are part of information science. Molecular biology has revealed a world of nanometer scale machinery and information processing, storage, and retrieval systems. There is only one known, demonstrable origin for machines and information processing systems and that origin is intelligent design. All other hypothetical origins remain undemonstrated, entirely narrative, speculative, unconfirmed, and mythical.

  227. Well Dave, this takes off on another subject, but I’ll throw in my 2 cents.

    You write,

    Humans are intelligent designers. If humans are something that nature produced then does it not follow that intelligent design is also something that can be considered a natural force in the universe?

    Human beings, including their behavior and the effects of that behavior, are part of the natural world, as are all other forms of life. Human behavior (and I include both our internal cognitive and emotional life as well as our external observable actions) has a number of properties that lead to what you call intelligent design.

    However the fact that such qualities are exhibited by us as physical beings does not justify, in my opinion, concluding that some more abstract or dis-embodied force called “intelligent design” exists and “can be considered a natural force in the universe.” I don’t believe such reification of the concept of design is warranted.

    I also don’t understand what you mean when you write “Excluding artificial constructs in biology however is based upon dogma not evidence.” Can you clarify this sentence?

  228. 228

    I never said computer science was a social science. And I’m happy to say that computer science can be a powerful lens into biology. I have a close relative who does precisely this: a biology postdoc with a computer science Ph.D. But that person thinks ID is hooey.

    Biology remains a natural science not because of dogma but because a naturalist perspective works.

  229. Jack

    Nowhere did I claim that intelligent agents must be disembodied. That is a straw man.

    The dogma is that the only intelligent designers in the universe are humans. If that is dogmatic it then follows that nothing in the universe is artificial in nature except that which human agency has produced. I don’t accept the underlying dogma. If the laws of physics allow intelligent designers such as ourselves to exist then it follows that other instances of intelligent agency are possible. If one puts any stock in the Copernican Principle of Mediocrity then not only are other instances of intelligent agency allowed they should be common in the universe.

  230. Jack

    So you objected to science being defined as seeking logical explanations. Only natural explanations are allowed. Well that sure puts the chance worshippers in perspective. Logical they are not. Technically logic is a branch of mathematics. So basically you feel that science and math are incompatible. Fascinating!

  231. larry

    Biology remains a natural science not because of dogma but because a naturalist perspective works.

    An engineering perspective works better. Genes, RNA, and ribosomes work just like modern factory robotics. Specifications are stored in abstract codes that direct machinery to choose and assemble parts to produce the specified product. That is better understood from an engineering perspective than from any naturalist perspective.

  232. Dave, I didn’t mean to erect any straw men. When you asked if intelligent design could not be “considered a natural force in the universe?”, I took you to mean a force in the sense of gravity or electromagnetic force: something pervasive and naturally interacting with the world outside of an embodied agent. If this is not what you meant, then I misunderstood.

    You write,

    The dogma is that the only intelligent designers in the universe are humans. If that is dogmatic it then follows that nothing in the universe is artificial in nature except that which human agency has produced. I don’t accept the underlying dogma.

    Man, I don’t accept that either, although I don’t see that as a dogma. My personal feeling is that throughout the billions of billions of stars in the billions of billions of galaxies, intelligent life has surely occurred many times.

    However, this is an unprovable belief, at least for now and perhaps forever, so I realize that I don’t really know whether my belief is true. I have no problem thinking that intelligent life exists elsewhere in the universe.

    I realize that this bears on the origin of life issue, and that you lean towards panspermia account. I personally don’t discount that as a possibility, but I also don’t see any reason why our planet can’t have been one of the places where life arose independently.

    We really have little idea as to whether the conditions of physics, chemistry and geology are such that life arises easily or not. If somehow we could have a complete dataset on all the planets in the universe we could and the nature of life in any form, or none at all, on them, we would know somethings that I am pretty sure we will never actually know,

  233. Jack

    but I also don’t see any reason why our planet can’t have been one of the places where life arose independently.

    It’s certainly a possibility. However, the possible is not neccessarily plausible. It’s possible for a tornado to assemble a spacecraft from junkyard components but it isn’t plausible. Further, if something is plausible it isn’t neccessarily likely. And if something is likely, it isn’t neccessarily certain. The chance & neccessity explanation for the origin and diversity of life on earth exists somewhere on the scale between possible and likely as it stands now. I’m not sure it rises to the level of plausible since there been no demonstration of chance & neccessity creating complex machinery but it’s at least possible. Intelligent design as an explanation is also somewhere between possible and likely. However I feel that because intelligent design does have the observed capacity to create complex machinery and there’s nothing that says human design is the only possible source of design that intelligent design is not just possible but also quite plausible. The continued failure of science to demonstrate chance & neccessity creating complex machinery despite great effort to do so weakens the plausibility of the explanation and strengthens the design explanation. The problem is that chance & neccessity is being peddled as a certainty and design an impossibility. That’s clearly not right. It’s neither scientifically nor logically correct.

  234. Dave writes,

    Jack

    So you objected to science being defined as seeking logical explanations. Only natural explanations are allowed. Well that sure puts the chance worshippers in perspective. Logical they are not. Technically logic is a branch of mathematics. So basically you feel that science and math are incompatible. Fascinating!

    Now Dave, that is a straw man. Of course scientific explanations are supposed to be logical. However, being logical is a necessary not a sufficient condition. Solipsism and Oomphalism are logically possible but useless scientifically.

    Here’s the complete text of the Introductory section in the Kansas standards on the Nature of Science. Logic and mathematics are a key part of the process described below.

    Science is a human activity of systematically seeking natural explanations for what we observe in the world around us. Throughout history people from many cultures have used the methods of science to contribute to scientific knowledge and technological innovations, making science a worldwide enterprise. Scientists test explanations against the natural world, logically integrating observations and tested hypotheses with accepted explanations to gradually build more reliable and accurate understandings of nature. Scientific explanations must be testable and repeatable, and findings must be confirmed through additional observation and experimentation. As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes.

    It is important to note that science cannot answer all questions. Some questions are simply beyond the parameters of science. Among the conditions that help define the boundaries of scientific explanations are the following:

    ! Scientific explanations are based on empirical observations or experiments. The appeal to authority as a valid explanation does not meet the requirements of science. Observations are based on sense experiences or on an extension of the senses through technology.

    ! Scientific explanations assume cause-effect relationships. Much of science is directed toward determining causal relationships and developing explanations for interactions and linkages between objects, organisms, and events. Distinctions among causality, correlation, coincidence, and contingency separate science from pseudoscience.

    ! Scientific explanations are tentative. Explanations can and do change. There are no scientific truths in an absolute sense.

    ! Scientific explanations are historical. Past explanations are the basis for contemporary explanations, and those, in turn, are the basis for future explanations.

    ! Scientific explanations are probabilistic. The statistical view of nature is evident implicitly or explicitly when stating scientific predictions of phenomena or explaining the likelihood of events in actual situations.

    ! Scientific explanations are limited. Scientific explanations sometimes are limited by technology, for example, the resolving power of microscopes and telescopes. New technologies can result in new fields of inquiry or extend current areas of study. The interactions between technology and advances in molecular biology and the role of technology in planetary explorations
    serve as examples.

    ! Scientific explanations are made public. Scientists make presentations at scientific meetings or publish in professional journals, making knowledge public and available to other scientists.

    Hypothesis, law, and theory are frequently misunderstood terms used in science. A hypothesis is a testable statement about the natural world that can be used to design experiments and to build more complex inferences and explanations. A law is a descriptive generalization based on repeated observations. A theory is a well-substantiated explanation of the natural world that incorporates observations, inferences, laws, well-tested hypotheses and experimental findings to explain a specific aspect of the natural world. Theories drive research because they draw attention to areas where data or understandings are incomplete, suggesting additional directions for research.

  235. Jack

    Okay, so where’s the repeatable testable way that the ATP synthase molecule came to be formed by law and chance alone? I’m all for experimental biology. That is a wonderful, productive science. Historical biology is rather useless in comparison. Supposing that birds descended from dinosaurs isn’t going to cure any diseases, Jack. However, as nanotechnology progresses machines on the scale and complexity of ATP synthase can be artificially constructed. But that will just serve to prove it can be done by intelligent agency. I keep returning to the theme that machines are made by design not by chance. I’m willing to entertain the possibility that chance can do it but I guess I’m more like Missourans than Kansans and thus you have to show me to convince me.

  236. Dave, doesn’t the panspermia hypothesis just move the “chance and necessity” issue to another time and place? Does not the question of how those designers came to be become a analogous question?

    Actually, my understanding of the panspermia hypothesis is that there are two versions:

    1. Life arose naturally elsewhere, and that basic components of life are capable of staying viable on objects in space, so just as our solor system is made of atoms originally formed in other stars, life on earth original arose on some other planet in some other solar system, or

    2. Life arose naturally somewhere else, and then intelligent life (much more advanced than us now) deliberately created or isolated the basic components of life and deliberately sent them here, or perhaps just scattered them to the wild winds, so to speak, seeding the area around them with life.

    Are any of these descriptions close to what you think might have happened?

    And do any of them, or any other explanation, avoid the “chance and necessity” dilemma of at least someplace intelligent beings arising from non-living and non-intelligent causes?

  237. Jack

    doesn’t the panspermia hypothesis just move the “chance and necessity” issue to another time and place?

    Sort of but infinite regressions like that eventually wind up at how the matter and energy in the observable universe along with the laws that govern it was created. Let’s stick to things that we can examine and compare. We can examine the machinery of life on earth and compare it to machinery that we design. There’s nothing else we can examine or compare it to.

  238. I haven’t read all the posts in detail but I have no problem with accepting the Kansas science standards. And according to these standards Darwin’s ideas or the current version, except for micro evolution, should be thrown out of the curriculum because they don’t past the muster as science according to the standards. All they are is speculation.

    I am using the following quote about the standards:

    “The Nature of Science: Science is a human activity of systematically seeking natural explanations for what we observe in the world around us. Throughout history people from many cultures have used the methods of science to contribute to scientific knowledge and technological innovations, making science a worldwide enterprise. Scientists test explanations against the natural world, logically integrating observations and tested hypotheses with accepted explanations to gradually build more reliable and accurate understandings of nature. Scientific explanations must be testable and repeatable, and findings must be confirmed through additional observation and experimentation. As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes.”

    Jack Krebs, you have been challenged several times about Darwin being bogus for explanations of evolutionary biology except for trivial stuff. Because this challenge has never been answered by anyone including the biology people who frequent this web site, this is an indication that it can not be answered. So any version of Darwin’s ideas should be severely restricted in the Kansas curriculum. It is the only honest thing to do. Can you provide any reason why it shouldn’t?

    And please don’t give me all that nonsense that nearly all the scientists accept it. That is a bogus argument and what they accept is micro evolution. Produce one scientist who can defend any thing but that. As I said there are several who are contributors and lurkers on this site. Or better yet, get your own and bring him/her here for a civil discussion.

  239. I highly recommend that those who are serious about the evolution debate and know the biology behind it, get the book that Allen MacNeill recommended. it is

    Evolution in Four Dimensions: Genetic, Epigenetic, Behavioral, and Symbolic Variation in the History of Life by Eva Jablonka and Marion J. Lamb. You can get it for about $12 plus shipping on Amazon.

    I have read about 40% of it and it is no threat to ID but is a thorough exposition of the current theory and new ideas that should be added on to the modern evolutionary theory. In fact because it introduces additional complexity to the evolution mechanism in terms of the many epigenetic processes one could argue that these new layers of regulation reinforce the idea of how hard it would be for such a system to arise by chance. If you thought complex machines in the cell was a materialist killer, wait till you see all the different changes that have to be made to the cell epigenitically to make each cell type.

    Also when Allen MacNeill talks about targeted mutations, it is only applicable to bacteria and not really to multi celled organisms. The Lamarckian issue as discussed so far does not seem to be a very robust explanation for anything of any consequence. There are some possible instances where environmental pressures can affect what might get expressed in an offspring but not in the traditional Lamarckian way. For example, what a mother eats may affect the fetus and how it develops. An animal with several embryos might have mainly one sex and the hormones from one sex might affect the embryos of the other sex. There are also some trivial cases where physically altering some primitive life forms results in the new physical form showing up in the offspring.

    And to stay on topic there is a discussion about the mating of hybrids and the possible problems caused by epigenetic factors. These are real and are primarily the methylization of the genome which turns on and off various proteins and is what affects cell type and also distinguishes the DNA which comes from the mother from that which comes from the father. There a lot of interesting topics such as micro RNA’s which is a hot topic these days in micro biology. The book is well researched. It is also an example of people in the evolutionary biology community arguing with each other.

    Again, no threat to ID even though the authors make the obligatory claims denouncing ID. Interesting book and one that all who want to follow the science should have. And is relatively inexpensive.

  240. DaveScot @ 217 –

    Bob

    500 bits is a measure of complexity. You must understand this to understand CSI.

    I do. But what does it mean? What does it represent? The only interpretation I’ve come across is that it is the probability that a protein or DNA sequence would have that particular sequence if it was put together at random. But, as Jack has pointed out, nobody claims that that’s how ATP synthase came about. So, what is the 500 bits meant to mean? How is it relevant?

    Dave @ 219 –

    Bob

    It said nothing about the range of possible amino acid sequences that could accomplish this task.

    Correct. …

    So you’re now admitting that you can’t calculate the “specified” part of CSI? Everyone would accept it’s small, but you were claiming to be able to calculate CSI, but you seem to be admitting that you can’t manage the second letter.

  241. Participants (esp. LNF):

    First to Bob O’H: Kindly look at 187 -8, where it is pointed out that for the gtenome, the config space is so large that even with 10^1000 islands of functionality and 10^150 workable configs in each of these islands of function — very generous indeed — we still have not begun to make a dent in the lostness of the fucntionality in the overall config space on order of 10^180,000 for even the simplest reasonable genome of 300,000 base pairs. In short, even a very generous upper limit is enough to show that “bio-functionally specified” states are very rare in the overall genomic config space.

    I see, too, the sub-thread on science and science education continued overnight.

    Sadly, far too much of it is not on the issue in the main, so we now have to try to clear the atmosphere after red herrings have led out to ad hominem soaked strawmen that have been burned, clouding and poisoning the atmosphere.

    Several points thus require a response, but I first must point out to LNF at 213 that he has unfortunately failed to look carefully at the initial exchange at 117, 123 – 124, or at my remarks in which I pointed out the actual exchange and the rhetorical tactic at work.

    Now, let us note: It is astonishing that anyone would take seriously the ideas that:

    [a] Mr Krebs would not remember nor look up his own words [cf 117] on a major claim he and his ilk have consistently made against the Kansas science education board, circa 2005, or

    [b] that he cannot understand or see the stated or cited summary of his accusation [cf my excerpt below from 124!], or

    [c] that he has not seen the cited substantiating facts for my own remarks taking him up on his tactics [cf 123 – 124], or

    [d] that he has not seen the citation of the FAQ that addresses that problem [cf 124]; which

    [e] points out, with a very telling citation from the media and public relations officer of Kansas Citizens for Science – to wit: our “strategy” is to “portray” those who seek an objective discussion of evolution “in the harshest light possible, as political opportunists, evangelical activists, ignoramuses, BREAKERS OF RULES, un-principled bullies, etc.” — that the sort of claim in 117 is part of a calculated public relations stratagem to avoid discussing the issue in the main, while vilifying the members of the Board circa 2005; to make them appear to be unreasonable, unjust and extremist – all the while, when

    [f] what the vilified Board have in fact advocated is a very reasonable, phil of sci-informed summary of what science historically is. [Cf a popular level summary here, and my own introductory remarks here, for teachers setting out to teach science in school. Section E in my always linked also has a few relevant remarks. Sorry to get didactic or even pedantic, but this it the LEAST amount of homework that one must do to understand what is going on and what is at stake. A glance at Rom 1:19 - 23 would not hurt for those who are inclined to foundational Christian perspectives.]

    But then, sadly, the point of such tactics is to exploit the ignorance of those who do not have an independent and well-informed understanding of the underlying issues and are naive enough to trust the media and evo mat advocates to give them the straight story. Accordingly, I again excerpt the remarks I made at 123 – 4, as a warning:

    In particular, given the objection on violation of procedure in 117, I note the balancing FAQs:

    Q: What is the scientific basis for the changes?

    A: Most of the changes reflect common sense and all have a solid scientific basis. They were crafted by eight members of the Writing Committee (the Authors), three of which hold doctoral degrees in the life sciences (biochemistry, entomology and medicine). They were then scientifically and educationally validated by 23 experts during 3 days of hearings in May, 2005 by 5 PhD biologists/ molecular biologists, 4 PhD biochemists, 3 PhD Chemists (2 with expertise in theories of chemical evolution – origin of life), 1 PhD Geneticist (the inventor of the Gene Gun), 1 PhD Quantum Physicist, 3 Philosophers of Science (two with PhD’s), 1 PhD Professor of Education, 3 biology teachers, a Muslim journalist and an attorney.

    Q: Why do we get conflicting reports about the changes to the standards?

    A: Organizations that oppose the changes are unwilling to publicly debate evolution because they falsely claim it is not scientifically controversial. To avoid a discussion of the real controversy they unfairly demean those who seek it. See http://www.KansasScience2005.com for an explanation of the strategy of the media and public relations officer of Kansas Citizens for Science: our “strategy” is to “portray” those who seek an objective discussion of evolution “in the harshest light possible, as political opportunists, evangelical activists, ignoramuses, breakers of rules, un-principled bullies, etc.” The boycott of hearings that discussed key issues of science and education is an example of this strategy – to demean rather than to discuss.

    Plainly, we have seen overnight that such intentional, deceitful strawman and ad hominem tactics are often effective. Indeed, that is why they are resorted to by the unscrupulous or ill-informed and hot-headed. But, as Aristotle warned in his The Rhetoric, 2300 years ago; with the sad fate of Socrates obviously in mind:

    Of the modes of persuasion furnished by the spoken word there are three kinds. The first kind depends on the personal character of the speaker [ethos]; the second on putting the audience into a certain frame of mind [pathos]; the third on the proof, or apparent proof, provided by the words of the speech itself [logos]. Persuasion is achieved by the speaker’s personal character when the speech is so spoken as to make us think him credible . . . Secondly, persuasion may come through the hearers, when the speech stirs their emotions. Our judgements when we are pleased and friendly are not the same as when we are pained and hostile . . . Thirdly, persuasion is effected through the speech itself when we have proved a truth or an apparent truth by means of the persuasive arguments suitable to the case in question . . . . [Book I, Ch. 2 ]

    We have been warned, and should be on our guard against such uncivil, dishonest advocacy in service to the agenda of evolutionary materialism. [Observe, onlookers, the want of an apology or even a simple retraction, on Mr Krebs' part for his misrepresentation of what I have said in 123 - 124; all through the exchanges yesterday morning, and up to today. On the balance of the evidence that is plainly not at all an accident.]

    Next, DV, I will respond on the merits . . . to the accusation claim and to the underlying issue of definitions of science and what is going on behind apparently reasonable but in fact loaded words.

    GEM of TKI

  242. Participants:

    Now, let us begin with the actual substantial matters raised by Mr Krebs at 225, especially the key opening words of the Feb 2007 redefinition of what science is:

    1] Re-defining Science materialistically . . .

    The Nature of Science: Science is a human activity of systematically seeking natural explanations for what we observe in the world around us . . . Scientific explanations must be testable and repeatable, and findings must be confirmed through additional observation and experimentation. As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes.

    The highlighted words show where some serious, materialism ideologically loaded historical and philosophy of science problems are with the stadnard as stated and as currently enforced by the sort of tactics we just remarked on.

    Now, too, let us observe how Mr Krebs first sets out to defend this claim:

    I know that many here would agree with many of Calvert’s statements, but I, and the majority of the writing committee, believe these statements are quite wrong. More importantly, a large majority of the world’s scientists would disagree with them also.

    The second, related reason that the ID Minority wanted to change the description of science is to allow supernatural causes in scientific explanations . . . . Calvert makes it clear that science seeking natural explanations is antithetical to theistic religion, clearly implying that explanations that invoke God are what are ruled out by science . . .

    The first, most obvious objection is that the definition of science is not a project within science but rather one in PHILOSOPHY, to wit, philosophy of science.

    Worse, by contrast with scientists of 60 – 100 years ago such as Bohr or Peirce, the vast majority of today’s scientists are woefully ignorant on (and too often contemptuous of) philosophical matters or on the history of their discipline. So, the scientists being “polled” — whose survey, where, when and with what methods — by Mr Krebs are LAYMEN at best on the question of what is the historically well-warranted, philosophically sound definition of science as a whole as a discipline. (Further to this, the “polling” in question is after a lot of spinning has gone on by advocates of the evolutionary materialist agenda, and in a context where – as the upcoming movie Expelled will publicly document in painful detail – institutional dominance by evo mat advocates has now reached a critical situation where to question the agenda is to risk one’s career.)

    So, something is obviously very wrong with what is being claimed by Mr Krebs.

    2] Getting back to 123 . . .

    To see what is really going on, let us immediately note how I addressed the attempted evolutionary materialist re-definition of science, all the way back in 123:

    a –> Since there is a clear context in which “natural” in effect in context means evolutionary materialist [i.e. “the best materialistic explanation of the cosmos from hydrogen to humans”], the [materialist redefinition of science] clearly and improperly begs a lot of big questions.

    b –> It is indoctrination, not education – and I say that as one who has taught in science and technology at high school and college level and has had a hand in curriculum and programme development [and in the previous remark this morning I link a reader for teachers which I developed a 101-level semi-definition of science in light of its history, praxis and some relevant philosophical considerations] . . . .

    c –> Further to this, I observe that statistics is a major tool used in observational and experimental studies in science, and that in hypothesis testing, it in fact articulates several tools that are precisely useful for distinguishing [I] chance, [II] law-like natural regularities and [III] design/intent/agent action as possible causal factors, in the context of situationally plausible alternative hypotheses. [That is, I am showing that in science there are in fact commonly used tools that address distinguishing chance, necessity and agency; i.e. to then exclude agency in relevant contexts is selective hyperskepticism, as you may see in more details in light of the major application of these techniques in information theory and conceptually linked areas, from Section A, my always linked. Such linked contexts include DNA as a code-bearing informational nanotechnology.]

    d –> Indeed, these tools are commonly used in the design of experiments, e.g. the use of control cases and various treatments, leading to ANOVA to analyse the impact of various factors to appropriate levels of confidence. So it is simply falsehood backed up by slanderous allusion, to say that “science currently has no tools to test explanations using non-natural (such as supernatural) causes.” [NB: In a typical case, one needs to distinguish natural variation and effects of treatments, e.g. Different degrees of fertiliser across crop plots. One does so empirically, based on statistical techniques that may be looked up under the abbreviation just given.]

    e –> For: [a] non-natural has a very relevant meaning, i.e “[intentional, intelligent] agent,” and [b] all of this is in the unacknowledged context of the too often INTENTIONAL misrepresentation of Intelligent Design as being about claimed scientific inference to the supernatural, where [c] in fact ID and a lot of pure and applied science works in a context where agent-cause [INTELLIGENT as opposed to SUPERNATURAL; which while possible is only one of the possible intelligent causes; agent identification is logically posterior to intelligence detection (we can have "murder by unknown agents")] is a relevant consideration and methods have been developed for addressing agent action – which is in this context a very relevant meaning of “non-natural.”

    f –> I say “too often intentional,” as: if you [Mr Krebs] and others of your ilk don’t know the basic context of the design inference across chance law-like regularity tracing to mechanical necessity and design, that is because of willful refusal to do basic homework on the nature and context of design theory. Sorry if that sounds harsh, but it is time to call you and your ilk to basic intellectual duty.

    So, how did Mr Krebs respond on the merits to these objections to the attempted re-definition?

    3] Science is not the only way to know . . .

    Science as described in the Kansas standards does not say that science is the only way of knowing, or that all things, and all types of valid explanations, have to be scientific. It merely says that science is limited to a particular type of explanation that explains the relationships between various parts of the material world.
    In fact, there is a line in the standards (which I wrote) that says that the student
    understands there are many issues which involve morals, ethics, values or spiritual beliefs that go beyond what science can explain, but for which solid scientific literacy is useful.

    g –> Now, immediately, we live in a civilisation in which science is still by and large regarded as the dominant way to know reliably, and “that’s not scientific” is tantamount to “that’s illogical” or “irrational” or “mythical” or the like. So, if a claim or view can be stigmatised as “unscientific,” it will typically be dismissed.

    h –> This is utterly misleading; especially in a context where polling of scientists has been substituted for the proper historical and philosophical analysis required to identify reasonable factors that can be used to identify what science is. In short Mr Krebs himself exemplifies the problem where the aura of “science” has been cast over the province of knowledge and expertise in general.

    i –> So the attempt to say that this is just a small sector of the vast domain of knowledge plainly and spectacularly fails.

    j –> Worse, as already identified, the definition distorts the praxis of science by smuggling in the back door the criterion that in scientific pursuits, only those explanations which are consistent with the evolutionary materialist perspective are permitted – that is the challenge that this redefintion is smuggling in dogmatism by the back door has a serious point. [Note, onlookers: not one of the evo mat advocates in this blog has ever been able to identify an empirical case where functionally specified complex information beyond the Dembski-type bound has originated by chance + necessity only; in a context where routinely and reliably in cases where we may see the causal process in action, such FSCI is produced by intelligent action. ]

    k –> Do we know that on empirically testable, relaiable, grounds, agents could not have been active in the origin of life or of the cosmos, for instance? No. But, through this attempted re-definition, we are invited to exclude such a logical and physical possibility ahead of examining the evidence by a rule that is historically unwarranted and philosophically question-begging.

    l –> Then — through the results of such dogmatic, ideologically loaded question begging redefinition backed up by censorship and career busting — the naïve are invited to think that there is no credible reason to infer that the FSCI in the nanotechnology of the cell, the explosion of such FSCI in the body-plan level biodiversity we see in the section of the fossil record known as the Cambrian revolution, and the organised complexity of the physics of the cosmos as a whole are “scientifically” known to be the products of chance + necessity only.

    5] Educationally . . .

    Science standards are meant to summarize current fundamental mainstream concepts. They are conservative, descriptive documents meant to provide beginning students with the basics so that at least some of them will be prepared to move further in science. It is not the role of science standards to present or make a case for ideas that have not yet “earned their wings”, so to speak, in the scientific community.

    m –> The obvious first problem here is that “current fundamental mainstream concepts” is in the context of a controversial, philosophically question-begging, ideologically loaded attempted re-definition of science by the evolutionary materialists. By injecting “current” they hope to sweep away the relevant history and phil of sci, inserting current “wisdom” as if that were the last or best word. And that in a context of institutional censorship and career busting and a resort to the polled opinions of the laymen on the subject: scientists, not philosophers of science.

    n –> As to he claim that the ideas in question are “conservative,” this is manipulative misuse of language: we are seeing a radical agenda, pushed by radicals, using the most destructive public relations tactics. A properly conservative view of science and scientific methods, would reflect what is sen across time, not what is the opinion of a dominant, strongly ideological faction of highly polarised institutions. And by that – for sadly excellent reason — I not must not only mean the ilk of NCSE or ACLU but have to, with regret include even the NAS, editorial boards of too many journals and the like.

    o –> Observe, onlookers. Mr Krebs nowhere addresses the sort of objective definitions of science that we can find in high-quality dictionaries, such as I BEGAN my remarks in 123 with – observe the utter absence of imposition of naturalistic or materialistic criteria on what scientific inference may do, but instead the emphasis on objectivity:

    science: a branch of knowledge conducted on objective principles involving the systematized observation of and experiment with phenomena, esp. concerned with the material and functions of the physical universe. [Concise Oxford, 1990 — and yes, they used the “z” Virginia!]

    scientific method: principles and procedures for the systematic pursuit of knowledge [”the body of truth, information and principles acquired by mankind”] involving the recognition and formulation of a problem, the collection of data through observation and experiment, and the formulation and testing of hypotheses. [Webster’s 7th Collegiate, 1965; I have deliberately chosen definitions from dictionaries that were published before the current controversies.]

    p –> As to “ideas that have not earned their wings,” etc, let us note, that as I showed all the way back to 123, and as may be seen in my always linked, we have recognised that causal factors include chance, necessity and agency all the way back to at least Plato’s Socrates. And, that each of the factors may leave empirical traces that may more or less reliably be distinguished and/or detected. Indeed,t eh common use of statistical and probabilistic methods in scientific investigations and analysis is premised in major part on precisely this. So, to impose ahead of time the criterion that logically and physically possible causal factors must not be considered if they will cut across the currently institutionally dominant view of evolutionary materialism, is to massively beg the question and dogmatically load the resulting redefinition of science.

    q –> it is also worth noting that the vilified board EXPLICITLY excluded exposition of ID in the 2005 standards. In short, the insinuation in the following extract is false and misleading – and is insisted on in the teeth of the strongest protest and direct statements in the now cast-away 2005 standards, to the contrary:

    The ID movement’s are with the adult scientific community: trying to prematurely insert these concepts into the state standards is an abuse of the educational system.

    r –> So, what was really at stake was the educationally sound path of taking a more honest, balanced and critically aware exposition of the evolutionary materialist paradigm and its associated origins theories. THAT is what has been unjustifiably suppressed by Mr Krebs and his ilk.
    All, at the expense of children in school and parents who are ill-equipped to know better.

    6] Board politics and alleged rule breakers

    Now, let us briefly turn to Mr Krebs’ remarks on the Board etc, in 212:

    Instead of following the recommendations of the committee they had appointed, creationist members of the state Board worked with various Intelligent Design/creationist advocates, in ways that are not part of the established procedures, to revise the committee’s recommended standards and eventually adopt standards which the committee disowned and rejected.

    In short, Mr Krebs’ “rule breaking” accusation boils down to: they did not follow the MAJORITY [plainly, given the above, unsound] report.

    Instead, they followed a minority report.

    Sorry, Mr Krebs, it is the BOARD who were elected to make decisions on the part of the public, not self-anointed “experts” such as you have shown yourself to be. And, in that context, to blindly follow unsound advice by the majority of a polarised panel, is obvious folly.

    Nor can we – given your track record of distortions and misrepresentations in this thread — take your summary of the course of events in Kansas as anything like a true or fair view; your inability to accurately and fairly address what I have said while present here and now tells us that. [Onlookers, please go to the links in 246 above for a bit of the other side of the story.]

    On the evidence of the issues in this post, the Board acted wisely in 2005, rejecting the unjustified innovations of 1999.

    Sadly, after a massive media manipulation campaign conducted on lines we have seen above in this blog thread, the public have been misled by those they have naively trusted to lead them aright, to reverse that action.
    _______

    Mr Krebs, you need to do some very serious soul searching and rethinking. Then, you need to get up and set about fixing the harm you have helped to do.
    A soul-searching read of the obvious [but often overlooked] manipulation of the public in Plato’s Parable of the Cave would be an excellent place to begin, especially if you include some readings on the sad fate of Socrates at the hands of the resulting manipulated Athenian public.

    GEM of TKI

  243. PS: I am glad to see that the issues on the merits in 187 -8 are now being taken up, especially the huge increment in functionally specified complex information [FSCI] locked away in epigenetic factors. We need to think soberly about the only reliably known cause of FSCI and what an empirically anchored induction from that would lead us to. DV, I will come back on this later on — right now I have a “flu house” to deal with.

  244. PPS: ericB here has an excellent post on the underlying issues: unjust balances. So, if you find my point by point plod above hard to follow, have a look there first — in a thread that is currently in large part looking at possible Creationist ideologisation of science.

  245. PPPS: So does Paul Nelson here. [And the thread in which eric B was posting has some very useful comments in general.]

  246. Science is a tool we use to help us figure out the reality behind that which we are investigating.

    The word “natural” is any definition of science is ambiguous. Both intelligence and design are natural.

    And this universe cannot owe its existence to natural processes as natural processes only exist in nature- ie once nature comes into existence.

    Science also requires objective testing and repeatability. Universal common descent cannot be objectively tested- all the supporting evidence for UCD can be used to support alternative scenarios.

    ID is NOT asking anyone to investigate the supernatural. However we can and do investigate objects that are a product of intent on a daily basis.

    So here it is Jack or Bob O’H:

    How can we objectively test the premise that chimps and humans share a common ancestor?

    I will make a bet that any test you come up with I can match for a different scenario.

  247. kairsofocus:

    1. I don’t think you know what ad hominem means. Can you find an actual statement in one of my posts that is an ad hominem attack?

    2. You write,

    Sorry, Mr Krebs, it is the BOARD who were elected to make decisions on the part of the public, not self-anointed “experts” such as you have shown yourself to be.

    Actually, we were Board “anointed” experts – the Board chose us and empowered us to do the job. Their job as elected officials is to listen to the experts that they themselves have chosen. For them to think that they know more about curriculum matters than the members of the education committee that they choose to do the work is politically motivated micro-management, not good educational management.

    And it’s telling that both times that the Board subverted the standards, in the next elections enough of those responsible were defeated in elections, some decisively, to overthrow their decisions. Obviously the public didn’t think they’d done the right thing in ignoring the work of their duly anointed appointed committees.

  248. kairosfocus and Jack Krebbs et al.

    Can we get beyond the heated rhetoric and focus on the heart of the issue:

    As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes.

    Materialism claims there are no tools to test.
    ID is proposing that such design can be detected regardless of whether it is human, alien or supernatural direct causation.

    Look at Reverse Engineering.
    Does inference of design principles infer intelligent causation?

  249. Jack Krebs:

    Leo Stotch:

    You are defending a politically- correct aberration called “methodological naturalism,” a set of arbitrary rules that has nothing to do with science and everything to do with power maintenance. Until 15 years ago, no philosophy of science textbook used the term. Consult any history of the philosophy of science and you will find nothing about it. This formulation was designed specifically to put intelligent design into disrepute and for no other reason. That is why the irrelevant passages in the Kansas formulation contain allusions to the “supernatural,” so as to further institutionalize the lie that ID is a faith based enterprise.

  250. One of the things that I read recently is that there are none or almost no fossils of the great apes. So if one was speculating on ancestors there is nothing except the extrapolation backward from current species to some supposedly hypothetical distant ancestor.

    If we are to compare any of the primates existing today all there is are their genomes and most of these genomes are composed of long repetitive sequences. There is also the methylization on top of each sequence and till all this gets figured out nothing can be settled. There is one human chromosome, I believe it no. 10, that is almost entirely made of these long sequences with only a few coding regions.

    So while they have the genomes to compare, those studying them are at the kindergarten level of learning. How fast they advance will depend upon funding and unless they have a medical use for the research it will be slow because that is where the funding mainly goes.

  251. Jack Krebs,

    you said

    “Actually, we were Board “anointed” experts”

    Did you excuse yourself when it came to biology because by your own admission you do not know anything about it, or at least the so called heart of biology, evolution. So you are hardly an expert. An expert is not one who routinely says that experts believe it. An expert is one who can cite chapter and verse to back up his position.

    Why were you picked?

  252. Jerry:

    1. When did I admit that I know nothing about biology and evolution? I’m certain I never said anything like that.

    2. I was picked for the committee for a number of reasons. First, I had been the curriculum director for my school district for many years, although I don’t hold that post now. I had spent a number of years working on district standards in science, social studies, English, math, and health education. From that work, I was fairly thoroughly conversant with national recommendations about science curriculum, and had spent many hours working with our science teachers to fine-tune and restate those recommendations to fit our students. (This was before the state stepped in and took over the work by creating state standards.)

    I had also been on the state math standards committee back in the early ’90′s.

    As my work on the committee showed, I am quite knowledgeable and skilled in the process of writing standards: the structure, language considerations, group facilitation, and so on.

    And last, I have an anthropology degree, with background especially in human evolution and the evolution of behavior.

    The committee had a number of different types of members: curriculum directors such as myself, classroom teachers, professors of science and science education, and so on. I was well qualified for the job.

  253. And last, I have an anthropology degree, with background especially in human evolution and the evolution of behavior.-Jack Krebs

    Great- so how do you objectively test the premise that chimps and humans share a common ancestor?

    Can you point out the scientific data which demonstrates the genetic differences observed can account for the physiological and anatomical differences?

    I ask because it appears that the debated aspects of biology do not reflect your accepted definition of science.

    Or do you think that imagination is a proper substitute for scientific data?

  254. Jack Krebs,

    Whenever you are asked anything about evolution, you punt or deflect the answer to one of evading the issue. When you do say something, your standard response is that all the experts accept it. When for the first time on this thread you provide some substance, it is the wrong answer. This does not sound like someone who is an expert.

    From your answers you seem to think micro evolution is enough to get you by when the debate is on a plain far above that. ID accepts micro evolution and in any of your conferences or meetings you should make that point. Because you do not seem to understand this, then you should excuse your self from writing biology standards or participating in construction of these standards.

    Maybe you can use your evolution background to answer the assertion that Darwinian processes cannot explain several key areas of evolution, namely the origin of macro evolution events, of which there are certainly thousands if not much more. Darwin’s ideas can explain the trivial stuff that he saw on his voyage on the Beagle but not the big stuff. Everything that Darwin say is easily explainable on micro evolution terms. But not the complicated stuff.

  255. —–”Leo: “StephenB, once again you impute to me motives not in evidence. I am beginning to think you don’t like me.”

    Actually, I do like you. That is why I apologized to you twice for once speculating about your motives. That you didn’t accept my apology suggests that you don’t like me.

    In any case, you will find not a word about motives in my latest correspondence which was directed at two people not one. Clearly, you defend methodological naturalism and that is the point I was arguing against. I made that point with no allusions whatsoever about your intents or motives. Reread my comments carefully. Your charge against me the first time was fair. This time it isn’t.

    That said, I would like to start over in the spirit of friendilness and mutual respect. That means I would reserve the right to disagree with your ideas without being accused of attacking you personally. It also means that you maintain the right to be treated with respect. So, are you OK with starting over?

  256. DLH (and others):

    Caught in a rain storm, popped back.

    Now that we can see what we are plainly dealing with on the agenda-driven, ideologically loaded attempted re-defintion of science [i.e. unacknowledged insertion of materialism by the back-door, thus corrupting the very nature of science, science institutions and even science education], we safely can dismiss what is just noise and return to the substance of the blog thread.

    For that, I beg to draw our attention (while I am stuck here in a rain storm) back to the sequence of issues raised in 187 – 88 on the main issues for the thread. For that, RRE at 112 as adjusted is as good a place to begin again as any:

    . . . Microtus pennsylvanicus is [a complex bio-system based on the cell, i.e. on] a MICROSCOPIC MACHINE with an even smaller genetic CODE or INSTRUCTION SET to BUILD proteins [its key parts] from scratch.
    The bacterium [cell, thus also the animal built up from cells organised in tissues, organs and body plans,] fits the standard definition of a machine [AmHD: “A device consisting of fixed and moving parts that modifies mechanical energy and transmits it in a more useful form”]; you can look it up yourself. All machines when studying [for which we directly know] their origin were intelligently designed. So [from repeated and so-far exception-less empirical observation, we reliably know] it takes intelligent causes to produce them . . . .

    Show me any machine or code [M-WD: “a system of signals or symbols for communication”] that can be produced without intelligence. You cannot do it [or you would have dome so already]. Only human intelligent designers [have been observed to] make machines and codes, with the very real exception being biological organisms, which are more complex machines with a more complex code than we can make today with our own intelligent designing skills. So the finger goes back to you[the evo mat scientist] —YOU must empirically demonstrate a [functioning, complex] code or machine that has been caused into existence without using intelligent causes– purely naturalistic mechanisms as you say.

    Since you are excluding intelligent causes from your origins hypothesis a priori, as well the scientific realm when it comes to machines and codes, then YOU must provide and demonstrate empirically, a CODE and a MACHINE from some OTHER MECHANISM.

    A fair challenge and after well over 100 posts since, unmet; unmet because the evo mat advocates cannot do what is really required to actually scientifically establish their case.

    Now, on the specific origin of men and chimps, I call our attention back to:

    a –> We speak, vocalising ideas in spoken words in sound-based languages; chimps etc. evidently cannot (though of course parrots can verbalise words and in some cases may possibly understand some of what they say). How is this accounted for on the known claimed small percentage DNA differences between us and our “cousins” [was it 1%, 2%, or – per ericB at 178, 5%, and BTW where does that figure come from, and to what phenotypical significance, chromosome by chromosome?]? How has this been accounted for in terms of chance + necessity only, working through random variation and natural selection, beyond ad hoc just-so stories, i.e. on an empirically testable “scientific” basis? I see here ericB’s telling remark:

    {{The traditional X% figure only considered differences in protein coding sequences in DNA, not the rest of DNA, which now is known to be able to influence interpretation . . . . Even in regard to coding DNA, the traditional X% figure ignores sections where chimps and humans have nothing in common. It only measures differences in shared coding regions.}}

    b –> We express ourselves in complex, arbitrary verbal codes that embrace concepts of identity, action, effect, purpose, past, present, future, abstract concepts etc. The various apes etc do not. How is this accounted for on the same terms?

    c –> We have fully opposable thumbs, apes etc — as a rule — evidently do not. That seems a simple enough modification, and is plainly highly useful – it is critical to the capability of the human hand. If our populations diverged in similar environments at the same time [and were close enough to hybridise with ancestral chimps], why did we develop such full opposability fairly rapidly, while our ape “cousins” as a whole did not? Conversely, if our ape cousins did not need it to survive and thrive in evidently similar environments, why and how did we develop the fully opposable thumb? [I am here speaking to the issue of mutations, environmentally driven selection and change vs stability of organism architecture.]

    d –> In short, I am speaking to two key differences between us and our cousins: (i) the verbalising, conceptualising mind-brain system, and (ii) the hand that gives effect to what is conceived. That is, the issue is: how do we account for these key differences within the allegedly small genomic changes, and the time available and the similarity of environments in which the change vs stasis are claimed to have happened?

    e –> Further to this, how do we account for the issues on fertility and reproductive isolation vs hybridising that are associated with this thread, in the context of the key changes noted?

    _______________

    I think that these five points help put issues over chromosome 2 or the X-chromosome, etc in context.

    Jerry, at 244 makes a good start:

    to stay on topic there is a discussion about the mating of hybrids and the possible problems caused by epigenetic factors. These are real and are primarily the methylization of the genome which turns on and off various proteins and is what affects cell type and also distinguishes the DNA which comes from the mother from that which comes from the father. There a lot of interesting topics such as micro RNA’s which is a hot topic these days in micro biology. The book is well researched. It is also an example of people in the evolutionary biology community arguing with each other.

    Now, on substance, how can we move on from this point?

    GEM of TKI

  257. Leo Stotch:

    Jack Krebs:

    Let me once again focus in the central issue. We are discussing a politically correct aberration called “methodological naturalism,” a set of arbitrary rules that have nothing to do with science and everything to do with power maintenance. With all the distractions, no one has yet addressed the issue: Until 15 years ago, no philosophy of science textbook used the term. Consult any history on the philosophy of science and you will find nothing about it. What about that?

    This formulation was designed specifically to put intelligent design into disrepute and for no other reason. It is an intrusion into free thought and open inquiry, and you have provided no rational justification for it. Your only defense is that a large number of scientists are equally invested in your ideology. None of the great scientists of the past had to endure these kinds of restrictions. What about that?

    By imposing these standards, you militate against the advance of science and perpetuate a culture of mediocrity. Creative minds are providing new ways of looking at old problems from a rigorously scientific perspective. Yes, they are in the minority, and that is exactly why you should sponsor and encourage them. History confirms that it is the dissenting minority that is responsible for all real progress. What about that?

  258. Stephen writes,

    Until 15 years ago, no philosophy of science textbook used the term [methodological naturalism].

    True. It’s a recently coined phrase.

    Stephen continues,

    This formulation was designed specifically to put intelligent design into disrepute and for no other reason.

    False. The term was coined by Paul deVries, a philosopher at Wheaton college, a conservative Christian institution. I believe my friend Keith Miller, editor of the book Perspectives on an Evolving Creation, has written on this, showing that deVries coined the term to support the view that Christian belief and science need not conflict, and that his use of the term and its intent had nothing to do with ID. I’ve emailed Keith and ask for more information.

    Also the idea that science seeks natural causes only goes back to the beginnings of modern science, with Galileo, Newton, and others, and earlier. See this post for more information about this.

    And last, Stephen writes,

    None of the great scientists of the past had to endure these kinds of restrictions. What about that?

    Please name a great scientist of the past whose work that made him famous involved anything other than a natural explanation for the phenomenon he was studying.

  259. 259

    Piggybacking on the discussion of methodological naturalism‘s origins as a term: a term does not always emerge at the same time as the idea it expresses. The idea of methodological naturalism is, as Jack says, as old as modern science. The term was needed because attacks on science confused the issue, calling into question what was taken for granted.

    We can compare the term trinity, which is found nowhere in Scripture but was needed later to clarify and make explicit what (for traditional Christians) was always an essential component of Christian faith.

  260. —–Jack Krebs: “Please name a great scientist of the past whose work that made him famous involved anything other than a natural explanation for the phenomenon he was studying.”

    The point is, they didn’t need anyone to hogtie them with rules, nor did they need a bureaucrats to tell him how to ply their trade. One of the reasons they were great is they were ready to put aside their personal biases and prejudices and follow where the evidence lead them. In other words, they questioned their own assumptions. That is what made them great.

    Today’s great scientists are of that same mind set. They are challenging the mindless biases and prejudices of the scientific establishment. That means questioning the failed paradigm of neo-Darwinism. Your scheme is calculated to forbid the questioning. Further, you missed the main point: History confirms that it is the dissenting minority that is responsible for all real progress. How convenient of you to ignore that.

  261. —–Leo Stotch: “So, to the extent that ID does not require supernatural causation, it can be advanced within the process of methodological naturalism.”

    Ridiculous. Methodological naturalism rules out any inference to intelligent agency in principle. Why would you suggest otherwise?

    —–And that is why I have been an advocate of the design inference not being the goal if ID-based inquiry, but rather the prerequisite to it.

    You are confusing an inference with a presupposition.

    —–Once the design inference is in the bag, it is important to understand the who, what, where, when, why, and how of the design work.

    How open-minded of you to withhold ID the privilege of deciding for itself what its goals ought to be.

    —–This will lead to biological/medical advances undreamed of. And that is where success lies for ID. Not in clever metaphors or philosophical musings, but in the development of real-world applications that people can use in their lives. Use ID to cure a disease and Darwinism will fall like a ton of bricks.

    Yes, I have heard that line from you before. Let ID provide a miracle, and then you will grant it a fair hearing. By the time it reaches those heights, it will not need defending. The time to defend it is right now, while misguided zealots are trying to kill it before it blossoms. Do you really expect me to believe that you would like to see “Darwinism fall like a ton of bricks.”

  262. —-Leo: “What I don’t understand is why you feel that disallowing appeals to the miraculous is a handicap for ID? How exactly does on repeatably test a miracle?”

    What I don’t understand is why you don’t understand the difference between an inference to agency and a miracle.

  263. —-Leo: “That is what the lawyers call non-responsive. The court notes that you cannot name a scientist, great or small, past or present that came about their discovery by any other means except seeking natural explanations to natural phenomenom.”

    This is what judges call jumping to conclusions. These great scientists were not seeking solely natural explanations. They were seeking the right explanation whatever that might happen to be. All these great scientists insisted that they “were thinking God’s thoughts after him.” As it turns out, it was that open-mindedness that permitted them to investigate the natural laws, which they considered to be a part of a bigger picture. It is the same open-mindedness that ought to prompt us to consider intelligent agency.

  264. —–larrynormanfan: The idea of methodological naturalism is, as Jack says, as old as modern science. The term was needed because attacks on science confused the issue, calling into question what was taken for granted.

    The IDEA of methodological naturalism has been around for a while. The DRACONIAN ENFORCEMENT of methdological naturalism is about 20 years old.

  265. 265

    StephenB, if Newton (to pick an example) was “not seeking solely natural explanations,” but his greatness (and the greatness of all other great scientists) derives solely from the natural explanations that he provided, and if every scientific success to date also derives from natural explanations, then it would seem pretty smart to focus on those natural explanations in science, no? What’s to be gained from the supposed openness you tout, in other words, if non-natural explanations have gained no traction in science (the groundbreaking discoveries of ID excepted, of course)?

    Sorry for the snark, but you’re clinging to an anti-materialist science despite admitting the astounding success of science practiced in materialist terms.

  266. —–”StephenB, if Newton (to pick an example) was “not seeking solely natural explanations,” but his greatness (and the greatness of all other great scientists) derives solely from the natural explanations that he provided, and if every scientific success to date also derives from natural explanations, then it would seem pretty smart to focus on those natural explanations in science, no?”

    It is absolutely essential to look for natural explanations first and foremost. That has always been the priority and should continue to be. However, to give something top priority is not synonymous with ruling out everything else indefinitely. That is the distinction that is not being made.

  267. StephenB, if Newton (to pick an example) was “not seeking solely natural explanations,” but his greatness (and the greatness of all other great scientists) derives solely from the natural explanations that he provided, and if every scientific success to date also derives from natural explanations, then it would seem pretty smart to focus on those natural explanations in science, no? What’s to be gained from the supposed openness you tout, in other words, if non-natural explanations have gained no traction in science (the groundbreaking discoveries of ID excepted, of course)?

    Hey larrynormanfan,

    I have to stop you here, because you make the mistake of thinking that what we consider “natural” was also viewed as “natural” in Newton’s day. It was not.

    Newton was mocked by followers of Descartes, Leibniz and other Mechanistic Natural Philosophers because they felt he was re-intorducing “occult” influences with his non-mechanical, action-at-a-distance “gravity”. They said his explanations were not science, since they did not provide a mechanical explanation for the phenomena, even though they were mathematical, and were essentially “magic”.

    From “The Sceintific Revolution” (Stephen Shapin, Univeristy of Chicago Press, pg.63)

    Crucially, however, Newton reintroduced, or at least put new stress on the role of, immaterial “active powers” in a properly constituted natural philosophy…

    Newton insisted that he had not sacrificed mechanism; such rivals as the German Gottfried Wilhelm Leibniz (1646-1719) violently accused him of using the enormous cultural prestige of mathematics to reintroduce occult principles and of abandoning the dream of specifying a completely mechanical universe.

    I guess there really is nothing new under the sun. In the same way, IDers are accused of using math to introduce “religion” (a false claim) or the “supernatural” into science…perhaps all ID is doing is showing, like Newton, that a simpler explanation exists, even if it is not completely “mechanistic” in the the sense of being included in the currently acceptable set of “natural” causes.

    Tomorrow, perhaps notions such as Intelligence, Will, or Teleology will be considered as “natural” and “mechanistic” as gravity is today.

  268. —–I really don’t care what you believe about me. You are only here spoiling for a fight. And I am your chosen target because I understand that appeals to supernatural causation are ultimately not testable and, thus, cannot be scientifically studied with any repeatable rigor.”

    I am simply holding you accountable for propping up well-tested strawman. ID does not to appeal to supernatural causation. No one who knows anything about a design inference would use that kind of language. So what am I supposed to do, let it pass. It allows for the possibility of supernatural agency, or human agency, or any other kind of agency, but that is in no way the same thing. Once again, ID studies the EFFECTS OF INTELLIGENT AGENCY.

  269. —–Atom: “I guess there really is nothing new under the sun. In the same way, IDers are accused of using math to introduce “religion” (a false claim) or the “supernatural” into science…perhaps all ID is doing is showing, like Newton, that a simpler explanation exists, even if it is not completely “mechanistic” in the the sense of being included in the currently acceptable set of “natural” causes.”

    —-”Tomorrow, perhaps notions such as Intelligence, Will, or Teleology will be considered as “natural” and “mechanistic” as gravity is today.”

    Excellent point Atom. And well stated.

  270. —– Leo: An excellent point, Atom, and succinctly stated. Which supports my opinion that it is simply insufficient to stop at the design inference. By stopping there, we foreclose an investigation to learn more about our world and may miss opportunities not available to the Darwinists.

    And you accuse me of putting words in YOUR mouth.

  271. Leo mentioned a point earlier that I want to follow up on.

    StephenB wrote,

    These great scientists were not seeking solely natural explanations. They were seeking the right explanation whatever that might happen to be. All these great scientists insisted that they “were thinking God’s thoughts after him.” As it turns out, it was that open-mindedness that permitted them to investigate the natural laws, which they considered to be a part of a bigger picture. It is the same open-mindedness that ought to prompt us to consider intelligent agency.

    All these great scientists were seeking were “the right explanation”, to quote Stephen, and what they found without exception were natural explanations. This ought to tell us something about what kinds of explanations are successful, and which are not.

    Note also that many (not all) of these great scientists did their work as committed theists – they, as Stephen wrote, thought that they “were thinking God’s thoughts after him.” They saw no conflict with their Christian faith and their search for natural explanations. In fact – it looks like they had no problem being methodological naturalists!

  272. By the way,

    This is all vaguely reminiscent of the argument that philosophy has never produced anything of value.

    To quote Bertrand Russell (The Problems of Philosophy, pp. 154-155)

    But if you put the same question to a philosopher, he will, if he is candid, have to confess that his study has not yet achieved positive results such as have been achieved by the other sciences. It is true that this is partly accounted for by the fact that, as soon as definite knowledge concerning any subject becomes possible, this subject ceases to be called philosophy, and becomes a separate science. The whole study of the heavens, which now belongs to astronomy, was once included in philosophy;…

    This is somewhat similar to the claim that science has only progressed by looking for “natural” explanations…this is trivially true, since once a new class of causal forces is accepted as an explanation, this new force is now also “natural.”

    This is why we should follow the evidence wherever it leads, even if that is to explanations that are not currently within our set of respectable, “natural” mechanisms; Remember, Newton’s gravity was once considered something other than “natural”.

  273. —-Leo: “Wrong. It (design inference)only disallows inference to supernatural (and thus untestable) agency. Natural intelligent agency is allowed. It is you that have ruled out the possibility that the intelligent designer is a natural entity. Why is that?”

    It is clear that you have not investigated the methodology of the explanatory filter. A design inference reflects only the presence of intelligent agency. It cannot make a judgment about whether that agent is natural or supernatural. Methodological naturalism forbids addressing anything other than physical laws or chance. You are using the word “natural” in an imprecise way.

  274. 274

    Atom [278], I agree that what is called “natural” has changed. Note, though, in your quote from Shapin (an excellent book, by the way), Newton’s stated commitment to “mechanism” (by which Shapin means a mechanical and natural description of the universe):

    Newton insisted thathe had not sacrificed mechanism; such rivals as the German Gottfried Wilhelm Leibniz (1646-1719) violently accused him of using the enormous cultural prestige of mathematics to reintroduce occult principles and of abandoning the dream of specifying a completely mechanical universe.

    In other words, Newton argued that gravity was, in fact, “mechanistic” (natural). Jack Krebs [283] says it better than I could:

    All these great scientists were seeking were “the right explanation”, to quote Stephen, and what they found without exception were natural explanations. This ought to tell us something about what kinds of explanations are successful, and which are not.

    Meanwhile you speculate:

    Tomorrow, perhaps notions such as Intelligence, Will, or Teleology will be considered as “natural” and “mechanistic” as gravity is today.

    Maybe, though I doubt it. That’s certainly the hope of believers in (for example) astrology, “water memory,” and telekinesis. But time has not been kind to them as far as science goes. Further, I think most IDers would be unhappy in practice if that were the case, as the vast majority have a prior commitment to an origin of intelligence outside of nature (except in the case of the Incarnation). I note the usual exceptions (Mike Gene and David Berlinski).

  275. I liked Atom’s point about Newton and some of the resistance his ideas received in their times.

    So I’d like to point out there is nothing to prevent ID theorists from making the best case they can for whatever they want to make a case for, and if they want to make a case for stepping outside the bound of methodological naturalism, they are free to do so.

    But they have to make convincing arguments, and so far they have not.

    Note well that what I mean is not that they haven’t convinced me, which is not very important, but that they haven’t convinced any significant portion of the scientific community.

    Newton’s ideas won out because he backed them up with other aspects of the scientific method: data, tested hypotheses, etc. Perhaps ID will also win out.

    But at this point ID is mostly philosophical arguments, saddled by a connection to clearly religious beliefs (young-earth creationism being one) and political moves (trying to influence state science standards), and these are not the ways minority views in the past have eventually succeeded.

    So I find the complaint of “draconian enforcement” empty. Great scientists in the past who took a minority view became great because they buckled down and did the work and eventually convinced the world they were right.

    If you think that something other than seeking natural explanations is fruitful, then show the world by bearing some fruit.

  276. 276

    Atom, your last post makes a great case for classifying ID as a type of philosophy rather than science.

  277. —–Leo: “Or maybe you could recognize that you are operating with the presupposition that the agency must be supernatural. Without that a priori assumption, your objection to The Scientific Method is logically incoherent, because any other type of agency is accessible through The Scientific Method.”

    No. Again, a design inference begins with empirical observation. If it began with a presupposition of any kind, then the whole exercise would be a tautology, the conclusion would already be in the presupposition. Inferences to the best explantion don’t work that way. They proceed from data to inference.

  278. Atom, your last post makes a great case for classifying ID as a type of philosophy rather than science.

    How is that?

    Simply because ID hasn’t produced any “results” that are widely acknowledged?

    Russell’s point was that you can win an argument in “True Scotsman”/”True Science” fashion, but that it is an empty victory.

    If you want to say that ID relies on “supernatural” forces or mechanisms, and that science has only progressed by accepting “natural” mechanisms and forces, then fine. You win the argument.

    But it is a trivial victory.

  279. So I find the complaint of “draconian enforcement” empty. Great scientists in the past who took a minority view became great because they buckled down and did the work and eventually convinced the world they were right.

    If you think that something other than seeking natural explanations is fruitful, then show the world by bearing some fruit.

    I agree with you Jack. I think history will absolve ID in the same way it absolved Newton and his “occult” forces. Newton’s model did not fit into the “science” of the day (Mechanistic Philosophy), but it was well thought out, mathematical, and made predictions.

    Though you’d disagree, I see ID in much the same light. It does not fit into the “science” of our day, but I find the work of Dembski, Meyers, Behe, ReMine, Sewell and others well thought out, mathematical (where applicable – see Dembski’s work on Active Information and CSI, ReMine’s work on population genetics, or Sewell’s work on the 2loT), and full of predictions (limits of law based and chance processes, the edge of evolution, speed limits of genetic change, etc.)

    History will show who was correct. In the mean time, there is work to be done…so please support the right of ID scientists to ask these questions and research them thoroughly without losing their jobs or positions.

  280. 280

    (289) Jack Krebs, you have little respect for ID proponents. Which is to be expected as you are affiliated with a group that won’t allow to science teachers to reasonable bring up doubts on Darwinism.

    Isn’t this fascism?

  281. larrynormanfan:

    Atom, your last post makes a great case for classifying ID as a type of philosophy rather than science.

    Actually, larrynormanfan, I see Id exactly as this, a type of philosophy, a philosophical framework. It certainly isn’t a theory, an hypothesis.

    However, within the ID framework, there are scientific hypotheses. IC, SCI, etc. are falsifiable scientific hypotheses that are the product of the philosophical framework of ID.

  282. —-Jack Krebs: “But at this point ID is mostly philosophical arguments, saddled by a connection to clearly religious beliefs (young-earth creationism being one) and political moves (trying to influence state science standards), and these are not the ways minority views in the past have eventually succeeded.”

    We are not talking about young earth creationism, which is faith based; we are talking about intelligent design, which is empircally based. In any case, definitions are always arbitrary, as is the line of demarcation between science and non-science. The theory of intelligent design is a counterpoise to Darwinian evolution. Each theory has the power to falsify the other. In other words, they represent parallel explanations.

    So, if scientists want to say that ID is not science, they must say the same thing about Darwinian evolution, because both are alternate inferences to the best explanation. Just as Newton discovered physical laws in his day, scientists have discovered coded information in our day. Sadly, the Darwinists either do not understand or refuse to accept the extent to which that new development changes things.

  283. 283

    (293) Atom, one think the movie Expelled is supposed to expose, is how ID research is being “covered up”.

    There is already enough data to make a robust case for intelligent design. See the DESIGN OF LIFE.

    I hope I’m not placing too many expectations on the movie, but hopefully it will blow the lid off persecution of design theory.

  284. Re: Jack Krebs (289) “So I’d like to point out there is nothing to prevent ID theorists from making the best case they can for whatever they want to make a case for, and if they want to make a case for stepping outside the bound of methodological naturalism, they are free to do so.”

    In the way that Guillermo Gonzalez was free to do so so?

    Were you meaning to add “(provided that you keep quiet and stay undercover long enough to get tenure first)”?

  285. p.s. Jack Krebs (289), By “freedom” did you mean the “freedom” that Dr. Richard Sternberg had to publish a pro-ID paper that had passed the critical review of four reviewers with a combined five relevant Ph.D.s?

    Or do you mean the “freedom” that Dr. Richard Sternberg “enjoys” now, after having his career deliberately shredded and trashed? Indeed, he has been “freed” from much, starting with the keys to the research facility.

  286. Off topic, but now that it has been mentioned, I have always wondered if Dr. Sternberg ever found a new job after he got fired?

  287. 287

    poachy, he was never fired, IIRC.

  288. Back at 294, PannenbergOmega brought up a point that is relevant to this idea of freedom. He wrote,

    (289) Jack Krebs, you have little respect for ID proponents. Which is to be expected as you are affiliated with a group that won’t allow to science teachers to reasonable bring up doubts on Darwinism.

    I assume that Pannenberg is referring to the fact that I, and Kansas Citizens for Science, support the Kansas Science standards, which include mainstream concepts of evolution.

    If so, I can say categorically that Pannenberg is wrong: the Kansas science standards do not stop science teachers from bringing up “reasonable doubts about Darwinism.” The science standards do not prohibit anything whatsoever. They are not meant to be all inclusive curriculum.

    Standards are a summary of main concepts that the teacher should cover. All science teachers teach more than is in the standards, and I’ll venture that all teachers in some way teach questions, doubts, ambiguities or further complexities about the topics they teach. Not only do the standards not prohibit such things, good pedagogy encourages teachers to do so.

    What the teacher does teach beyond the standards is a local curriculum issue, and there the teacher does have some limits on his or her freedom, because the teacher is contractually obligated to teach within the bounds of the district’s curriculum. Some districts are very strict about exactly what should be taught, and some (such as the small district in which I work) are not, leaving curriculum decisions in the hands of the individual teacher.

    So in this respect the nature and extent of the “doubts about Darwinism” that a teacher might bring up are limited by what the local administration might feel is reasonable. Given the importance of high stakes testing these days, many schools would probably limit such additions to the curriculum on pragmatic grounds: we have more to teach than we have time for as it is.

    And of course, they are ways in which a teacher could cross legal boundaries: a teacher who taught not just “doubts about Darwinism” but also the alternative explanation of young-earth creationism would open himself up to legal action. A public education teacher doesn’t have the freedom to teach young-earth creationism.

    So, in summary, any restrictions on the freedom of a teacher to teach “doubts about Darwinism” do not come from the science standards, but from the contracts the teacher has with their school system, and from the laws of the United States.

    The larger issue is this: one’s freedom to act does not imply a freedom from reaction. One is free to be a jerk, but the consequence is that one may have no friends. One is free to espouse controversial ideas, but one will undoubtedly run into resistance when one does: that should be expected. I have friends right here at the University of Kansas that are on the minority side of some issues (the dinosaur-bird relationship and the effect of gamma radiation from nearby stars on mass extinctions). It is part of their life as scientists to get criticism, some of which can become personal and some of which gets entangled with larger university political issues. This is just the way life goes.

  289. 289
    irreducible_complacency

    Jack you make it sound so innocuous. If you are not allowed to teach the Truth, then what difference does it make what you teach?

  290. larrynormanfan,

    Tell us just what did happen to Dr. Sternberg. Your reply seems like an attempt to say nothing happened to him.

  291. Participants (and onlookers):

    Sadly predictable.

    But now, I better ‘fess up to a bit of a hidden agenda. Namely, a concealed, informal expert elicitation calibration exercise. (Y’see, I do know some of the tricks of the “facilitator’s” trade . . . even if I usually refuse to use the more shady techniques.)

    1] Expertise calibration . . .

    You see, in 263, in response to DLH’s — recall, he holds some authority in the blog — call to focus back on substantial matters, I resummarised the substantial issues for the thread [as I had already posted at 187-88], i.e. I was not at all “changing the subject [having lost on the merits]” as Mr Storch seems to imagine. [Actually, as the evo mat advocates have consistently been unable to provide a cogent answer on the merits of OOL, OO body plan level biodiversity etc relative to chance + necessity only, intelligent agency stands by default as the only credible, empirically warranted explanation. That's plainly the reason why there is a move to beg the question by trying to rule agent factors out before examining the facts and calling on all relevant possible causal explanations to speak up for themselves on the merits.]

    More directly, 263 provided an opportunity for instance for Mr Krebs to show that he is able to credibly answer to the substantial matters of chimp-man evolution and hybridisation [thus calibrating his explicitly claimed “expertise” and showing that there is something there in the chimp-man story beyond just-so stories in the name of science], as well as associated matters tracing all the way back to the origin of life in whatever postulated pre-biotic soup scenario he cares for. In this case, silence is revealing, utterly and sadly revealing.

    As well, he had the opportunity to show that he can rise above the pseudo-consensus techniques that radical educators and other advocates in the guise of “experts” and “facilitators” so often resort to. [Observe how if one had only his account, one would infer that the committee presented a consensus view; i.e. I am here noting on the techniques he and others plainly used that suppressed the range of calibratably credible expert opinion, in the interests of a radical agenda.]

    Pseudo-consensus, sadly, is a well-known stratagem of too many so-called progressive educators, as I know all too well from having worked with curriculum and programme development as well as a few “change” facilitation exercises: unfreezing, changing, refreezing in ways that do not respect the integrity of persons and their right to have proper disclosure on what is being done to them as well as reasonable access to the full range of material factors to guide sound decision-making. [Cf. Lewin, 1947, Schein, 1961 etc.]

    So, it is utterly unsurprising to me that the suppressed minority in the committee courageously took the only reasonable path open to them after having obviously been savaged and suppressed through ruthless manipulative techniques: they blew the whistle and communicated a minority dissenting report on their own initiative; showing the true state of what science is, relative to the history, phil and current and historical praxis of science in the real world. Further to this, many of the points Mr Krebs makes above, in my considered opinion, reflect obvious retaliation against whistleblowing. (Indeed, now that there are whistleblower protection statutes on the books in many jurisdictions, some members of the committee may have legal recourse to defend their publicly savaged reputations.)

    Mr Storch may well be surprised to see that his “expertise” was tried and found wanting.

    But, similarly, he had the opportunity to show that he had responsibly interacted with issues of the imposition of methodological naturalism and its implications, vs. the free ability of scientific practitioners to infer across the three major empirically observed causal factors: chance, natural regularity, agency. In particular, all the way back to 123, and as raised again in 247, I pointed to the implications of statistical methodologies such as ANOVA, techniques which are commonly applied to real-world science.

    For, if methodological naturalism did not inject a selectively hyperskeptical inconsistency, we would at once see the relevance of such techniques for the properly scientific status of the design inference. But, Mr Storch is plainly far too captivated by the idea of the “consensus” of practitioners, and is consistently too willing to pigeonhole by affiliation to notice that.

    In short, both failed an informal expert elicitation calibration test — their opinions and assertions should therefore be precalibrated by our knowledge of that failure, when we make decisions on the results of this thread. Now, too, the why and how of the failure is interesting. But first, let the participants and onlookers note that fact of failure, and its implications: want of true expertise and want of ability to work with diversity of opinions among experts, decision-makers and the public.

    2] Expert elicitation?

    A bit of context will help.

    For some 13 years now, we here in Montserrat have had to live with an erupting volcano, and have had to learn how to handle diversity among the experts and the need for adequate public and policy-maker understanding of that diversity, to guide sound decision-making.

    At first, with the example of a mutually discrediting public scientific quarrel in mind from the 1976 – 77 crisis in neighbouring Guadeloupe, there was an undue emphasis on the “consensus” of the “expert scientists” and the advanced state of the art. But, thankfully, the VDAP team from the Cascades Volcano Observatory [who watch Mt St Helens] broke the facade of “consensus,”and allowed enough dissent to emerge to at least warn the public. Unfortunately, diversity among the scientists, policy-makers and public continued to be suppressed until after a series of nasty surprises and disastrous events culminated in up to dozens of deaths. Then, since about the end of 1997, an expert calibration and range-of-calibrated-opinion based estimation method has been put in place under Dr Willy Aspinall. And even now, we struggle with the problem of prudent action in light of the possible range of expert opinions on facts, explanations and projected trends: optimistic, moderate, pessimistic.

    The bottomline is, that many of us here in Montserrat have learned the hard way that robust decision-making captures and makes advantageous use of diversity and different scenarios or views, instead of manufacturing a group-think style pseudo-consensus through manipulative censorship-oriented polarisation-promotion techniques among experts, policy makers, technical practitioners and the public. [BTW, this is the same problem that is happening with the climate change debate. Of course, it is exactly what is happening with the current state of science and science education on issues related to the inference to design when it potentially cuts across the agenda of the evolutionary materialists. That dangerous parallel is what Dave Scott is intuitively sensing and responding to when he regularly posts at UD on this off-topic point. For that matter the same issue comes up in the study and application of work group techniques, which brings us full circle to the tricks and traps of the wily curriculum or “change” facilitator.]

    [. . . ]

  292. 3] Making up our own minds on origins, having escaped the materialists’ shadow shows

    In using the term “shadow shows” I am of course again alluding to Plato’s Socrates and the parable of the cave, from about 400 BC: the powerful are often tempted to enmesh the public in chains of mental slavery, and “educate” or “inform” us through manipulative shadow-shows that use images and stories that seem plausible only because we have not escaped “de system . . . de system,” which far too often — as Mutabaruka went on to sing — “. . . is a fraud.”

    In short, the worldviews diversity and dissent management challenge we now face with science and science education is nothing new; it goes back to the dawn of the West’s intellectual culture. (At least we have “progressed” beyond forcing dissenters to drink hemlock. But, unjustified career-busting and reputation tarnishing ill-founded ad hominem attacks are not at all harmless. For, “life and death lie in the power of the tongue . . .”)

    The solution lies in large part in the citation from Aristotle’s The Rhetoric, Bk 1 Ch 2, that was previously made:

    Of the modes of persuasion furnished by the spoken word there are three kinds. The first kind depends on the personal character of the speaker [ethos]; the second on putting the audience into a certain frame of mind [pathos]; the third on the proof, or apparent proof, provided by the words of the speech itself [logos]. Persuasion is achieved by the speaker’s personal character when the speech is so spoken as to make us think him credible . . . Secondly, persuasion may come through the hearers, when the speech stirs their emotions. Our judgements when we are pleased and friendly are not the same as when we are pained and hostile . . . Thirdly, persuasion is effected through the speech itself when we have proved a truth or an apparent truth by means of the persuasive arguments suitable to the case in question . . .

    In short, [a] no appeal to our emotions is better than the accuracy of the underlying perceptions and value judgements that drive those emotions. [b] No authority is better than his or her facts, assumptions and reasoning. [c] Only when the claimed facts are so and materially represent the truth [“a half-truth is a whole lie”], then are joined to good reasoning in light of premises that do not unnecessarily beg questions, do we have a trustworthy conclusion. And, by the time students are being exposed to science education, they should be being equipped with the tools and contexts to think soberly and critically.

    Otherwise the curriculum in question is a fraud, deceptive, manipulative indoctrination wearing the false colours of education. This is plainly happening to origins science education when there is a refusal to expose students to a critical analysis of the strengths and limitations, achievements and gaps in the relevant theories and bodies of knowledge. The further fact that known exploded — thus, deceptive — icons of evolution have too often continued to be used even in the very recent past (and, sadly, currently) to give the false impression of a far more factually well warranted theory than can be sustained in the face of serious informed critical analysis, simply clinches over the nails in the coffin of contemporary education on origins.

    As to the issue of defining science, similarly, without a proper exposure to the full range of relevant facts and issues studied under the history and philosophy of science, the resulting question-begging definition will predictably be just as misleadingly fraudulent.

    In particular, the very prevalence of statistical techniques in experimental, clinical, field and general observational studies is proof enough that science routinely has to use and trust reasonably reliable (though obviously not fool-proof) techniques to discriminate chance, natural regularities and agency in empirical results. It is only when those and related techniques based on the same underlying first principles are extended in ways that on the evidence provide challenges to the evolutionary materialist story on origins, that “methodological naturalism” is trotted out to try to cut off free inquiry.

    Such selective hyperskepticism and inconsistency, backed up by intimidation and censorship tactics as the movie Expelled will document for the public at large, underscore that there is something seriously rotten in the state of current science.

    This brings us to the issue of . . .

    4] Fixing the rot:

    So, we have to insist that the shadow-shows be stopped and that the lights be turned on:

    a –> We must insist that any “definiton” of science be based on the full range of relevant historical, philosophical and methodological facts, factors and issues. In particular, loaded language such as “Science is a human activity of systematically seeking natural explanations for what we observe in the world around us . . . “ must be corrected. (If intelligent causes and their empirical traces — notice, not “supernatural causes” — will not fit into a “definition” of science in relevant contexts, then the “definition” is question-begging, misleading and censoring.)

    b –> A superior, non-question-begging definition is not hard to find, e.g. consult high quality dictionary definitions developed before the evolutionary materialist ideologues were strong enough to impose censorship on the dictionaries etc:

    science: a branch of knowledge conducted on objective principles involving the systematized observation of and experiment with phenomena, esp. concerned with the material and functions of the physical universe. [Concise Oxford, 1990]

    scientific method: principles and procedures for the systematic pursuit of knowledge [“the body of truth, information and principles acquired by mankind”] involving the recognition and formulation of a problem, the collection of data through observation and experiment, and the formulation and testing of hypotheses. [Webster’s 7th Collegiate, 1965]

    c –> Next, make sure you understand the difference between operational, day to day science and origins science. The former deals with current observables and repeatable situations; the latter seeks to plausibly reconstruct the unique, unrepeatable, often irrecoverable past. The credibility of the one should not be simply cast over the other, and indeed that is an overlooked issue in the 2007 redefinition: “Scientific explanations must be testable and repeatable . . .” immediately entails that studies of the purported remote past are only conventionally “scientific,” as the past is unique and simply not repeatable. Scientifically informed abductive explanatory models of the past may well help more or less explain what we observe in the present that we believe tells us something about the earth’s past, life’s origins and diversity, and our own origins as humans, as well as the origins of the cosmos, but that is not at all the same as a direct, credible record of and report on the actual past.

    d –> Thus, we should clarify the degree of diversity and uncertainties that attend to the relevant theories, models and schools of thought on origins, in light of the full range of causal factors and their empirically detectable traces: chance, natural regularity, intelligence. (Intelligent Design, of course, is the emerging science that systematically studies empirical signs of intelligence, especially in the context of the scientifically informed study of the past.)

    e –> Indeed, what is happening can be profitably looked at through Kuhn’s concept of two states of science praxis: [1] normal science, [2] science in crisis; modified through Lakatos’ insights. In the former condition, once a paradigm has emerged through initial breakthroughs a dominant school emerges and articulates its views, solving puzzles happily within a common frame of reference. But all along, some puzzles resist solution. And, if they are on central issues, after a time it is no longer sensible to simply fob them off with promissory notes: a crisis is emerging, often marked by the rise of minor paradigms and schools of thought which adhere to divergent views on what the science is about, and maybe indeed what science is about in general. That is, suddenly, the worldview-tinged core is under challenge, not just the belt of theories and models. Perhaps the dominant paradigm can solve the problem, maybe one of the new paradigms will, maybe the crisis will be prolonged for generations [as happened with Economics across much of C20]. But, one thing is sure, as Feyerabend has aptly summarised: across time there has been no simple stable, easily summarised, one size fits all scientific method. Other major philosophers of science have also pointed out that there are no generally agreed criteria that allow simple black/white demarcation of science and non-science.

    f –> So, the game of definitional chopping we have seen above is ill-informed and manipulative. Equally, the refusal to objectively and openly address the strengths and limitations of various explanatory models on origins points to ideologically loaded indoctrination, not education. And, refusal — on pain of career busting — to allow serious consideration of the only known causal explanatory factor — intelligence — that can currently explain the observed FSCI on OOL, OO biodiversity and origin of the organised complexity of the cosmos reflects worldview prejudice and censorship, not soundness in the science institutions. [And observe, again, what happens whenever evo mat advocates have an opportunity to address the actual substantial issue of accounting for OOL, body plan level biodiverity etc relative to chance + necessity only: exaggerated extrapolations from microevolution, distractors and dodging. That should warn us on what is really going on at this stage . . .]

    In short, it is time for reformation.

    I believe a sober addressing of the points just raised and the substantial matters highlighted in 187 – 88 and again in 263 would be a good place to begin.]

    GEM of TKI

  293. Darwinism is mostly philosophical arguments masquerading as science, clearly saddled to anti-religious belief. This is not speculation; it is found in the words of the most prominent advocates of the theory, from Darwin himself to Huxley to Gould to Dawkins. Why pretend that Darwinism does not reflect a certain outlook on life when its own prophets say that it does? And why pretend that it is more scientific than ID when virtually none of its postulates can be empirically observed? The Darwinists want to tell us what “science” is. This is philosophy, not science.

  294. So how do you objectively test the premise that chimps and humans share a common ancestor?

    Can you point out the scientific data which demonstrates the genetic differences observed can account for the physiological and anatomical differences?

    I ask because it appears that the debated aspects of biology do not reflect your accepted definition of science.

    Or do you think that imagination is a proper substitute for scientific data?

    BTW Leo, anti-biotic resistance has nothing to do with what is being debated.

    Even YECs accept variation- and that is all anti-biotic resistance is.

  295. One more question-

    How can we tell if the designer is supernatural?

    If we follow the data and it leads us to the supernatural it would be too late to go back and then disallow the investigation.

  296. In what appears to be a post that has appeared belatedly, Irreducible Complacency writes,

    Jack you make it sound so innocuous. If you are not allowed to teach the Truth, then what difference does it make what you teach?

    And how do you know what the Truth is, and is there a difference between religious Truth and scientific truth?

    The Kansas science standards summarize the consensus fundamentals of the worldwide scientific community. What other criteria should we use in deciding what we should teach in public school education? We can’t teach religious Truth because we, the world as a whole, have no way to determine which religious Truth, if any, is True.

    Science is truth with a little “t”. It is not the job of public education to teach what metaphysical or religious belief one ought to have about the relationship between science and metaphysics. Theoretically a science teacher could introduce students to some of the major metaphysical positions, without offering any of them as correct, but few high school teachers have the time, training, or inclination, to do that.

  297. Mr Stotch

    Do pardon me; my old, dyslexic eyes will miss more typos than I care to think.

    GEM of TKI

  298. Participants:

    Lurker X has called back, with some additional remarks on hybridisation proto-chimp X proto-man.

    I again excerpt for the pleasure and comment of the more biologically inclined:

    _______________

    . . . The particular chromosomal fusion that had to have happened if humans are apes is commonly called a ‘tandem fusion.’ I refer ‘telomeric fusion,’ as this is more descriptive (*). [Figure 3 on this page ( http://www.grisda.org/origins/11067.htm ) is the best graphic illustration of a 'tandem fusion' (i.e. 'telomeric fusion') that I can find this morning.]

    (*) From this page ( http://www.jodkowski.pl/wk/WJVeith.html ), you can see that the term ‘tandem fusion’ has an ambiguous meaning: “A tandem fusion on the other hand is a fusion of two chromosomes in which one end of a chromosome fuses with the end or the centromere of another chromosome.”

    . . . .

    What is one of the *key* components of “Darwinsim?” Is it not precisely “differential reproductive success?” Is it not precisely that lineages which produce more offspring relative to related lineages which produce fewer will replace the “less fertile” lineage(s)? Or, from the converse point of view, that the “less fertile” lineage(s) will die out, sooner or later?

    Is it not *precisely* that (according to “Darwinism”) “differential reproductive success” explains the history and development of life on earth?

    . . . .

    The hypothetical-parent-species has a “2n=48″ karyotype. The hypothetical first individual having the proposed chromosomal fusion has a “2n=47″ karyotype. The proto-human species (which doesn’t yet exist in the scenario) has a “2n=46″ karyotype.

    The only way to derive the karyotype of the proto-human species (i.e. the standard modern-human karyotype) is via the crossing of individuals heterozygous for the proposed fusion. The hypothetical first individual heterozygous for the proposed fusion (having the “2n=47″ karyotype) can mate only with individuals having the “2n=48″ karyotype … the viable offspring of such unions, if there are any possible, will have either the “2n=47″ karyotype of the “2n=48″ karyotype.

    So, IF the individuals heterozygous for this proposed chromosomal fusion are not totally infertile, it is not impossible to derive the modern-human karyotype. HOWEVER, there is that problem of the reduced fertility (“fitness”) and the problem for “Darwinism” in that it *requires* purely naturalistic (non-intelligent agent) explanations. IF the heterozygous individuals are not wholly infertile, intelligent agents making informed decisions *might* be able to work around the fertility problems: “Darwinism” doesn’t allow for this [though, via question-begging and special-pleading, the “Darwinists” allow themselves in the here-and-now to be the intelligent agents making informed decisions in this hypothetical pre-historic past. . . .

    And this is the other horn of the dilemma which the proposed chromosomal fusion poses for “Darwinism.”

    IF, in our scenario (i.e. just-so story-telling) we do ever get individuals homozygous for the proposed chromosomal fusion (i.e. individuals having the “2n=46″ karyotype), then there is nothing to prevent them breeding with individuals having *any* of the three karyotypes which now exist within the population of our hypothetical species. That is, the “proto-human species” and the “hypothetical-parent-species” and the “hybrids” are all a *single* species.

    AND, if they are not a *single* species, then we can never get the “2n=46″ karyotype in the first place.

    BUT, if they are a single species, and if the “hybrid” is not so infertile as to prevent us getting the “2n=46″ karyotype in the first place, then we cannot get *rid* of the “2n=47″ and “2n=48″ karyotypes … unless we’re “Darwinists,” because then we’re allowed to beg-the-question and special-plead again, even though we’re now assuming/insisting the very opposite of previously.

    ________________

    Well, biologists, what say ye to this?

    GEM of TKI

  299. After reading the latest round of posts from Jack, Leo, and larrynormanfan, one thing is clear. They have not yet taken the trouble to investigate the ID methodology. Indeed, they do not even know what a design inference is. Consequently, they continue to comment on what ID is not rather than what it is. Is it too much to ask that they investigate the matter prior to commenting on it? Or, is it the case that they do understand the subject and choose to misrepresent it? It would certainly help matters if they were at least on speaking terms with Dembski’s explanatory filter. That way they might be able to enter into a rational discussion with us. We have taken the trouble to understand their theory, but they obviously don’t have a clue about ours. This is dialogue?

    Further, what are we to make of their dogged defense of modern evolutionary theory? In fact, Darwin’s theory of evolution has not provided a single benefit for mankind in 150 years. It is irrelevant to cosmology, unnecessary for biology, and useless in medicine. Whatever advances that have been made in the study of antibiotic therapy find their origins in molecular biology and pharmacology, not Darwinism. Still, these ideologues can wait to assassinate ID in its adolescence, while clinging to Darwinism in its old age. It’s time for these people to grow up and stop militating against progress. A 15 year old promise is far better than a 150 year old failure.

  300. Mr Krebs:

    Saying “consensus” over and over and over “don’t make it so.”

    Kindly therefore, address, in context, the issues of normal vs crisis science, the worldview-tinged core and belt of theories as well as the emergence of competing paradigms when serious anomalies as listed starting with OOL and the Cambrian revolution, stick around for decade after decade.

    Last but not least, if the aim of science is to increasingly discover the truth — “that which says of what is, that it is; and of what is not, that it is not” [Aristotle] — about the cosmos, its contents and unfolding from its beginnings [if it had one] then it cannot properly censor out as “unscientific” a whole known class of cause ahead of inspecting the actual data, i.e agent cause in those situations where evidence pointing to agency may be inconvenient to the evolutionary materialist worldview.

    Again, kindly provide repeatable, currently observable empirical evidence that shows within our capacity to make observation, a capacity to spontaneously (i.e from chance + necessity only) create functionally specified complex information requiring storage capacity on the order of that provided by 300 – 500,000 4-state elements. [That is, in excess of 9*10^180,000 possible configurations. Intelligent agents do that all the time.]

    For details, cf above and linked, including the always linked.

    GEM of TKI

  301. Stephen says,

    After reading the latest round of posts from Jack, Leo, and larrynormanfan, one thing is clear. They have not yet taken the trouble to investigate the ID methodology. Indeed, they do not even know what a design inference is. Consequently, they continue to comment on what ID is not rather than what it is. Is it too much to ask that they investigate the matter prior to commenting on it? Or, is it the case that they do understand the subject and choose to misrepresent it? It would certainly help matters if they were at least on speaking terms with Dembski’s explanatory filter. That way they might be able to enter into a rational discussion with us. We have taken the trouble to understand their theory, but they obviously don’t have a clue about ours. This is dialogue?

    I am quite familiar with the things about ID that you mention, but those are not things I have been discussing. I have been discussing the Kansas science standards and why both the description of science and the evolutionary science contained therein are appropriate for public school education.

    And understanding something and agreeing with someone (for instance, you) about it are two different things. The only thing I think I have said about ID is that it is mostly philosophical arguments, and I think that is an informed opinion, not an uninformed one.

  302. Science is truth with a little “t”.-Jack Krebs

    Semantics aside the truth is that the design exists in the natural world and can be studied.

    And experience tells us that it matters a great deal to any investigation whether or not that which is being investigated arose via agency or nature, operating freely.

    Have the science teachers present the scientific data- BIAS FREE.

    It is obvious why teachers and scientists have to keep reminding themselves what they are discussing in biology was not designed, rather it evolved.

    Stop doing that and ID wins.

    As if molecules just happen to be able to build other molecules to build more molecules to sustain this thing we call a living organism.

    The kids these days are too computer savy to buy that nonsense.

  303. Mr. focus:

    1) How does the competing paradigm address OOL and the Cambrian revolution?

    When did the implementation of a design occur? What did it involve: poofing into existence of new organisms, tweaking of existing genomes, teleportation from Alpha Centauri, something else? I understand ID has only been around for somewhere between 15 and 2,500 years (though certainly no more than 6,000), so I wouldn’t necessarily expect the question to be definitively answered, but what is the empirical evidence for each of the possibilities?

    2) Oh and

    kindly provide repeatable, currently observable empirical evidence that shows within our capacity to make observation, a capacity

    in anything other than a human or other earth-inhabiting animal

    to create functionally specified complex information requiring storage capacity on the order of that provided by 300 – 500,000 4-state elements. [That is, in excess of 9*10^180,000 possible configurations. Intelligent agents do that all the time.]

    3) Or how about repeatable, currently observable empirical evidence that shows within our capacity to make observation, the existence of an intelligent agent other than a human or other earth-inhabiting animal?

    4) What does the category of intelligent agent include? Humans, chimps, bower birds, leprechauns (in honor of the season)?

  304. —–Leo: “A wise person once told me “Seek first to understand, then to be understood.” Words that I might suggest you take to heart.”

    As it turns out, it is I that am trying to get you to understand. First, Please learn the methodology involved in a design inference. I don’t think that is too much to ask.

    Second, with regard to the standards of science, I have already pointed out that they are arbitrarily established. More to the point, if you subjected your Darwinistic world view to the same standards as ID, it would not qualify as science either. They are parallel explanations or alternative inferences to the best explanation. If ID can’t do “abductions” in the name of science, then neither can Darwinists.

    Those are the two points that I wish you would address.

  305. —–Jack Krebs: “And understanding something and agreeing with someone (for instance, you) about it are two different things. The only thing I think I have said about ID is that it is mostly philosophical arguments, and I think that is an informed opinion, not an uninformed one.”

    I assumed that you did not understand the ID methodology since you made references to the the “supernatural.” Since an ID inference doesn’t do that, it seems fair to assume that you didn’t understand the process. To begin with an empirical observation and to follow with an analysis of physical laws and chance happenings is hardly an exercise in philosopy. Why would you think that it is.

    There is, of course, a larger problem. If the ID methodology is philosophy, then Darwinian methodology is philsophy as well. Both begin with an observation and end with an inference to the best explanation. You can’t have it both ways. Either ID is science or Darwinian evolution is not. They are alternative explanations derived from the same empirical source. If you believe otherwise, you are not being logical.

  306. At 321, Stephen writes,

    Second, with regard to the standards of science, I have already pointed out that they are arbitrarily established. More to the point, if you subjected your Darwinistic world view to the same standards as ID, it would not qualify as science either. They are parallel explanations or alternative inferences to the best explanation. If ID can’t do “abductions” in the name of science, then neither can Darwinists.

    This view sounds quite post-modernish to me, and I don’t agree. The standards of science are not arbitrary – they have been established from the successes of 500 or so years of people doing science. If someone wants to come along and show how changing those standards might be more successful, then they are welcome to try that. But just saying that the established standards of science should change because they are “arbitrary” is not a convincing point.

    Similarly, it is true that scientific explanations about the past and ID explanations about the past are alternative “inferences to the best explanation,” but again, it is a post-modern argument that I don’t accept to say that somehow that makes the two explanations equivalent. We accept in science (just as we do in law) that from the evidence we can decide which explanations are better, and in fact we can decide which explanations are poor, or even wrong. It can’t possibly be useful to hold the view that all explanations are equivalently true just because each is an inference.

    Yes, both explanations based on evolutionary science and explanations based on ID are abductions, but the vast majority of people conversant with the evidence believe that evolutionary science is the best explanation, and that so far ID is not. All these philosophy of science issues are somewhat irrelevant in comparison to the practical fact that ID has very little specificity (what was designed, when, how, etc.), no methodologies for scientists to use to test any ID hypotheses (and very few ID hypotheses), and a number of philosophical arguments that practicing scientists find flawed and unconvincing.

    At 323, Stephen writes,

    I assumed that you did not understand the ID methodology since you made references to the the “supernatural.” Since an ID inference doesn’t do that, it seems fair to assume that you didn’t understand the process.

    I have lots of grassroots experience with ID advocates, and I can assure you that a desire to include supernatural explanations in science is a theme that runs throughout the arguments of those advocates.

    In Kansas, John Calvert’s main argument was that “seeking natural explanations” was an approach that led to atheism and barred the door from a belief in theism, and that conversely ID was the approach that led to theism. That is most assuredly an argument that ID is associated with supernatural causation.

    So despite the formal claim that ID is not about supernatural causation, I think there is a lot of evidence that this is not true in respect to many ID advocates and to the ID movement as a whole in respect to various situations, such as the Kansas science standards, around the nation.

    At Stephen finishes,

    There is, of course, a larger problem. If the ID methodology is philosophy, then Darwinian methodology is philsophy as well. Both begin with an observation and end with an inference to the best explanation. You can’t have it both ways. Either ID is science or Darwinian evolution is not. They are alternative explanations derived from the same empirical source. If you believe otherwise, you are not being logical.

    I’ve already discussed this, but here I’ll reiterate: just because ID is an alternative explanation doesn’t make it right. There are many explanations that at one time were offered as scientific and which were, sooner or later, judged to be quite wrong. Unless you are a committed post-modernist, you have to believe that human beings, working together with processes which have proven themselves to be successful many times over the centuries, can separate the wheat from the chaff.

    ID can’t make itself science, much less solid well-accepted science, by merely making philosophical arguments.

    I have a saying on my board at school that I point out to my students at the start of every year, from Stephen Covey: “You can’t talk yourself out of something you behaved yourself into.” The converse applies here: “ID needs to behave itself into being science – it can’t just talk it’s way in.”

  307. —-Leo: “To repeat, I have made no comments one way or the other regarding my feelings on evolutionary theory and therefore I must ask you exactly what Darwinistic-expialedocious world view are you referring to and how you determined, based on a disagreement about The Scientific Method, that I hold it?”

    Well, it’s a little thing called connecting the dots. Let’s review some of your positions: [A] Defending the Kansas standards for science, [B] associating the design inference with the “supernatural,” [C] always siding with the Darwinist in a debate, [D] claiming that a design inference begins with the presupposition of design, [E] Associating Darwinism with medical progress, [F] Defending methodological naturalism, the ID killer, and [G] Suggesting that ID should debate less and accomplish more. So, I conclude that you must not be an ID supporter. That leaves two other possibilities. You must embrace either Darwinism or Theistic Evolution. I am putting my money on Darwinism, but I am leaving open TE as a possibility

  308. Hold the presses! ID is about “supernatural causation”! What next? The world is round?

    Just because Darwinism is the prevelant worldwiew doesn’t make it right; viz. Ptolemy. Are we especially dense today? Sorry–must be the stimulant.

    Behe is as “right” as any of the tendentious drivel found in “Nature.” The fact that we cannot see this is due to identity, not “science.”

  309. —–Jack Krebs: “Similarly, it is true that scientific explanations about the past and ID explanations about the past are alternative “inferences to the best explanation,” but again, it is a post-modern argument that I don’t accept to say that somehow that makes the two explanations equivalent. We accept in science (just as we do in law) that from the evidence we can decide which explanations are better, and in fact we can decide which explanations are poor, or even wrong. It can’t possibly be useful to hold the view that all explanations are equivalently true just because each is an inference.”

    We were not discussing the question of who is right and who is wrong. That is a separate question that I would be happy to take up later. The question on the table is who is doing science and who is doing philosophy. To settle the latter question, we must analyze the methods being used. Both ID and Darwinism evaluate evidence empirically and make inferences to the best explanation. They examine the same evidence and arrive at parallel answers to the same questions. For example, Darwinism looks at a DNA molecule and explains it in terms of law and chance, ID explains it in terms of design. Indeed, ID is a more complete analysis because it considers law, chance, and design, in that order, by the way.

    Further, ID methodology is much more precise and well-defined than Darwinism, which means that it will not have the luxury of covering up its failures by establishing new paradigms each time the evidence refutes the old ones. ID is too precise to conveniently morph into anything else; it will never devise its own version of “punctuated equilibrium.” That is a privilege that is open only to your side. The broader point is that either both are science or both are philosophy. You can’t have it both ways by saying that Darwinism is science and ID is not.

    —–“This view sounds quite post-modernish to me, and I don’t agree. The standards of science are not arbitrary – they have been established from the successes of 500 or so years of people doing science.”

    Well, postmodernism does tend to make everything relative, and I certainly don’t believe in relativism. Some things never change, other things are always changing. It takes wisdom to know the difference. The goals of science will likely not change much, but the ways of getting there will always be changing. That is not postmodernism; that is realism. Intelligent design is suggesting a new way to get to the same place, which is, the truth. That raises the relevant question: Which to you value more, truth or convention?
    It is ironic that you would say that “there are many explanations that at one time were offered as scientific and which were, sooner or later, judged to be quite wrong.” That is exactly what is happening right now. Now that we have discovered coded information, we now know that the old explanation for a DNA molecule is incomplete. I should probably rephrase my comment: The CURRENT standards of science have been arbitrarily established and converted into rules. Why continue to embrace a failed paradigm? Why not make room for progress?

    You suggest that most scientists “find ID unconvincing.” Many scientists, not all, find ID unconvincing because they have a vested interest in a paradigm that they have become comfortable with and built a career around. That is what is at stake and that is what the Kansas standards are all about—maintaining a failed paradigm.

  310. —–Leo: “A through D, F, and G are not incompatible with an investigation into ID. Sure, they presuppose that a natural ID explanation can be found. So what? That presupposition has served scientific discovery for centuries. You yourself said that ID doesn’t need to fall back on miraculous events to make it’s case. So, you should hold no truck with The Scientific Method. Further, E was stated in the context of what I feel ID needs to do to become relevant in everyday life. Context is everything and you either have missed, or ignored, that context.”

    Nice try, but all the points you mentioned ruled out ID. If you understood the method, you would know that. You still do not understand what a design inference is.

    On the contrary, I am six for six. You are anti-ID on every count. All that remains is for you to disclose whether you embrace Darwinism or TE. Will that day ever come?

  311. jerry (304): “…what did happen to Dr. Sternberg”?

    Excerpt:

    “Smithsonian Scientist Was Demoted for Views Critical of Darwinian Evolution”

    “The House Government Reform Subcommittee on Criminal Justice, Drug Policy, and Human Resources has issued its official report on the investigation into the harassment and discrimination against biologist Dr. Richard Sternberg. … The congressional report bluntly states: The staff investigation has uncovered compelling evidence that Dr. Sternberg’s civil and constitutional rights were violated by Smithsonian officials. …”

    More can be read here:
    Smithsonian Scientist Was Demoted for Views Critical of Darwinian Evolution

  312. ericB,

    I know what essentially happened to Sternberg. But several here have passed it off as nothing happened because he was not fired. All I was doing was pointing out the hypocrisy of such remarks.

  313. Jack Krebs (302): “One is free to espouse controversial ideas, but one will undoubtedly run into resistance when one does: that should be expected. I have friends right here at the University of Kansas that are on the minority side of some issues (the dinosaur-bird relationship and the effect of gamma radiation from nearby stars on mass extinctions). It is part of their life as scientists to get criticism, some of which can become personal and some of which gets entangled with larger university political issues. This is just the way life goes.”

    Your comments and opinion lose credibility when you attempt to paper over the issue by lumping vague “resistance” and “criticism” which can even become “personal” (horrors) under the same umbrella as

    violation of civil and constitutional rights
    spying
    disinformation and the concerted effort to spread false information to ruin someone’s reputation
    demotion or loss of positions in some cases
    effective termination of one’s ability to conduct research

    Can you name even one of your friends at the University of Kansas who has faced anything like what Darwin skeptics have faced? Please stun us with the most gruesome example you have.

    “Criticism” is not a violation of intellectual freedom. It is a participation in the free exchange of ideas.

    Darwin skeptics face violation of their intellectual freedom, including the trashing of their careers and/or losing the ability to conduct research. Attempts to destroy the individual’s ability to speak is not in any way in the same category as “criticism”.

    The more generous interpretation is that you can’t see the difference. If you can but choose to intentionally obuscate anyway, so much the worse.

    Whatever happened to the high value that was once placed with this ideal?

    “I disapprove of what you say, but I will defend to the death your right to say it.”
    – Evelyn Beatrice Hall (a.k.a. S[tephen] G. Tallentyre) paraphrasing Voltaire’s words in his Essay on Tolerance: “Think for yourselves and let others enjoy the privilege to do so too.”

  314. I wasn’t “lumping” the kind of resistance I was talking about with things you are mentioning. You are probably thinking about the cases in Expelled, but those were not on my mind when I wrote what I wrote. I was just talking about the kind of resistance that any scientists meets when they want to champion a minority view, such as the cases I mentioned. I don’t know much about the cases in Expelled (having, of course, not seen it), and I imagine there are different views about what happened in those cases. But that is not something I know much about nor is it what I was referring to.

  315. To Jack Krebs, I welcome and accept your clarification that you were not intending to lump these dissimilar types of situations together, and that you were not thinking of the cases I alluded to.

    That said, if you “don’t know much about the cases in Expelled (having, of course, not seen it) … that is not something I know much about”, many of the cases of injustice and intolerance that will be in Expelled were first in the news and in other sources.

    I would encourage you to learn more about them, so that you are more informed about the situation before you make statements about the “freedom” of Darwin skeptics or ID advocates to advance their views. This issue is not just a scientific issue, and it is opposed in a manner quite unlike other minority scientific views.

    You might want to start with the link I gave above to the congressional investigation into what was done to Dr. Sternberg.

    For more instances, another source is The Politically Incorrect Guide to Darwinism and Intelligent Design by Jonathan Wells, especially but not only chapter 16 “American Lysenkoism”.

    ARN description.

    Another example that can be read online would be the breaches of academic freedom and denials of due process sent against Professor Dean Kenyon.

    A Scopes Trial in Reverse

    Yet another is the denial of tenure for Guillermo Gonzalez. He had an exemplary record of publication and instruction, and did not even teach his ID perspective in class. Yet the mere fact that he was known to hold such views was sufficient, as the paper/email trail shows.
    Design Was the Issue After All: ISU’s official explanation in Gonzalez case exposed as a sham (Updated)

  316. ericB @ 330 –

    It’s perhaps worth making a couple of clarifications:
    1. The report wasn’t written by the sub-committee, it was a staff report prepared for one of the members of the committee.
    2. The “demotion” was not from one job to another. Sternberg was a guest researcher, and his title changed, but I don’t know if that changed any of the privileges he is entitled to.

  317. Participants (and onlookers):

    A few mopping up remarks on points are plainly in order:

    1] Abduction and science

    The rhetorical dodge to label abduction as “post modernism” and dismiss it without further consideration fails, and further illustrates a want of understanding the nature of scientific reasoning and methods, thus also — again — want of credible capacity to make or justify a definition of “science.”

    For in fact, as scientist-philosopher Charles Sanders Peirce correctly pointed out about 100 years ago, ALL scientific thought that rises to the level of explanatory modelling or theorising or hypothesising and empirically testing embeds abductive inference. For the point of abduction is that we have the following relationship between explanation [E] and empirical evidence [F]: E => F

    This means that the facts, so long as they are consistent with the explanatory model support it, but — on pain of the fallacy known as affirming the consequent — cannot prove it. But, given the higher epistemic status of factual observation, if such a model fails to account for relevant facts on reasonably sufficient trial, we have good reason to seek or switch to an alternative explanation that covers the facts better.

    More broadly, scientific explanations work into explaining currently known facts, making and confirming predictions and bridging to other fields in science:

    E => {A: OF1, OF2, . . . OFj} + {B: OP1, OP2, . . . OPk} + {C: P1, P2 . . . Pm} + (D: B1, B2, . . . Bn}

    That is, a scientific explanation [a] ties — or should tie — together coherently the existing body of observed credible facts, [b] has a track record of observed correct predictions (or also retrodictions, i.e predictions on not yet observed but subsequently seen “facts” of the past] sufficient to allow us to trust it as reasonably reliable, [c] makes onward predictions that are yet to be confirmed [and can potentially disconfirm, if they have sufficient weight or if they build up to the state of a crisis], [d] in general also bridges to other domains of science, such that their facts and explanations etc can be available as further tests. For instance, once DNA turns out to be a code-bearing molecule, the resources of information theory and associated thermodynamics issues obtain, much to the detriment of OOL models and currently challenging macro-evolutionary scenarios such as the Cambrian life revolution. [BTW, this last is actually a longstanding anomaly for Darwinism, as Darwin knew about it and issued promissory notes that, 150 years later, are now clearly “bouncing.”]

    The issue on operational vs origins science is not on whether they are abductive or not, but on REPEATABILITY. The past is repeatable, so we can only, strictly, make a scientifically informed, abductive historical explanation.

    [NB: It can be argued that in general worldviews are abductive systems, too. That is, worldviews seek to explain reality relative to core first plausibles, and are subject to comparative difficulties across factual adequacy, coherence and explanatory power. Since worldview elements are inextricably embedded in the cores of scientific research programmes, in multiple ways (including affecting our observations . . .) the abductiveness of scientific explanations is not at all surprising.]

    2] Cogently addressing the nature of the inference to design vs strawman attacks

    I find it astonishing but telling, that — some 200 posts after 123 -4 — Mr Krebs has yet to ever actually acknowledge the basic definition of the design inference as a scientific project:

    Materialistic Kansas standards, circa 2007: Science is a human activity of systematically seeking natural explanations for what we observe in the world around us. . . . As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes.

    My response in 123, excerpted yet again — it now plainly stands by default:

    a –> Since there is a clear context in which “natural” in effect in context means evolutionary materialist [i.e. “the best materialistic explanation of the cosmos from hydrogen to humans”], the second excerpt clearly and improperly begs a lot of big questions.

    b –> It is indoctrination, not education – and I say that as one who has taught in science and technology at high school and college level and has had a hand in curriculum and programme development . . . .

    c –> Further to this, I observe that statistics is a major tool used in observational and experimental studies in science, and that in hypothesis testing, it in fact articulates several tools that are precisely useful for distinguishing [I] chance, [II] law-like natural regularities and [III] design/intent/agent action as possible causal factors, in the context of situationally plausible alternative hypotheses.

    d –> Indeed, these tools are commonly used in the design of experiments, e.g. the use of control cases and various treatments, leading to ANOVA to analyse the impact of various factors to appropriate levels of confidence. So it is simply falsehood backed up by slanderous allusion, to say that “science currently has no tools to test explanations using non-natural (such as supernatural) causes.”

    e –> For: [a] non-natural has a very relevant meaning, i.e “[intentional, intelligent] agent,” and [b] all of this is in the unacknowledged context of the too often INTENTIONAL misrepresentation of Intelligent Design as being about claimed scientific inference to the supernatural, where [c] in fact ID and a lot of pure and applied science works in a context where agent-cause is a relevant consideration and methods have been developed for addressing agent action – which is in this context a very relevant meaning of “non-natural.”

    f –> I say “too often intentional,” as: if you and others of your ilk don’t know the basic context of the design inference across chance, law-like regularity tracing to mechanical necessity and design, that is because of willful refusal to do basic homework on the nature and context of design theory. Sorry if that sounds harsh, but it is time to call you and your ilk to basic intellectual duty.

    3] What the design inference is about . . .

    First, we observe that causal factors and forces cluster about [1] chance, [2] law-like regularities tracing to mechanical necessity, [3] agent action. The second is in effect not highly contingent: if we have heat, oxidiser and fuel a fire reliably bursts into being. Highly contingent situations reflect chance and/or agency, e.g. which face of a die is uppermost. Indeed, here is a simple example from section A my always linked that illustrates how the three may interact and are often in effect independent the one from the other:

    heavy objects tend to fall under the natural regularity we call gravity. If the object is a die, the face that ends up on the top from the set {1, 2, 3, 4, 5, 6} is for practical purposes a matter of chance. But, if the die is cast as part of a game, the results are as much a product of agency as of natural regularity and chance. Indeed, the agents in question are taking advantage of natural regularities and chance to achieve their purposes!

    But, it does not stop there:

    If one were so inclined, s/he could define a six-state code and use a digital string of dice to store or communicate a message by setting each die in turn to the required functional value for communicating the message. In principle, we could then develop information-processing and communication systems that use dice as the data-storage and transmission elements [say, using registers made from plastic troughs loaded with strings of dice set to particular values and "read" by scanning the pips]; rather like the underlying two-state [binary] digital code-strings used for this web page. So also, since 6^193 ~ 10^150, if a functional code-string using dice requires significantly more than 193 to 386 six-state elements [we can conveniently round this up to 200 - 400], it would be beyond the edge of chance as can be specified by the Dembski universal probability bound, UPB. [That is, the probabilistic resources of the observed universe would be most likely fruitlessly exhausted if a random-walk search starting from an arbitrary initial point in the configuration space were to be tasked to find an "island" of functionality. . . So, if we were to then see a code-bearing, functionally meaningful string of say 500 dice, it would be most reasonable to infer that this string was arranged by an agent, rather than to assume it came about because someone tossed a box of dice and got really lucky! (Actually, this count is rather conservative, because the specification of the code, algorithms and required executing machinery are further -- rather large -- increments of organised, purposeful complexity.)]

    In short, the combination of contingency, complexity beyond reasonably available probabilistic resources and specification – especially functional specification – combine to point reliably to agency as the dominant causal force in a situation. Indeed, onlookers, note why I can say “reliably”: observe how none of the evo mat advocates in the thread are able to come up with a counter-example on all cases within our observation. But, the very posted in this thread are examples of just how commonplace is the point that contingency + complexity + specification point to agency. In short, we have massive empirical warrant for the design inference through the explanatory filter. (Indeed, to infer to message not lucky noise the evo mat participants in this thread have intuitively made exactly the same design inference, consistently. They just don’t like it when that inference points against their favourite explanatory models tied to their preferred worldview of materialism.)

    Sadly, in too many cases, there is then a resort to not merely “resistance” and “criticism” but injustice. And, we should take very careful note indeed of those who try to make light of or dismiss or “justify” injustice!

    [ . . . ]

  318. 4] . . . despite the formal claim that ID is not about supernatural causation, I think there is a lot of evidence that this is not true in respect to many ID advocates and to the ID movement as a whole in respect to various situations, such as the Kansas science standards, around the nation

    REALLY!

    And I suppose that we could — and with massive documentation from leading darwinistas, starting with Mr Dawkins et al — object that materialists, despite formal denials use methodological naturalism as a back-door to smuggle in evolutionary materialism thence, philosophical/worldview level atheism. But in fact we need not go to a rebutting ad hominem [one of the few cases where the ad hominem is NOT fallacious].

    Instead we can point out that the whole design inference is an empirically anchored process that is in fact commonplace in day to day life and science. [Observe onlookers how not one of the evo mat advocates ever took up the hypothesis testing and ANOVA examples from experiment design.]
    The real objection, in short, is not to the method, but to the onward worldviews level debate where design inferences in certain contexts may make some people think that it is empirical support for their theistic worldviews. But, that is not its primary focus, nor is it an embedded question-begging assertion [unlike inserting “natural explanations” into the definition of science].

    For the chain of reasoning – again – is:

    –> We observe that causal factors cluster as chance, necessity agency – a commonplace that was immemorial in Plato’s day.

    –> We observe that contingency, then sufficient complexity and specification allow us to distinguish where each of the three is dominant, leading to a known reliable sign of agency. (One we in fact routinely rely on in science, general decision-making and day to day life.)

    –> We thus can credibly and reliably identify the FACT of agency

    –> Beyond that, the situation may in some cases help us identify onward the identity of relevant agents. But, not as reliably [as any competent detective can tell us]. Often too, the onward debate – on both sides — has departed from science proper to wider philosophical issues, though there is some overlap in the core of scientific research programmes. (For instance the idea that the necessary being underlying our observed contingent cosmos, is a quasi-infinite array of sub-universes with randomly scattered physics is an ad hoc, not factually based metaphysical speculation.)

    –> And from the beginning of the modern design movement in science, that basic distinction was EXPLICITLY made by Thaxton, Bradley and Olson. In short, to insist on such accusations in the teeth of longstanding easily accessible facts to the contrary is a massive and willful breach of a duty of case. (Indeed, if US Libel laws were in any sensible shape, it would long since have been grounds for a cluster of major libel suits.)

    For shame!

    6] Congregate, 318: How does the competing paradigm address OOL and the Cambrian revolution?

    First, it allows us, on known reliable principles and procedures, to infer the credible fact of design. That, in the present sad state of science and science education, is a big achievement.

    Second, it sets up the context for reverse-engineering the design and creating novel designs based on what we learn. [Indeed, it is not irrelevant to note how this question reveals how we have been robbed of a balanced view of the rise and history of modern science: Modern science as a sustained project began between about 1100 and 1700 as by and large Judaeo-Christian theists sought to reverse engineer the orderly plan of nature they believed God had made: thinking God's thoughts after him]

    In the first case, we actually had a proto-ID prediction in the 40′s by Von Neumann [if memory serves], that the cell would be in key aspects a self-replicating self-directing information system. Just so, once we further elucidate its architecture, we can move on to implementing systems that use the same design principles. In short, ID is neither a science stopper nor a science stopper. In fact, historically holding the design view of nature – including men like Newton [ever read his General Scholium to the Principia? Cf. App 4 my always linked . . .] was both a science and a technology starter.

    7] I understand ID has only been around for somewhere between 15 and 2,500 years (though certainly no more than 6,000)

    An unworthy resort to the “ID = Biblical, Young Earth Creationism” smear. Cho man, do betta dan dat!

    8] kindly provide repeatable, currently observable empirical evidence that shows within our capacity to make observation, a capacity in anything other than a human or other earth-inhabiting animal to create functionally specified complex information requiring storage capacity on the order of that provided by 300 – 500,000 4-state elements.
    I don’t need to.
    The point was, that we know that intelligent agents by direct observation, routinely produce FSCI beyond the Dembski-type bound. Not one counter example of being able to provide such within our observation relative to chance + necessity only has been proffered – for years and years, actually. Put that with the sort of microstate-macrostate considerations in my always linked appaendix A point 6. Doesn’t that tell you there is an empirical observation and an explanation that rests on the same principles that underpin the highly succsssful science of thermodynamics?
    Moreover, our existence shows us that the cosmos is consistent with the existence of intelligent agents and has actually produced such. So, inference to agents is not a leap into the dark beyond what we know is empirically possible. By sharpest contrast, your side in effect has been unable to provide basic empirical support for the contention that chance + necessity within the gamut ofr obsercvable reality can repeatably produce FSCI.
    In short we see advocates of an inferior explanation trying to turnaround the burden of proof. A burden that on the material issue, has long been met.

    9] how about repeatable, currently observable empirical evidence that shows within our capacity to make observation, the existence of an intelligent agent other than a human or other earth-inhabiting animal?

    Another dead-on arrival turnabout attempt. Kindly cf 8 just above.

    10] What does the category of intelligent agent include?
    Had you simply took time to go to the always linked, and the in-page link on Defining “Intelligence” youy would have seen:

    First, let us identify what intelligence is. This is fairly easy: for, we are familiar with it from the characteristic behaviour exhibited by certain known intelligent agents — ourselves. Specifically, as we know from experience and reflection, such agents take actions and devise and implement strategies that creatively address and solve problems they encounter; a functional pattern that does not depend at all on the identity of the particular agents. In short, intelligence is as intelligence does. So, if we see evident active, intentional, creative, innovative and adaptive [as opposed to merely fixed instinctual] problem-solving behaviour similar to that of known intelligent agents, we are justified in attaching the label: intelligence. [Note how this definition by functional description is not artificially confined to HUMAN intelligent agents: it would apply to computers, robots, the alleged alien residents of Area 51, Vulcans, Klingons or Kzinti, or demons or gods, or God.] But also, in so solving their problems, intelligent agents may leave behind empirically evident signs of their activity; and — as say archaeologists and detectives know — functionally specific, complex information [FSCI] that would otherwise be improbable, is one of these signs.

    Even in this and other recent threads, pretty good descriptions or intelligence have been offered.

    _________________

    Plainly, the evolutionary materialists among us have some serious soul-searching and rethinking to do.

    GEM of TKI

    PS: Bob O’H: You know, or should know, a lot better than that on what happened to Mr Sternberg. [Cf links at 334 above, and a lot of other sources, onlookers. This is making light of injustice, AGAIN. Let us heed the warning, before it is too late to avert tyranny.]

  319. Kairosfocus writes,

    The rhetorical dodge to label abduction as “post modernism”.

    That’s not what I wrote, as anyone who goes back and reads the first part of 324 can tell.

  320. I have lots of grassroots experience with ID advocates, and I can assure you that a desire to include supernatural explanations in science is a theme that runs throughout the arguments of those advocates.–Jack Krebs

    Is that why the Discovery Institute says that ID does NOT rely on the supernatural?

    So despite the formal claim that ID is not about supernatural causation, I think there is a lot of evidence that this is not true in respect to many ID advocates and to the ID movement as a whole in respect to various situations, such as the Kansas science standards, around the nation.–Jack Krebs

    And what about the materialistic position? It leads to a singularity. Meaning that it needs something beyond nature to get it going.

    So if you reject ID because of some infinite regress you also have reject the current paradigm for the same reason.

    You don’t get to ignore the fact that your position refresses to the SAME point as ID. That would mean you hold ID to a different standard.

  321. Joseph writes,

    Is that why the Discovery Institute says that ID does NOT rely on the supernatural?

    The DI says lots of things that I think are wrong. I have abundance evidence that many ID supporters, including public figures in the Kansas situation, believe that a goal of ID is to get science to include creation by God as a scientific explanation. It really makes no difference that the DI denies this if in fact people continue to affirm it.

    In fact a lot of this goes on in the discussion here at UD: among other things notice the frequent reference to Romans 1:20.

    And please note well that I am not disparaging Christianity here. I am a strong defender of theistic evolution and I know that TE’s, as Christians, accept Romans 1:20. But I believe that is a statement of religious faith, not a scientifically verifiable assertion.

    Joseph writes,

    And what about the materialistic position? It leads to a singularity. Meaning that it needs something beyond nature to get it going.

    So if you reject ID because of some infinite regress you also have reject the current paradigm for the same reason.

    You don’t get to ignore the fact that your position refresses to the SAME point as ID. That would mean you hold ID to a different standard.

    I don’t believe you know anything about my position on this aspect of the discussion, but you do mischaracterize my position. I don’t have time to describe my thoughts on this subject right now, but they are not as you state.

    And I don’t believe that materialism is the current paradigm for many: as I have repeatedly argued, millions of people with various non-materialistic religious and philosophical beliefs accept science and accept the theory of evolution. Fighting materialism, which seems to be the main concern of many here, is not the same as fighting science.

    That is what is at the heart of the “seeking natural explanations” issue in the Kansas standards: limiting science to seeking natural explanations is not the same as saying that natural explanations are all the human beings can, and do, seek. But seeking other kinds of explanations – spiritual, moral, ethical, emotional, etc. – goes beyond science and involves different aspects of our nature and experience. Just because science does one kind of thing doesn’t mean that these other kinds of things aren’t important.

  322. Mr Krebs:

    Re 324:

    [Citing SB:] . . . If ID can’t do “abductions” in the name of science, then neither can Darwinists.

    [JK:] This view sounds quite post-modernish to me, and I don’t agree . . .

    Last I checked my fravourite style advisors, “this” is most often used to directly identify the last just above, in the context of a list. If you instead meant to speak more broadly, you should have used something like “the above,” but that would still carry the invitation that you are imputing to abductive reasoning postmodernism. If you do not intend to impute pomo to abduction in SB’s statements, you need to write far more carefully and specifically.

    Further, if you will look at my earlier remarks, you will see that I used the logic of implication to substantiate what abductive inference is about. [Recall, Newtonian physics broke down abductively about 100 years ago. Cf my basic intro on the logic of science here. This, here, on basic straight thinking might help your harried teachers who are too busy to take time to teach kids how to think straight. It is based on materials I successfully used with 4th formers and up, for years. ]

    And, the “arbitrariness” in question in SB’s remark is the injection of a question-begging, double-standard criterion into your definition, which is — as I have shown since 123 – 4 — where the real RE-definition of science has been attempted.

    As an educator, it is credible that you will have done at least some basic inferential statistics; so you will recognise the implications of the rejection of the chance null hyp in contexts where the plausible alternative is agent action. Similarly, when we set up experiments with controls and treatments and apply ANOVA or related techniques, we are looking at assessing effects of agency inputs. In communication theory, the basic inference to message not noise is a design inference. All these have long since been pointed out in this thread, but not acknowledged.

    You cannot properly apply a selectively hyperskeptical double standard to design inferences when you don’t like their contexts. Nor can you properly write such a double-standard into a “definition” of “science.”

    Nor can you try to claim that such a definition extends over the past 500 or so years. That flies in the face of history. if instead you mean that the “definition” evolves, why then it needs to evolve right back to one that can handle the three observed causal factors: chance, necessity, agency. Or else, you are really saying that he power games you have played in Kansas trump the understanding that science is a serious search for the truth about the world in which we live, based on empirical and associated theoretical investigations.

    And, as Lyotard et al would be quick to point out, that is a very pomo — strictly, as Oden points out in that just linked lecture reader: ULTRA-modernist — perspective.

    GEM of TKI

  323. Mr Krebs:

    Re your:

    The DI says lots of things that I think are wrong. I have abundance evidence that many ID supporters, including public figures in the Kansas situation, believe that a goal of ID is to get science to include creation by God as a scientific explanation. It really makes no difference that the DI denies this if in fact people continue to affirm it.

    This is just insistent slander. And by now you must know better than that.

    I challenge you to properly draw out of the explanatory filter or the irreducible complexity concept — the professional, scientific level issues — an inference to God or the supernatural more broadly as opposed to an inference to INTELLIGENCE, as is written into both the name and the definition of ID.

    Cho man, do betta dan dat.

    GEM of TKI

  324. You know Darwinism has reached its institutional phase when its rhetoric starts to feel like being in church on Sunday morning and listening to a well-meaning but paternalistic and slightly dull sermon.

    That’s okay. We can speak slowly, too.

    There may be a “philosophical” side to ID, but that’s not really where it’s at. The real meat of the ID inference is found in the hard science being published every day in top peer-reviewed journals—countless study results in biochemistry and other fields that cry out “design” even though the word itself is rarely used.

    Are we getting through yet? It’s not the philosophy; it’s the Zeitgeist. The tide is turning against Modernism and the intellectual oppression that goes hand-in-hand with its love of theory, as typified by institutional Darwinism. Not because of any argument, or any strategy, but simply because hard science has passed Darwinism by.

    That’s why the church is empty. Or hadn’t you noticed? NS just isn’t hip anymore. It was hip a hundred years ago, but the world has moved on, and Darwin’s clergy are making themselves increasingly irrelevant with each new dogmatic proclamation.

  325. to KF: “This” referred to the entire paragraph that I quoted, not just the last sentence. If you actually read the two paragraphs I wrote you will see what aspects of the situation I was referring to as being post-modernish. I did not make the claim you said I made.

  326. PS: Bob O’H: You know, or should know, a lot better than that on what happened to Mr Sternberg. [Cf links at 334 above, and a lot of other sources, onlookers. This is making light of injustice, AGAIN. Let us heed the warning, before it is too late to avert tyranny.]

    If I’ve made an incorrect statement, I’d be happy to be corrected, but the link you gave says nothing about the investigation I was referring to, and does not appear to mention demotion. So I’m not sure what the relevance is.

  327. Bob O’H is on record that nothing of consequence happened to Sternberg. Does anybody have any contrary information or is the Sternberg episode just a lot nothing.

  328. —-Jack Krebs: “This” referred to the entire paragraph that I quoted, not just the last sentence. If you actually read the two paragraphs I wrote you will see what aspects of the situation I was referring to as being post-modernish. I did not make the claim you said I made.”

    Inasmuch as you are laboring strenuously to misinterpret a paragraph that I wrote, I will rewrite it (with interpretation in parentheses) so that can be no misunderstanding.

    Your standard of science is an arbitrary formulation calculated to serve the interests of Darwin fundamentalists. (The term “arbitrary” in this sense is meant to convey the idea that science is being defined in a way that serves a partisan interest and therefore does not serve the interests of truth. It is not meant to convey a sense of social constructivism, which is the post-modernist way of “creating” a subjective truth rather than “discovering” an objective truth.) More to the point (as in the original paragraph, this is a literary hint that what is coming up is the main point of emphasis and therefore not to be ignored) If you subjected your Darwinist methodology to the same standards as ID, it would not qualify as science either. ID and neo-Darwinism are parallel explanations or alternative inferences to the best explanation. If ID researchers can’t do “abductions” in the name of science then Darwinists must be held to the same standard. That means that either both are doing science or neither are doing science.

    It is my fervent hope that you will now drop the inappropriate allusions to “postmodernism” and address the issue on the table.

  329. Jerry:

    Mr Sternberg was harassed to the point where as I recall, he lost his wife.

    He was unjustly accused of all sorts of things up to and being suspected of being an academic fraud [he holds TWO PhDs relevant to evolutionary biology] and a thief [we gotta change the locks and deprive him of keys . . .] etc etc. it was really nasty. And, as the Congressional staff report will make plain, he was effectively demoted and he was subjected to loss of reasonable access to research materials, all for [1] publishing an article that was published in accordance with relevant procedures, passed proper peer review by three qualified indeed “distinguished” scientists and [2] insisting on keeping the confidentiality of such review. All through the collusion of the NCSE and senior staff at the Smithsonian. (But you see, if we are to believe Mr Krebs and his ilk, if it challenges the unchallengeable, perfect wisdom of the evolutionary materialist paradigm, ipso facto it cannot be “science.”]

    The only reason the RvS case has not gone to court is the peculiarities of his status as a research associate. Indeed, the letter that Bob just tried to make light of is itself serious and sobering reading, especially the email transcripts in it. (Indeed, it reveals a deep-rooted hostility that lurks behind the actions of the likes of the educator we have just had an exchange with: are we SURE we want our children under the tutelage of such men?)

    Go here for RvS’s own side of the story and a fair amount of documents. if you track my email through my always linked page and the contact me link, I will provide you with a copy of the staff report as I think it is no longer available online. Stunning reading, reminds one of the worst days of fascism.

    Bob should be ashamed of what he just did. There is no excuse or even explanation for what was done to Mr Sternberg. Period.

    GEM of TKI

  330. I guess DS has to recalculate ATP synthase’s CSI:

    ATPase is no example for ID since you can remove the axle and it still rotates (Furuike S et al. (2008): Axle-less F1-ATPase rotates in the correct direction. Science 319(5865):955-958). As PZ says:

    This is obviously what we’d expect from evolution: that a molecular machine would not be an all-or-nothing affair, but that incremental variations would produce incremental changes in efficiency.

  331. The term “arbitrary” in this sense is meant to convey the idea that science is being defined in a way that serves a partisan interest and therefore does not serve the interests of truth.

    —–Leo Stotch: The Scientific Method, dating to centuries prior to Darwin’s birth, was developed as a tool to suppress a nascent challenge to evolution? Wow, it must have been developed by Nostradamus.

    What is it about the phrase “is being defined” that you don’t understand. Try to refect on the significance of the present tense.

    Also, congratulations on ignoring the main theme of the paragraph, which was, of course, the fact that ID and Darwinism are parallel methodologies.

  332. Leo:

    Do better than that.

    I have, long since (123 – 4 on), cited dictionaries from 1990 on science and from 1965 on sci method that show just how recent is the attempted, question-begging redefiniton of science as in effect the best evo mat explanation of the cosmos from hydrogen to humans.

    In case you will not scroll up, here they are again:

    science: a branch of knowledge [= "true, justified belief"] conducted on objective principles involving the systematized observation of and experiment with phenomena, esp. concerned with the material and functions of the physical universe. [Concise Oxford, 1990]

    scientific method: principles and procedures for the systematic pursuit of knowledge [”the body of truth, information and principles acquired by mankind”] involving the recognition and formulation of a problem, the collection of data through observation and experiment, and the formulation and testing of hypotheses. [Webster’s 7th Collegiate, 1965; I have deliberately chosen definitions from dictionaries that were published before the current controversies.]

    The redefinition Mr Krebs and you have championed takes science away from its ability to recognise and freely follow objective truth.

    For that, there is no excuse or explanation. Period.

    GEM of TKI

    PS: Onlookers, here is a useful popular level intro on what is going on. I challenge Mr Krebs and co to summarise then cogently rebut this article on its main points.

    PPS: Mr Krebs, Rom 1:19 – 23 gives Paul’s statement as a theistic design thinker — not the only kind [cf Cicero 50 BC, Plato circa 400 BC, or for that matter an Antony Flew or David Berlinski today]. If he is wrong, he can be shown to be in error, but not by question- begging definitions. And, Rom 1:19 – 23 has nothing to do with the properly scientific status of the explanatory filter or the irreducible complexity concept. I again challenge you to accurately summarise these concepts and show why they are properly unscientific.

  333. —–kairosfocus: “I have, long since (123 – 4 on), cited dictionaries from 1990 on science and from 1965 on sci method that show just how recent is the attempted, question-begging redefiniton of science as in effect the best evo mat explanation of the cosmos from hydrogen to humans.”

    Indeed you have. Also, I have corroborated the point by indicating that until 15 years ago, philosophy of science textbooks did not use the term “methodological naturalism.” Further, there is nothing about it in the history of the philosophy of science. Methodological naturalism is the new kid on the block, and this new kid has become a juvenile delinguent.

  334. People seem to want to leap on me, so I’ll ask again – please say specifically what it wrong with what I wrote:

    1. The report wasn’t written by the sub-committee, it was a staff report prepared for one of the members of the committee.
    2. The “demotion” was not from one job to another. Sternberg was a guest researcher, and his title changed, but I don’t know if that changed any of the privileges he is entitled to.

    The sub-committe report was not the OSC report, so citing that is not relevant to my first point. As for my second, someone would have to show that Sternberg was employed by the Smithsonian before you can even start to build a case that I’m wrong.

    Please also note that this is all is wrote – Joseph’s claim that I am “on record that nothing of consequence happened to Sternberg.” is simply wrong. I hope Joseph will show where I explicitly state this, or apologise for mis-representing me.

  335. 47

    StephenB, at 347, writes,

    Inasmuch as you are laboring strenuously to misinterpret a paragraph that I wrote, I will rewrite it (with interpretation in parentheses) so that can be no misunderstanding.

    Your standard of science is an arbitrary formulation calculated to serve the interests of Darwin fundamentalists. (The term “arbitrary” in this sense is meant to convey the idea that science is being defined in a way that serves a partisan interest and therefore does not serve the interests of truth. It is not meant to convey a sense of social constructivism, which is the post-modernist way of “creating” a subjective truth rather than “discovering” an objective truth.)

    Stephen, I don’t think I labored to misinterpret you. Here are a few definitions of the word “arbitrary” which are in agreement with my understanding of the word:

    1. based on or subject to individual discretion or preference or sometimes impulse or caprice;

    2. Choices and actions are considered to be arbitrary when they are done not by means of any underlying principle or logic, but by whim or some decidedly illogical formula

    3. Uncertain; random; accidental; discretionary; outside of central relevance to the methodology, law or principle, therefore accepting of individual choice and subjectivity.

    None of these seem to imply being chosen for a partisan purpose. I understand what you mean now that you have clarified it, but my original response was to the word “arbitrary” as meaning as described above, and I don’t think that can be taken as a misinterpretation, labored or otherwise.

    Stephen also writes,

    More to the point … If you subjected your Darwinist methodology to the same standards as ID, it would not qualify as science either. ID and neo-Darwinism are parallel explanations or alternative inferences to the best explanation. If ID researchers can’t do “abductions” in the name of science then Darwinists must be held to the same standard. That means that either both are doing science or neither are doing science.

    This gets to the heart of my point to kairosfocus.

    Seeking the best inference (abduction) is one of the main things science does – it is most certainly not a post-modern idea.

    But there are aspects of the situation other than abduction that are

    1. relevant to whether something is science or not, and also to

    2. whether a particular inference is in fact the best scientific explanation.

    1. Science uses particular tools to test the inferences under consideration. (These are covered well in the Kansas science standards.) One may draw inferences that in fact are not amenable to scientific investigation: for instance, Christians believe that the inference that the entire world shows evidence of design is the best explanation, and within the context of their religious faith it is, but that doesn’t make it a scientific inference.

    ID researchers can provide inferences that claim that ID explanations are the best explanation. If those explanations are compatible with all the other components of the scientific method, then they can be considered scientific inferences, but if they include claims that are untestable using the methods of science then they wouldn’t be scientific inferences even though the holder may considerer them the best explanation from that person’s metaphysical position.

    Which brings me to point 2

    2. Given competing scientific explanations, some inferences are genuinely competing, but sometimes it is a clear that a given scientific inference is poor, and in fact at times we conclude that it is dead wrong. The scientific method and the worldwide scientific enterprise do have ways of sorting out the solid inferences from the weak, and in the colloquial sense, the right from the wrong.

    So just because something is an inference doesn’t mean it’s a correct inference – that is what the process of science tries to ascertain.

    So there are two questions to ask of an ID inferential hypothesis:

    Can it be investigated with the tools of science, and if so, is it correct.

  336. —-Jack Krebs: “None of these seem to imply being chosen for a partisan purpose. I understand what you mean now that you have clarified it, but my original response was to the word “arbitrary” as meaning as described above, and I don’t think that can be taken as a misinterpretation, labored or otherwise.”

    Fair enough. Indeed, on rereading my original paragraph, I agree that the first sentence was far too murky.

  337. Thanks, Stephen. I think that is all cleared up, and I now understand your point.

  338. —–Jack Krebs: “Science uses particular tools to test the inferences under consideration. One may draw inferences that in fact are not amenable to scientific investigation: for instance, Christians believe that the inference that the entire world shows evidence of design is the best explanation, and within the context of their religious faith it is, but that doesn’t make it a scientific inference.”

    First, let me pay you a compliment. Your frequent posts and consistent application to the issues is much appreciated and it lends itself to optimum clarification of issues. Also, I wish I didn’t have to revert back to the critical mode after immediately establishing a point of agreement with you about the various connotations of the word “arbitrary.” Nevertheless, here we go.

    The “explanatory filter,” which is a definitive (though not the only) means of design detection does not rest on religious faith nor is it applied in that context. Surely, this has become clear by now. We move from [A] physical laws to [B] chance, and, if justified [C] design. There is no reason to confuse this process with an exercise in religious faith. Don’t hold us accountable religious fundamentalists who can’t make the distinction and please don’t use their confusion as evidence as ID science in action.

    —–“ID researchers can provide inferences that claim that ID explanations are the best explanation. If those explanations are compatible with all the other components of the scientific method, then they can be considered scientific inferences, but if they include claims that are untestable using the methods of science then they wouldn’t be scientific inferences even though the holder may considerer them the best explanation from that person’s metaphysical position.”

    Once again, you are assuming methodological definition of science as the standard of judgment when it is precisely that definition and that standard of judgment that is the point of contention. This definition or standard is not 500 years old. As kairosfocus and I have already indicated, it is only about 15-20 years old.

    —–Given competing scientific explanations, some inferences are genuinely competing, but sometimes it is a clear that a given scientific inference is poor, and in fact at times we conclude that it is dead wrong. The scientific method and the worldwide scientific enterprise do have ways of sorting out the solid inferences from the weak, and in the colloquial sense, the right from the wrong. So just because something is an inference doesn’t mean it’s a correct inference – that is what the process of science tries to ascertain.

    You are right, of course. That is precisely the question we should be asking: Which paradigm is most likely to lead us to the truth? I submit that the ID model is more qualified than neo-Darwinism to arrive at a “correct” conclusion because it is more willing to go where the evidence leads. Unfortunately, that is not what the fuss is really about. Many of the scientists that you allude to are less concerned about sorting out the good from the bad and more concerned about clinging to their obsolete paradigm. They use their power to disenfranchise ID scientists precisely because they don’t want that paradigm challenged. That is not good science. A good scientist is always willing to challenge his own assumptions.

  339. Stephen writes,

    First, let me pay you a compliment. Your frequent posts and consistent application to the issues is much appreciated and it lends itself to optimum clarification of issues.

    Thanks. I like to think that my style of posting is consistent, but the frequency of my posts and overall participation in this thread is because I’m on spring break – life will return to “normal” next week, and then all this will have to cease. :-)

    Later, Stephen writes,

    Once again, you are assuming methodological definition of science as the standard of judgment when it is precisely that definition and that standard of judgment that is the point of contention. This definition or standard is not 500 years old. As kairosfocus and I have already indicated, it is only about 15-20 years old.

    And, as I have responded, the phrase “methodological naturalism” is recent, but the idea that science seeks natural explanations is in fact foundational to the rise of science with Galileo, Newton et al. This is well-established: Galileo, Newton and others clearly and explicitly explained that they were separating the search for physical explanations from metaphysical ones. If you can find evidence from the history of science that contradicts this, please offer it.

    Stephen writes,

    Which paradigm is most likely to lead us to the truth? I submit that the ID model is more qualified than neo-Darwinism to arrive at a “correct” conclusion because it is more willing to go where the evidence leads.

    This may be true if in fact ID can show that something other than a natural explanation actually leads someplace, but such an explanation must be something that is susceptible to the scientific method. Even if the world of science were to suddenly agree that both natural and non-natural explanations were acceptable, ID advocates would still have to put forth some hypotheses, clearly state specifics (what, when, where, how, etc.), develop methodologies that could be following by all scientists regardless of metaphysical beliefs, and so on.

    So this is the challenge to idea. Have faith in your own program and get to work doing the above: show the world that ID is not just all philosophy. If you can do the above, then scientists will follow.

    Your (and the ID movement’s) insistence that the demarcation problem has to be solved first has the cart before the horse. Show that moving the boundary for science leads to something that is useful (in the explanatory sense) and convincing.

    Which brings me to my last point.

    Stephen writes,

    The “explanatory filter,” which is a definitive (though not the only) means of design detection does not rest on religious faith nor is it applied in that context. Surely, this has become clear by now.

    No, the “explanatory filter” is not definitive: the methods outlined by Dembski have never been used in a realistic biological context. As I wrote earlier in this thread, the only calculations that have ever been done in the context of the explanatory filter have been under the hypothesis that all the parts of something have come together simultaneously by chance, and that is an unrealistic hypothesis that no biologist believes is the case for anything.

    No ID advocate has even tried, as far as I know, to develop a methodology for real situations (multiple organisms, multiple generations, selective pressure, etc.) by which someone could calculate the probability that state A in a population could lead to state B. The obvious thing to do – I have been pointing this out for years – would be for an ID advocate to tackle a simple experimental situation (one that he would characterize as micro-evolutionary), run an experiment in which state A proceeded to state B, and then show a method of calculating the probability of that happening.

    This is one reason why the world of science has not taken ID seriously: the simple combinatorial calculation methods put forth by the ID advocates are so unrealistic that biologists dismiss them as rhetoric and not a genuine attempt to do science.

  340. —–Jack Krebs writes: “So this is the challenge to idea. Have faith in your own program and get to work doing the above: show the world that ID is not just all philosophy. If you can do the above, then scientists will follow.”

    —–and again, “Your (and the ID movement’s) insistence that the demarcation problem has to be solved first has the cart before the horse. Show that moving the boundary for science leads to something that is useful (in the explanatory sense) and convincing.

    On the first point, we could get a lot more work done if the Darwinist establishment would stop chilling the environment, shutting down our labs, and ruining our careers. On the second point, the discovery of coded information is sufficient reason for considering non-natural elements. (By the way, thanks for understanding the difference between natural and unnatural as applied to intelligent design. Many do not).

    —–And, as I have responded, the phrase “methodological naturalism” is recent, but the idea that science seeks natural explanations is in fact foundational to the rise of science with Galileo, Newton et al. This is well-established: Galileo, Newton and others clearly and explicitly explained that they were separating the search for physical explanations from metaphysical ones. If you can find evidence from the history of science that contradicts this, please offer it.

    The spirit of science and history both contradict it. It is one thing to “seek” natural explanations; it is quite another thing to insist that nothing else should be sought. These great scientists were not committed to naturalism, they were committed to truth. Galileo, Newton el al. conducted a search for natural explanations because, at the time, it was the most productive thing to do. For them, it was a stretch out of a psychological comfort zone and an expansion of a former paradigm. They were breaking rules and challenging rigidly held assumptions. For them, it was the most productive means to get to an end, which was truth. It was the end that mattered, not the means. Methodological naturalism insists that the means must remain the same forever, even if the end may not be realized. It violates the spirit of science, which, in my judgment, is why Galileo or Newton would never have signed on it. I submit that they would have rejected methodological naturalism as a scientific straightjacket and a meddlesome intrusion

    —–“No, the “explanatory filter” is not definitive: the methods outlined by Dembski have never been used in a realistic biological context. As I wrote earlier in this thread, the only calculations that have ever been done in the context of the explanatory filter have been under the hypothesis that all the parts of something have come together simultaneously by chance, and that is an unrealistic hypothesis that no biologist believes is the case for anything.”

    Once again, with respect, I must insist on the proper distinctions. We are not discussing the “applications” of the explanatory filter which I will be happy to take up with you at another time. The subject on the table is the proposition that the explanatory filter is a scientific methodology. I am trying to disabuse you of the mistaken notion that it is a faith -based enterprise. Inasmuch as it begins with an empirical observation and examines sequentially and systematically the three possibilities of law, chance, it employs the scientific method. Once we understand that this process has nothing to do with religion, we can then discuss the quality of the science. I hope I am not being presumptuous when I say, first things first.

    Also, can you explain what you mean by “the hypothesis that all the parts of something have come together simultaneously by chance,” and how that relates to the explanatory filter. There may be some miscommunication here. You are not by any chance alluding to the subject of “irreducible complexity,” are you? That would be an entirely different matter.

    —–“No ID advocate has even tried, as far as I know, to develop a methodology for real situations (multiple organisms, multiple generations, selective pressure, etc.) by which someone could calculate the probability that state A in a population could lead to state B. The obvious thing to do – I have been pointing this out for years – would be for an ID advocate to tackle a simple experimental situation (one that he would characterize as micro-evolutionary), run an experiment in which state A proceeded to state B, and then show a method of calculating the probability of that happening.”

    As a thought stimulator, why not visit a current thread on this website entitled, “Intelligent design research published in ‘Nature.’” Once again, though, we are discussing the quality and the application of the science. That is something that I am willing to discuss once the appropriate distinctions have been made. Even at that, ID does not have a tough act to follow. Darwinism has not provided a single benefit for mankind in 150 years. It is irrelevant to cosmology, unnecessary for biology, and useless in medicine. Whatever advances that have been made in the study of antibiotic therapy find their origins in molecular biology and pharmacology, not Darwinism.

  341. 341

    The experimental scenario Jack suggests is something that Behe could (presumably) take up, since he has tenure. Does he still have a lab?

  342. Hmmm.

    1. I disagree with you about your view of the history of science in respect to seeking natural explanations, and the views of Galileo, Newton et al, but I don’t there is much more to be profitably discussed here.

    2. I definitely disagree that evolutionary science has not been useful. However, I’ll also say that human beings in general, and in science in particular, try to figure out as much as they can just because we want to know. We want to know things like how old the earth is and how stars are formed and how life has changed over time, so even if there have been no practical benefits to the theory of evolution (which I don’t believe is the case) we are going to study the question of how life came to have it’s present day diversity – just because we want to know.

    But this also is probably not worth discussing further either.

    Now Stephen writes,

    The subject on the table is the proposition that the explanatory filter is a scientific methodology. I am trying to disabuse you of the mistaken notion that it is a faith-based enterprise. Inasmuch as it begins with an empirical observation and examines sequentially and systematically the three possibilities of law, chance [and design], it employs the scientific method.

    Also, can you explain what you mean by “the hypothesis that all the parts of something have come together simultaneously by chance,” and how that relates to the explanatory filter. There may be some miscommunication here. You are not by any chance alluding to the subject of “irreducible complexity,” are you? That would be an entirely different matter.

    I double-checked by searching this thread, and I think I can with certainty say that I never said the explanatory filter was faith based – in fact I haven’t mentioned the explanatory filter at all in any of my posts (even though kairosfocus challenged me to demonstrate that I understand it.)

    But let me talk about it now.

    First, it’s a three step process: examine law first and then chance, and if neither law nor chance (within a reasonable level of probability – Dembski suggests > 10^-150), then conclude design.

    Now right off the bat the filter suffers from the fact that in the real world law and chance interact, often over an extended period of time, to produce the state in question – addressing them separately and in sequence as Dembski does is unrealistic in most cases, and certainly those related to biology and evolution.

    But let’s let that go, and lump law and chance working together into one category.

    Then the central question for the filter is “what is the probability that law and chance produced state X?”

    Therefore, the point I made about calculations based on pure chance are relevant to the idea of the explanatory filter. A calculation that merely looks at the total number of possible combinations for the components of something (the amino acids in the ATP synthase is what was being discussed earlier) is merely ruling out one possibility – that the molecule was formed by all the components coming together simultaneously by chance, and no one thinks that was the case anyway.

  343. —–Jack writes, “Now right off the bat the filter suffers from the fact that in the real world law and chance interact, often over an extended period of time, to produce the state in question – addressing them separately and in sequence as Dembski does is unrealistic in most cases, and certainly those related to biology and evolution.”

    Law and chance do interact in many ways, but they can certainly be analyzed sequentially in any case. Moon craters and snowflakes, for example, are two examples of law and chance working together, but each can be analyzed by category. “Specified complexity,” can be discovered in any information code, organic or inorganic. Patterns are patterns.

    —–”Then the central question for the filter is “what is the probability that law and chance produced state X?”

    Well, not exactly. That question is approachable with the explanatory filter, but it is not central. The central question is: Is a design inference warranted? Remember, the methodology is designed for a specific purpose, and it is skewed in the direction of allowing false negatives so that false positives can be avoided at all costs. In other words, the probability that the filter will detect design when none is present is almost zero.

    —–Therefore, the point I made about calculations based on pure chance are relevant to the idea of the explanatory filter. A calculation that merely looks at the total number of possible combinations for the components of something (the amino acids in the ATP synthase is what was being discussed earlier) is merely ruling out one possibility – that the molecule was formed by all the components coming together simultaneously by chance, and no one thinks that was the case anyway.

    It is not necessary to know how an organism is formed to recognize patterns and information codes. Consider the above paragraph. It exhibits specified complexity and was, therefore, designed. You don’t need to know anything else in order to make that calculation. If it exhibits “specified complexity”, it is designed. It doesn’t matter whether it is a whole or a part of a whole; whether it is a DNA molecule or an ancient hunter’s spear; whether it is man made artifact or a super-intelligent innovation. Intelligent agency leaves unmistakable clues, and it is bad science to ignore these clues.

    —–“I double-checked by searching this thread, and I think I can with certainty say that I never said the explanatory filter was faith based – in fact I haven’t mentioned the explanatory filter at all in any of my posts (even though kairosfocus challenged me to demonstrate that I understand it.)”

    Jack, please! You have claimed that ID is faith based. Clearly that indictment would apply to the explanatory filter, which is an important component of the ID methodology. Naturally, you didn’t discuss the explanatory filter without some prompting, because going into detail about the methodology automatically refutes your claim. Take note. We have discussed these points at some length, and the subject of religion has not come up one time. That should tell you something.

  344. Participants:

    At length, after 361 comments, some meat. Let us analyse:

    1] JK, 362, on the explanatory filter:

    it’s a three step process: examine law first and then chance, and if neither law nor chance (within a reasonable level of probability – Dembski suggests > 10^-150), then conclude design.
    Now right off the bat the filter suffers from the fact that in the real world law and chance interact, often over an extended period of time, to produce the state in question – addressing them separately and in sequence as Dembski does is unrealistic in most cases, and certainly those related to biology and evolution.
    But let’s let that go, and lump law and chance working together into one category.
    Then the central question for the filter is “what is the probability that law and chance produced state X?”
    Therefore, the point I made about calculations based on pure chance are relevant to the idea of the explanatory filter. A calculation that merely looks at the total number of possible combinations for the components of something (the amino acids in the ATP synthase is what was being discussed earlier) is merely ruling out one possibility – that the molecule was formed by all the components coming together simultaneously by chance, and no one thinks that was the case anyway.

    a –> Of course, the above neatly omits context that has been on the table ever since 123 – 4: the EF is an extension of commonly used inference testing techniques often seen in not only statistics but also by extension, in experiment design [e.g. ANOVA and control/treatment groups to distinguish chance and treatment effects – not only used in say agriculture or medicine but to evaluate novel teaching methods, JK!]. It is implies in the inference to message not noise in communication science and it is a commonplace in many fields of day to day praxis. So, the root issue is selective hyperskepticism in a context that does not fit an arbitrarily imposed [and BTW JK, arbitrary has a very relevant legal/administrative meaning of abuse of authority that disregards principle and precedent to make interested, rather than impartial and just decisions] worldview-laced agenda driven attempted re-definition of science.

    b –> I am also astonished to observe how easily Mr Krebs glides by the classic case in point of the EF in a bio-functional context: DNA is at the heart of cell-based life forms, and it has been analysed as a representative case from literally the origin of the modern design movement, in TBO’s 1984 TMLO; as to the impotence of chance + necessity in even generous prebiotic soups. FYI once again, DNA is a digital, 4-state information storing string. At the lower end, the minimal effective string length is of order 300 – 500,000 elements, the former corresponding to a configuration space of ~ 9.94*10^180,617.

    c –> Thus, even allowing for 10^1000 islands of functionality and 10^150 states per island, which is well beyond the number of individual organisms that can ever have lived in the observed cosmos across its lifespan [as 10^150 is the number of quantum states of the 10^80 or so particles in our observed cosmos], it is plain that the functional states are so isolated in the config space as a whole that random walks from arbitrary initial configurations in any plausible prebiotic soup will run out of probabilistic resources long before they reach any island of functionality. Similarly, chance + necessity are challenged to account for the explosion in config space required to cover body-plan level biodiversity such as in the Cambrian life revolution. Indeed, this is an excellent explanation for why the Cambrian life revolution – dozens of physla and subphyla right at the beginning of diversification on the conventional timeline – has defied darwinian explanation ever since, well the days of Darwin.

    d –> But, as we know, intelligent agents routinely create FSCI on that scale of complexity as this blog thread cumulatively exemplifies. So, we have a known effective mechanism, competing with a plainly probabilistically deeply challenged one. So, in the end, the key reason why a selectively hyperskeptical criterion is arbitrarily imposed on the definition of science is to evade the force of that, as evolutionary materialist thinkers are deeply uncomfortable with the idea of an intelligence acting at OOL or OO body-plan level biodiversity.

    e –> Now, too, Mr Krebs fails to note a very important context: CONTINGENCY, which immediately allows us to distinguish circumstances dominated by natural regularities [with maybe some noise or the like] and those dominated by chance or agency. That is, when he tries to lump together chance + necessity, he has neatly glided over a vital point – the FIRST DECISION NODE IN THE EXPLANATORY FILTER. Thus, disqualification right at the starting gate: Mr Krebs has misunderstood and thus misrepresented the way the EF works, right at the outset. [Thus, when he goes on to try to defend the attempt to slander the ID school of thought as a scientific endeavour as an attempt to introduce inference to the supernatural [cf here the question-beggfing redefintion he defends], he is simply not qualified to make that judgement.]

    f –> Now, too, this issue was emphasised right from the outset of the ID discussion of the origin of specified complexity. Here, let me quote the foundational technical level ID work, by TBO, citing and then expanding on Orgel’s 1973 remarks:

    ORGEL, 1973: Living organisms are distinguished by their specified complexity. Crystals fail to qualify as living because they lack complexity; mixtures of random polymers fail to qualify because they lack specificity.6 [Source: L.E. Orgel, 1973. The Origins of Life. New York: John Wiley, p. 189. in short the basic concept of Specified Complexity had long since emerged in the OOL literature when Wm A D was still a student in High School!]

    TBO, 1984, in TMLO ch 8 (which has long since been easily available online): 1. [Class 1:] An ordered (periodic) and therefore specified arrangement:

    THE END THE END THE END THE END
    Example: Nylon, or a crystal . . . .
    2. [Class 2:] A complex (aperiodic) unspecified arrangement:
    AGDCBFE GBCAFED ACEDFBG
    Example: Random polymers (polypeptides).

    3. [Class 3:] A complex (aperiodic) specified arrangement:
    THIS SEQUENCE OF LETTERS CONTAINS A MESSAGE!
    Example: DNA, protein.

    g –> Now, observe: crystals etc are in large part dominated by natural regularities tracing to mechanical necessity [e.g. inter-ionic, inter-molecular and/or metal packing forces]. They exhibit order, through there may be an additional randomising effect, e.g through dislocations and through impurities and other defects [and in fact such defects typically dominate the strength of materials]. In the case of semiconductors etc we then take advantage of this to engineer solid state electronics devices. In short, on a routine basis in real world microscopic scale science, we do distinguish reliably between chance, necessity and agency.

    h –> TBO then address cases of “high” contingency [i.e COMPLEXITY] – and, quantification relative to the UPB is where Wm AD comes into the picture. These show themselves in aperiodic structures and/or patterns of behaviour. The second — and main — question addressed by the EF is: how do we distinguish chance and agent action in the context of observed high contingency?

    i –> This brings up the second decision node: SPECIFICATION. For instance, functional code-bearing states are known to be rare in the relevant config space, once we have enough complexity to be relevant. Similarly, such states can be relatively simply described by simply stating the relevant function, without in effect having to repeat the sequence. So, if one observes functionality and can describe it simply, in a context of sufficient contingency [rarity reasonably 1 in 10^150 or more] we have excellent reason to infer agency not chance. To see why, in the context of the relevant statistical thermodynamics reasoning, cf my microjets example here. (Onlookers will observe here my use of functionality as a way to cut through the rhetoric over CSI.)

    j –> In short, JK sets up and knocks over a strawman, yet again. And, when it comes to ATP synthase, the obvious issue is to explain the DNA code for this enzyme, to achieve a rotatory enzyme central to energy processes in the cell, while the other structures of the cell also had to emerge. If this enzyme has only 300 monomers in its chain, that corresponds to 1200 DNA base pairs, or 4^1200 ~ 2.96*10^722 states. [Notice how DNA code analysis is directly relevant to assessing the FSCI in proteins, 300 amino acid residues being a typical protein chain length!]

    [. . . ]

  345. 2] SB, 363:

    This rebuttal is apt on the attempt to deny that JK indicts the EF as a faith-based inference to the supernatural:

    Jack, please! You have claimed that ID is faith based. Clearly that indictment would apply to the explanatory filter, which is an important component of the ID methodology. Naturally, you didn’t discuss the explanatory filter without some prompting, because going into detail about the methodology automatically refutes your claim. Take note. We have discussed these points at some length, and the subject of religion has not come up one time. That should tell you something.

    3] Similarly, this is telling on the design inference:

    It is not necessary to know how an organism is formed to recognize patterns and information codes. Consider the above paragraph [by JK]. It exhibits specified complexity and was, therefore, designed. You don’t need to know anything else in order to make that calculation. If it exhibits “specified complexity”, it is designed. It doesn’t matter whether it is a whole or a part of a whole; whether it is a DNA molecule or an ancient hunter’s spear; whether it is man made artifact or a super-intelligent innovation. Intelligent agency leaves unmistakable clues, and it is bad science to ignore these clues.

    Let us extend that analysis a bit, in light of my discussion in Section A , my always linked:

    k –> JK’s paragraph is text in English, transmitted over the Internet. That is, it was credibly encoded digitally [twice actually, in letters then in binary digits relevant to the HTTP protocol]. But, how do we KNOW that? For, is it not possible that random noise [by thermodynamics, an inescapable bane of communication systems] plus the mechanical necessities of electronics etc, has generated an apparent message where none was actually sent?

    l –> This is logically possible and there is no law of physics that utterly forbids it.

    m –> But, let us observe: letters are contingent, so not mere natural regularities tracing to mechanical necessity.

    n –> Further, sufficiently complex to be relevant to the EF: 292 characters inclusive of spaces, and including non-letter characters. So we are looking at, at minimum, 7-bit per letter ASCII code [128 characters . . .], or a config space of 128^292 ~ 2.02 *10^615, well beyond the UPB.

    o –> Within that space, relatively very few strings chosen at random will be SPECIFIED as “messages in English,” much less, such in the context of the discussion in this thread; as Denton long ago noted, it is empirically very hard indeed to generate 7 – letter words [avg. English lang word length] at random in text space, and that is before we get to grammar etc. [This point BTW is one reason why the old million monkeys typing Shakespeare by chance saw is so destructively misleading.] We therefore confidently and intuitively infer that the coded message was sent by an agent. Onward, contextual cues allow us to infer (with a far higher probability of error BTW) to the likely identity of the agent, one certain JK.

    In short, when we therefore see the same JK trying to infer that such a filter is not effective, we see selective hyperskepticism at work; using an inconsistent standard to reject what one does not wish to accept, for whatever reason or agenda.

    Observe JK, we freely and confidently affirm that in every case where the causal story is reasonably directly known, the EF correctly rules: agency. We therefore have high confidence that it is a reliable filter for that purpose: identifying clear cases of agent action. (Note the empirically based induction.)

    To date, over several years, not one counterexample has been put, of lucky noise generating messages beyond the UPB. And, targetted search techniques such as Mr Dawkins has used, introduce what Dembski and Marks call, active information, which is what allows them to do better than random search. Further to that, such use of active information becomes in fact an illustration of insightful, intentional, goal-directed intelligent design, precisely what the RV + NS darwinist model cannot revert to. Moreover, as a fair amount of that research has been published in the peer -reviewed literature, it can be chalked up to inadvertent intelligent design research.

    What is that trying to tell you?

    4] SB, 360: It is one thing to “seek” natural explanations; it is quite another thing to insist that nothing else should be sought. These great scientists were not committed to naturalism, they were committed to truth. Galileo, Newton el al. conducted a search for natural explanations because, at the time, it was the most productive thing to do . . .

    In fact, they were exploring natural regularities and were inferring, correctly, to mechanical necessity. For instance, in the classical apocryphal story, Newton watched an apple fall, with the moon swinging by in the sky. He connected the two, using the concept of in effect centripetal forces, and worked out the inverse square law nature of gravitation, which roughly matched the existing observations [If I recall correctly, about 10% off]. He then inferred further that the results were close enough to count, given the likely noise in the observations. He then did a far more detailed derivations, and more or less converted these into geometrical arguments.

    But, when we look at situations dominated by contingency, the matter is reversed. Chance or agency dominate, not necessity. And, in a lot of scientific work, we are interested in areas where such contingency dominates, so to arbitrarily insist on excluding agency when it does not suit one’s worldview preferences, is question-begging. And to then try to write that in the definition of “science” one proceeds to ram by state force down the throats of students is inexcusable. Period.

    5] Bob O’H:

    Bob, You are setting up and knocking over strawmen.

    You know or should know that Mr Sternberg was treated shamelessly, and that the only reason the Smithsonian people have got away with it to date is because his research associate status was cross-institutional, which complicated the jurisdictional issues. Stop straining at gnats while swallowing camels.

    If you want that Congressional staff report, you should be easily enough able to contact me.

    GEM of TKI

  346. PS: here is the online legal dictionary on ARBITRARY:

    Irrational; capricious.

    The term arbitrary describes a course of action or a decision that is not based on reason or judgment but on personal will or discretion without regard to rules or standards.

    An arbitrary decision is one made without regard for the facts and circumstances presented, and it connotes a disregard of the evidence.

    In many instances, the term implies an element of bad faith, and it may be used synonymously with tyrannical or despotic. . . .

    Sounds familiar? Sadly, and this is also very apt to an exchange on this Good Friday, it should.

    JK, if you will pardon a little Good Friday sermonette: what is it that the ghost of a certain Pontius Pilate is trying to tell you . . . ?

  347. 347

    Kariosfocus said,

    “Mr Krebs has misunderstood and thus misrepresented the way the EF works, right at the outset.”

    He is facilitating the current political strategy of the Darwinist cult. What Darwinists do is claim that Darwinism really isn’t about chance or necessity at all. Darwinists claim that Darwinism is actually “Evolution” and that no one can criticize evolution because it is universally accepted.

    Yet “evolution” is nothing but the description of change over time (i.e. the evolution of a bacteria vs the evolution of a BMW). The scientific matter at the hart of evolution is not whether it happens of course its over “how” it happened.

    What is meant by how? Well, this is where our Darwinist friends become nervously uncomfortable. There answer is an abstract tree of life that is the result of “mutations” and natural selection.

    The idea of natural selection is pretty much a fact. No one argues that things die and things live and that there is genetic material that is passed down generations that can only be passed down if the organism with it lives long enough to reproduce and of course visa versa.

    The issue here is about the “origins” of novelty. Where does that amazing genetic code come from in the first place and how did it get here. This is the real and ONLY question regarding origins.

    Now some very stupid Darwinist will repeat what some other sacred cow said or wrote in an out dated book that “mutations happen at random.”

    Some other very smart and politically adept Darwinists will say that “evolution is not random that is not how it works”– in an attempt to concede the point and create some false sense of truthful transparency regarding the theory’s straightforward correctness.

    Finally some very smart and very adept Darwinists like Richard Dawkins will say “life could have been designed but that is merely faith based and is not science.”

    Yet, some much smarter ID advocates know that the real and only faith being projected here is in the belief that mutation did and can occur for all of the complexity of life.

    So how do you possibly test the hypothesis that mutation and N/S could produce the double helix?
    You have to calculate the probability of it happening giving the best estimates of the variables in play. You have to label chance to the probability of a mutation occurring and you have to call natural selection necessity because in reality that is exactly what it is.

    In other words if you want to critique Darwinism to see if it is true you have to look at it for what it claims to be. Darwinists don’t want this because the theory doesn’t hold up.

    But that is not the end of it. If probabiltiy and necessity alone cant give us Specified Complexty then what can?!

    Via logical necessity,

    Enter: Explanitory filter

  348. PPS: On irreducible complexity and ATP synthase. I see where someone above has inserted a comment that the rotation is preserved in absence of the axle in the enzyme, as if that proves the material point. [BTW, has the crippled ATP Synthase been shown to be adequately and sustainably, multi-generationally functional in a cell of reasonable complexity, as a 100% in vivo replacement for normal ATP synthase? If so, why then did we get the more complex molecule to begin with?]

    Actually, we need to look at why it is that once DNA falls below about 360,000 base pairs life functionality begins to fail. That is, the cell as a whole [like the car as a whole, etc] shows an irreducible core based on the set of interacting complex components required to carry out its processes, one that has a measurable complexity as discussed above. ATP synthase is key to those processes as an energy linked enzyme. So, what is really needed is to account for the minimal complexity of the cell, right from the OOL – and that is the only logical start-point folks. Then, there is need to account for complexification and diversification into the cell types and behaviours required to account for body-plan level biodiversity.

    Of this we see nowhere the faintest trace in the literature.

  349. Frosty:

    Happy Easter weekend.

    I think you have a serious point.

    Cheerio . . .

    GEM of TKI

  350. 350

    Happy Easter to you too KariosFocus and evenyone else at the blog as well.

  351. 351

    Also I would like to add some further thoughts on the political game that Darwinists are playing here.

    I just finished 2 of Wittgenstein’s philosophical works- The Tractatus as well as a collection of his later papers called Philosophical Investigations.

    In both he discusses the nature of language and the rules of logic and operation within an understandable dialect.

    He focuses on what people mean by words and it is here that the realization or reality of his philosophy comes to light. No matter what I am feeling right now inside my soul or my head- someone else who is reading this very entry – regardless of how they feel – will understand almost exactly what I am saying “if” I have made sense using language correctly and intelligibly.

    What I am getting at here is
    One of the tricks that Darwinists use is to limit- that is “place false limits” on the language game that taking place in-between the ID advocates and the Darwinists.

    To go back and apply Wittgenstein here..

    ID advocates have used language correctly and have made vary intelligent and truthful claims or propositions regarding origins, DE and ID.

    What the Darwinists pretend to do is claim that they cannot understand what we are saying.

    If we attribute intelligence to the formation of specified complexity in the cell they claim they don’t no what we mean by “intelligence.”

    It is perfectly obvious what we mean but intelligence because the word can be looked up in any dictionary and applied to virtually an technologically evolved system on he planet. It can even be applied to Human beings themselves which are a product of nature.

    It is perfectly understandable to anyone with a 2nd grade imagination that the world could be at the very least front loaded in an intelligent way- that is resembling an intelligent thought.

    To deny this theory is limit language for political reasons.

    You cannot say that somthing is the result of intelligece in one place but deny that inference in another unless you have proff or evidece that is adequit or strong to the contrary.

    The ID inference is perfectly sensible and cogent- and the Darwinsts know it.

  352. Jack

    Is it fair to say that if ATP synthase was created in one step you’d agree that the only reasonable way that could happen would include the involvement of an intelligent agent?

    If you do then you have, admittedly or not, accepted the explanatory filter.

    You are correct in that most people (not everyone) don’t believe ATP synthase was assembled from scratch in one step. That’s because they don’t believe in the possibility of a designer but they do accept the explanatory filter’s output. The explanatory filter’s output in this case is a design inference IF ATP synthase was assembled from scratch in one step.

    Therefore the discussion becomes not about whether or not the explanatory filter works but rather about whether or not some incremental process (law and chance) can explain the assemblage of ATP synthase in steps where each step falls through the explanatory filter without a design inference.

    Imagining or presuming that there must be a series of steps explainable by law and chance is not scientific. It’s a statement of faith. In order to proceed beyond faith we must have the proposed steps defined so that they may each be run through the explanatory filter.

    We can never prove that no possible path exists for law & chance but that doesn’t make the design explanation non-science. If the design explanation is not falsifiable then I will agree it is non-science. But it IS falsifiable. If a single law and chance pathway is found then it falsifies the design explanation. Karl Popper described exactly this situation with the Black Swan example. A hypothesis is proposed that there is no black swan in nature. Obviously we cannot ever conclusively say there are no black swans because there is always the possibility that a black swan exists in a place where we didn’t look. But the hypothesis remains valid because finding a single black swan immediately falsifies the hypothesis. Likewise, the design hypothesis of ATP synthase is a valid scientific hypothesis because finding just one law & chance pathway will falsify it. If that path is described the explantory filter will do its job and fall out at the first question – can ATP synthase be explained by law and chance?

    Therefore, if you wish to falsify the design hypothesis for ATP synthase the burden is on you to describe the law & chance pathway. Otherwise it remains a perfectly valid scientific hypothesis. The hypothesis grows stronger as more effort to falsify it meets with failure just as the black swan hypothesis will grow stronger if continued searching fails to find a black swan. Similarly, the hypothesis that the law of gravity is the same everywhere in the universe can never be proven as we cannot, even in principle, measure it everywhere in the universe. But as we continue to measure it in more places and it is found to be the same the hypothesis grows stronger. A single instance of measuring the force of gravity and finding it different will falsify the hypothesis. Science would be crippled if we weren’t able to include “working theories” where proof of theory is not possible but falsification of theory is possible. That’s not to say that we should prefer non-provable theories to provable theories it’s only saying that both kinds of theories are necessary in the pursuit of science. Criminal trials where there is no eyewitness to the crime work the same way. If the prosecution can establish means, motive, and opportunity and any other explanation for the crime is beyond reasonable doubt that is sufficient to get a conviction. A single fact that subsequently comes to light which might establish reasonable doubt is always grounds for a retrial that may possibly overturn the original verdict. The conviction in this sense is a working theory. The criminal justice system would be crippled if positive proof were required for every conviction. That’s not to say we prefer circumstantial evidence to an eyewitness it’s just that the criminal justice system requires both because many crimes occur without an eyewitness.

  353. Therefore, if you wish to falsify the design hypothesis for ATP synthase the burden is on you to describe the law & chance pathway. Otherwise it remains a perfectly valid scientific hypothesis. The hypothesis grows stronger as more effort to falsify it meets with failure just as the black swan hypothesis will grow stronger if continued searching fails to find a black swan.

    This does my heart good and I cannot help but chuckle. You have touched upon a clever strategy by which we ID advocates need to sit back and do nothing while the hapless Darwinists have to struggle in their laboratories and writing for their silly journals. And in the end, who wins? ID wins!

  354. As I wrote earlier in this thread, the only calculations that have ever been done in the context of the explanatory filter have been under the hypothesis that all the parts of something have come together simultaneously by chance, and that is an unrealistic hypothesis that no biologist believes is the case for anything.–Jack Krebs

    That is false Jack. The EF does NOT require and the calculations do not require that the object/ structure in question arose simultaneously by chance.

    This is clear to anyone who has read and understood “No Free Lunch”.

    That you trumpet such a strawman demonstrates that you are either ignorant of the ID position or you are dishonest by misrepresenting it.

    No ID advocate has even tried, as far as I know, to develop a methodology for real situations (multiple organisms, multiple generations, selective pressure, etc.) by which someone could calculate the probability that state A in a population could lead to state B.-Jack Krebs

    What does that have to do with ID?

    ID does NOT try to explain everything.

    But thank you. You have demonstrated why it is very important to present ID to students.

    And again if you want ID to go away focus on supporting YOUR position.

  355. Joseph 374-
    Your response to Jack is non-responsive. In the paragraph you quote he does not make any claim about what the EF or the calculations done in applying it require. He states that in every instance in which those calculations have actually been done, the probability that the item under investigation arose by the action of law and chance alone has been calculated based on the assumption that it came together simultaneously.

    To refute him, all you have to do is find an instance in which the probabilities of a law and chance origin for the investigated phenomenon have been based on an honest and realistic appraisal of plausible law and chance pathways. But because most people who believe in ID don’t believe in plausible law and chance pathways, they never bother to actually consider what they might be in any particular case. They just raise two to the power of the number of something countable in the phenomenon (number of letters, number of nucleotides, whatever).

    Of course that’s just my experience of what IDers do based on reading this blog. If people here are constantly pointing to mainstream science articles as ID articles, and the journal established to publish ID articles hasn’t published an issue in 3 years, that gives the impression that there are no ID articles.

    Has any IDer gone through the proposed evolutionary pathway for any biological phenomenon and said here is the probability of this mutation, and here’s how I calculated it, and here’s the probability of this mutation, and here’s how I calculated that, and so on and so forth? That would require a lot of thinking and a lot of data analysis. Start with some easy ones and build up an arsenal of analytical techniques based on the data and familiarity with the existing science, then try to put a number on something like the flagellum.

  356. congregate,

    Are you saying that in order for you to accept ID that ID proponents must first explore ALL possible indirect pathways for ALL potentially designed objects? Seems like a hard demand to me and the unwarranted shifting of the burden of providing positive evidence. ID proponents on the other hand just want ONE example of an indirect pathway that is shown to create CSI.

    But because most people who believe in ID don’t believe in plausible law and chance pathways, they never bother to actually consider what they might be in any particular case.

    That’s because we’re not aware of a non-trivial example. Personally, I think that under limited conditions for certain types of systems there “might” a limited set of such pathways that create CSI (an unknown Law which ID would then adjust to). Now if it’s proven that these pathways (achievable by certain mechanisms) work uniformly then that’s another matter but in the meantime we’re waiting on just one example.

  357. Patrick – congregate might have a different take on this, but for me if you are to argue for design by looking for evidence against evolution, then you do have to explore all possible pathways, at least for the objects you are claiming are designed. Otherwise you’ve only got a designer-of-the-gaps argument.

    As for CSI, I’d still like to see a calculation of it. Dave tried but ended up admitting that he couldn’t calculate the specificity. There also seems to be some disagreement between him (@372) and Joseph (@374) over whether the calculation assumes a one-step synthesis.

  358. Now I’d say that it’s worth the effort to investigate known natural causes that PREVENT Darwinian evolution. But that’s another matter. You do realize that investigating ALL possible pathways is impossible–due to their necessarily indirect nature (due to IC)–in a practical sense? So, that being the case, what would you personally (obviously I consider this an unreasonable shifting of the burden) consider a reasonable number of pathway investigations per potentially designed object?

  359. I’m too busy to spend any time here now, but let me say that it’s not so much the number of investigations that is the issue (although that is an issue) as it is the lack of methodology for calculating the probability of any one pathway. If you don’t have a method that produces a number based on realistic conditions (x number of organisms, y number of generations, z number of mutational sites, etc.), then you can’t investigate his scientifically.

    It’s this simple: if you have a method that makes a claim about probabilities, you have to have a way of calculating those probabilities. I don’t see how this is not obvious.

  360. —–”If you don’t have a method that produces a number based on realistic conditions (x number of organisms, y number of generations, z number of mutational sites, etc.), then you can’t investigate his scientifically.”

    So, can we now agree that we are not talking about religion. Can we further agree that we are discussing the QUALITY of the science and not the FACT

  361. Sorry, premature post.
    —–Jack Krebs: ”If you don’t have a method that produces a number based on realistic conditions (x number of organisms, y number of generations, z number of mutational sites, etc.), then you can’t investigate his scientifically.”

    So, can we now agree that we are not talking about religion? Can we finally agree that we are discussing the quality of the science, which is debatable, rather than the fact of the science, which is not? I am prepared to go to the next step if you are. As it stands right now, it is not logical to discuss the efficacy of a scientific methodology while denying that it is a scientific methodology.

  362. Patrick at 376-

    Are you saying that in order for you to accept ID that ID proponents must first explore ALL possible indirect pathways for ALL potentially designed objects?

    No that’s not what I’m saying. Let me try to be more explicit.

    1) Jack said:

    the only calculations that have ever been done in the context of the explanatory filter have been under the hypothesis that all the parts of something have come together simultaneously by chance, and that is an unrealistic hypothesis that no biologist believes is the case for anything.

    2) In direct response to that Jack’s statement, Joseph (374) said:

    That is false Jack. The EF does NOT require and the calculations do not require that the object/ structure in question arose simultaneously by chance.

    3) The first two paragraphs of my statement in 375 were an attempt to point out that Joseph’s claim that Jack’s statement was false was not supported by the second sentence of his paragraph. Jack’s claim was not that the EF required simultaneity, but that every available attempt to demonstrate the use of the filter has used simultaneity, rather than any considered and empirically justified calculation of probabilities.

    As to what it would take for me to “accept” ID, I couldn’t precisely say, but to accept it as a scientific theory I would like to see some science being done on the building blocks of the theory, like, as I suggested, research on the probability of various types of mutations.

    I think Behe may even have done or tried to do some of this in EoE. Personally I don’t find the claims that because malaria has not evolved legs in the lab over millions of replications that evolution can’t have done it ever under any circumstances over any period of time to be particularly compelling. There are a lot of environmental and historical factors that the people making these claims don’t seem to have seriously considered in their analyses.

  363. Jack, I know you’re intending to criticize ID proponents but I see what you stated more as a condemnation of Darwinism since how can you or any other Darwinist honestly state that ANY of these pathways are at minimum “plausible” when Darwinists are not backing up any posited indirect pathways with such investigations?

  364. This idea of computing probabilities for the explanatory filter to work is an idea offered by IDists – it is not an idea or method that seems useful or is used by mainstream biologists. The person putting forth a new idea is the person who is responsible for devising the means to validate their idea. It doesn’t make sense for person A to have an idea and expect person B to figure out the means to prove A wrong. A needs to do his own work.

  365. Errrr…investigating ALL potential indirect pathways is the idea of you and your Darwinist friends. You’re inventing something new and claiming that in order for the EF to function correctly it requires this.

    My understanding is that the EF looks at the (final) object itself, not any specific hypothetical indirect pathway, and then calculates the number of informational bits required to represent the observed pattern. There is no assumption about how the object came to be, whether through a single event or multiple designed or undesigned iterations. The EF result should be a different result than that produced by calculating the probabilities of indirect pathways. Not to mention, the results for various pathways would of course be different depending on the number of steps (changes in length).

    For a real world example, I’ll use my name.

    “Patrick”
    8-bit single-byte coded graphic characters
    So 56 informational bits.

    Let’s say we had a genetic algorithm that started with a simple phrase and then produced “Patrick”. We could save the log and then calculate for each step. Depending on the pathway the result would be different from what I calculated for the EF.

    Now my name is not IC nor is it 500 informational bits. When a biological object is both I don’t see how this demand is required for the EF to function.

    Another example. Or even here with Musgrave’s ill-conceived “challenge” (which took about 20 minutes).

  366. My understanding is that the EF looks at the (final) object itself, not any specific hypothetical indirect pathway, and then calculates the number of informational bits required to represent the observed pattern. There is no assumption about how the object came to be, whether through a single event or multiple designed or undesigned iterations.

    That is wrong. Read Dembski’s explanation of the filter. The explanatory filter is about the history of the thing, not just it’s current state. This is a crucial distinction, and I am certain you are wrong.

  367. A pattern can of course include a specific history. For example, a million coin tosses that were all heads. But in a Powerball lotto does it matter how the balls bounced (a specific pathway) or just the result (pattern) that I won 10 times in a row? Also, I doubt Bill would confidently support the EF in regards to biology if it required the “history of the thing”. I mean, that’s the whole point…we DON’T know the exact history, so how could that be a requirement for it to work???

    In any case, I emailed Bill to see what he thinks about your objection.

  368. A post just evaporated. Is there any reason for it?

  369. Yes, Jack made a repeat comment with the addition of quoting me. So I zapped the duplicate.

    Anyway…I need to get going. Hopefully Bill will find time to drop in. I’m an engineer, not a mathematician, and it may be I’m misunderstanding something.

    EDIT: Edited 387 a bit.

  370. In order to accept the current paradigm, all that has to be done is show it works. It is impossible to explore all possible pathways and prove them deficient in order to disprove it. No science does that. That is a dodge and essentially admits that those who support the modern evolutionary theory do not have even one pathway or else they would be touting it. In other words the Darwinist have admitted they have lost the battle but the war goes on. Yes, hrun0815 on another thread, nylonase is trivial in terms of complexity and novelty and is no big deal. It is micro evolution. To bring it up is admission that there isn’t anything better or else you would have abandoned that example a long time ago.

    ID does not have to show anything. All it has to do is show the emperor has no clothes on. Which currently is true. It is up to the tens of thousands of people in evolutionary biology to dress him up, not the relatively small number in ID to eliminate all possible wardrobes.

    Now Darwinists won’t admit this but if they cannot show even one pathway to macro evolution that is not speculative then the theory is not a functional theory. We all accept the micro evolution aspects of it but it can shown that based on current knowledge and research, reproductive events do not lead to anything that is not trivial changes in genotypes and phenotypes. This could possibly change as new research comes in and analysis of current research is completed. But till that time all should accept the hypothesis that naturalistic approaches do not produce novel complex functions in phenotypes as the best explanation. So a Darwinist say that he will not accept this conclusion. Fine, what does such a person accept by pure speculation and that is not science under any standards.

    As an aside: this whole discussion will change somewhat in the next few months as more people read the Jablonka and Lamb book and find out that there are other processes affecting selection besides the genetic ones we are used to seeing here and in the textbooks and that these are passed along by reproduction. These epigenetic elements are real and have effects on the phenotype. They are quite interesting but from reading about them there is nothing that leads to real macro evolution, but only additional layers of micro evolution and maybe not even too much there. It is no threat to ID but adds some very interesting wrinkles to the evolution debate, some of which have a slight sniff of Lamarck.

    So when Allen MacNeill says that the modern synthesis is dead, don’t believe him. He just ascribes to a little bit more complicated version of the same process. And this process is entirely naturalistic and in no way undermines the current theory. It just extends it.

    We are a long way from chimps and humans but maybe some of the topics in this thread can be put on different posts in the future. We really should explore what we know about chimps and human similarities and differences as well as if there is any consistency in the evolution debate which I see little from those who support Darwinian methods. Jack has still not answered the question if something should be taught in science if there is no support for it no matter how the standards are written or what is the philosophical basis for teaching science.

  371. I made the same post again and it failed to show again. This time I have a copy but am curious why it failed to show up a second time.

  372. Patrick writes,

    Also, I doubt Bill would confidently support the EF in regards to biology if it required the “history of the thing”. I mean, that’s the whole point…we DON’T know the exact history, so how could that be a requirement for it to work???

    This is one of the problems I am trying to point out.

    Law, chance and design are typically referred to as causes. Causes move some part of the world from state A to state B. The explanatory filter is about making an inference about cause: it claims to lead to the inference that design was the cause by eliminating, on probabilistic grounds, that chance and law were not the cause. Being about cause, it must be about how a thing came to be and just not about it’s current state.

    For what it’s worth, the interested reader might like to read Howard Van Till’s critique of the explanatory filter idea here.

  373. Bob

    Where did I admit I couldn’t “calculate the specificity”? What I couldn’t calculate was your imagination. You imagined that other machines could meet the specification. I also couldn’t calculate Jack’s imagination. He imagined that there’s a Darwinian pathway that could build ATP synthase in a series of steps.

    What I admitted was that the design hypothesis for ATP synthase can’t be proven just like Popper’s example hypothesis about black swans can’t be proven. I can never prove that your imagined things don’t exist. What’s important, and what makes it scientific, is that the ATP synthase design hypothesis can be falsified.

    You and Jack evidently don’t understand falsification and/or think that anything that can be imagined is as good as being real.

  374. That EF filter is quite intuitive.

  375. —–Jack Krebs: “Law, chance and design are typically referred to as causes. Causes move some part of the world from state A to state B. The explanatory filter is about making an inference about cause: it claims to lead to the inference that design was the cause by eliminating, on probabilistic grounds, that chance and law were not the cause. Being about cause, it must be about how a thing came to be and just not about it’s current state.”Law, chance and design are typically referred to as causes. Causes move some part of the world from state A to state B. The explanatory filter is about making an inference about cause: it claims to lead to the inference that design was the cause by eliminating, on probabilistic grounds, that chance and law were not the cause. Being about cause, it must be about how a thing came to be and just not about it’s current state.”

    With all due respect, I anticipated this objection several posts ago. As I pointed out, it is not necessary to know how an organism is formed to recognize patterns and information codes. I can detect the design in an ancient hunter’s spear without know anything about the way it was constructed. If specifically planned patterns are present, a design inference is warranted. We have already covered that ground.

    Further, the article you refer to was answered by Dembski over five years ago. It is clear in reading Dembski’s answer that Van Till was confused about several matters, none of which I will go into here. If you want more detail, visit the “Design Inference” website and read the answers to the inappropriate objections. Why explore the questions and ignore the answers?

    Meanwhile, my earlier point is still on the table. Dembski’s explanatory filter is a scientific methodology. Van Till objected on scientific grounds, and Dembski answered the objection on scientific grounds. Again, I must call your attention to the fact nothing about religion is present in any of these discussions. Will you now prove your good faith and concede the fact that the ID methodology is a scientific and not a religious formulation. The only debatable issue is the QUALITY of the scientific methodology not the FACT of the scientific methodology.

  376. Or maybe not, but it does seem quite easy to comprehend.

  377. Jerry

    Your comment probably contained a sequence of letters that when encountered by the exspamatory filter resulted in a false positive.

  378. At 394, I wrote, “specifically planned,” patterns when I should have written, “specifically complex patterns.

  379. For Jack and Bob

    A review of the role of falsfication.

    Both of you made valid points in that things you imagined might exist. However, imagination of things possible in principle don’t rise to the level of demonstration that such things actually exist. Since black swans actually were found to exist Popper’s example is dated. The hypothesis was falsified. I’ll update it.

    Hypothesis: There are no purple polka dot swans in nature.

    Objection: There is no physical law that prohibits purple polka dot swans from existing in nature. One may exist but we simply haven’t observed it yet.

    Response to Objection: It can never be proved that there are no purple polka dot swans in nature. The hypothesis remains scientifically valid until the imagined purple polka dot swan is actually observed.

    Do you two understand this? If not then you don’t understand that scientific hypotheses need not be verifiable if they are falsifiable. Either that or you don’t understand the difference between imagination and reality. Do you two accept this? If not then you don’t accept Karl Popper’s demarcation of scientific hypotheses. If you don’t understand and accept these we don’t have sufficient common ground to continue this discussion.

    Jack: If you understand and accept this then my response to your assertion that law & chance can explain ATP synthase is that I agree it is possible in principle but you must demonstate that what exists in your imagination actually exists in reality.

    Bob: If you understand and accept this then my response to your assertion that many machines may exist that meet the specification of ATP synthase is that I agree it is possible in principle for many machines to meet the specification for ATP synthase but you must demonstrate that what exists in your imagination actually exists in reality.

  380. In response to my email about Jack’s objection, Bill said:

    I deal with this objection in part II of THE DESIGN REVOLUTION.

    After thinking on it personally I would place this objection in the same category as the assertion that the nature of the Designer(s) must be known in order for there to be a successful design inference (a topic that was recently debated here on UD).

    Also, way back at #350 sparc posted about ATP. This is a new objection? I realize sparc is still trying to understand IC due to other recent comments (see 129). Like Dave I want to know how this affects the efficiency. Others pointed out how there will be an irreducible core; the flagellum for example can have some components removed but there are core components required for functionality. For an example, let’s say we had a mousetrap that was electrified. This enhances the efficiency of its functionality. But we could remove that component. While the efficiency would decrease the irreducible core would still remain. So obviously once there is a functional core there can be modifications that involve direct pathways. Or there can be divergence where the original system loses components due to deleterious mutations and you have multiple variants with non-core components missing.

  381. I wasn’t making an objection. I was making the statement that the explanatory filter has to look at the history of an object and not just its current state in order to pass an event through the filter, so Dembski’s response doesn’t clarify anything. What I’d like to know is whether I am understanding the filter idea correctly.

    And if not, then why is all this talk about pathways relevant at all?

  382. Patrick @ 378 (and a couple of others making the same point) –

    You do realize that investigating ALL possible pathways is impossible–due to their necessarily indirect nature (due to IC)–in a practical sense?

    Yes. But how else can you show that something didn’t evolve naturally unless you show that it couldn’t evolve naturally by any pathway? For me, this is a big problem with the approach ID is taking. It’s purely a falsificationist programme, applied to a problem where falsification isn’t going to work.

    Dave @ 393 – seem my post @ 245. CSI needs a target specified. That’s the specification bit. You’ve admitted that you’re unable to specify how large the target is to get something that would act for the “storage of energy for use by other sub-cellular machines” (your post 172. Incidentally, isn’t this a definition of ATP, not ATPase?).

    You’re the one wanting to calculate CSI, so it’s up to you to calculate the specificity. I’m just a neutral observer (at least in this regard!), asking you to explain your steps.

  383. —–Jack Krebs: “I wasn’t making an objection. I was making the statement that the explanatory filter has to look at the history of an object and not just its current state in order to pass an event through the filter, so Dembski’s response doesn’t clarify anything. What I’d like to know is whether I am understanding the filter idea correctly.”

    As I stated earlier, I think your point is sufficiently addressed in Dembski’s answer to Van Till in “Naturalisms argument from invincible ignorance.” It can be found at “Design Inference Website.” Look for it in the section for year 2002.

    Again, I hope you will not be offended if I press an earlier point: Why explore the questions and ignore the answers? In the meantime, I must revisit yet another queestion. Do you concede that we are not talking about religion?

  384. He states that in every instance in which those calculations have actually been done, the probability that the item under investigation arose by the action of law and chance alone has been calculated based on the assumption that it came together simultaneously.–Jack Krebs

    That is false and Jack couldn’t substantiate that claim if his life depended on it.

    IOW Jack has to demonstrate what he says is correct.

    You guys don’t just get to say something and it automatically becomes true.

    And again if you want to refute ID all you have to do is substantiate the claims of YOUR position.

    But seeing that you cannot all you have left is to argue, from ignorance, against ID.

    Note- Not one of you has proposed a way to objectively test the premise that chimps and humans share a common ancestor. And if you did I will propose a test, using the SAME data, that supports an alternative position.

    CSI-

    To calculate specified information of something all you have to do is to count the bits required- For example CSI in biology refers to biological function.

    Therefor to calculate the specified information you need to know how many nucleotides (or amino acids) were required. Each nucleotide = 2 bits.

    Wm. Dembski puts CSI at a minimum of 500 bits. 500 bits is above 10^150- ie above all the probabilistic resources in the universe.

    So if you take the bacterial flagellum, which requires thousands of nucleotides, then you get a CSI of well over 500 bits.

    Now, to falsify the design inference of such a structure, just demonstrate how non-telic processes could build such a thing.

    And Jack, if we knew the history of something we wouldn’t need the EF.

  385. Hi folks.

    My spring break is over. I’ve got plans for the weekend and then it’s back to work, so I need to bring my participation in this thread to a close. I know that we don’t agree on many issues, so all I can do this morning is respond to some loose ends, and then let it go at that. Thanks to all for the discussion.

    1. Let me start with his last comment by Stephen:

    Do you concede that we are not talking about religion?

    We have talked about religion and science both. To the extent that the explanatory filter is about calculating the probability of certain events happening via law and chance, we are talking about something that is scientific. However, my position is that this concept has yielded nothing – that it has never been applied to realistic biological scenarios nor even has had proposed methodologies for doing so, and is unlikely to do so – so even though it is scientific in nature it is not something that will produce scientifically valid or useful results.

    On the other hand, ID most definitely is about religion for many people. For instance, those that say the world “screams” design, and quote Romans 1:20 in doing so; or those who make it clear that their objection to “seeking natural explanations” is that that approach is atheistic, and that ID is necessary to open the door to theism; or those that say the goal of ID is to establish that John 1:1 is scientifically true, and so on, confirm that for them ID is irrevocably connected to establishing scientifically a particular sectarian view of God’s activity in the world.

    2. On the more specific topic of the explanatory filter, Stephen asks “Why explore the questions and ignore the answers?, and refers me to an essay of Dembski’s. I have read Dembski’s response to Van Till, and quite a bit of Dembski’s other stuff. It’s not that I don’t understand his answers – it’s that I don’t think Dembski convincingly makes his case, and that he doesn’t really answer Van Till’s objections.

    3. Patrick emailed Dembski about my point that the EF is about the causes of an event – its history, and not just its cuurent state, but all we got back was a reference to the second half of a book. I continue to maintain that I am right: a simple combinatorial calculation concerning the components of an object addresses only one hypothesis – caused all at one moment by chance, is a hypothesis that no one believes is true anyway, and that eliminating it does not really address the real question, even in the context of the EF.

    Well, this is all I really have time for. Many interesting points have been raised, and the thread contains the results of a lot of work by numerous people. My thanks to the people here who supported my positions on various subjects – Bob O’H, congregate, leo stotch and larrynormanfan, and to those of you who disagreed with me civilly and thoughtfully, such as Stephen, Patrick and DaveScot.

    Thanks,
    Jack

  386. Bob O’H,

    Your reply at #402 is disingenuous. For a science to be viable it must show that it explains the phenomena it is supposed to apply to. Darwinian evolutionary theory fails entirely at macro evolution. There has never been an instance where it has been successfully applied.

    Current research in fact shows that it fails to generate the necessary complexity to do so in test after test. Therefore as a hypothesis let alone a theory it has been falsified and should be moved back to pure speculation. And because it is pure speculation should be removed from the textbooks and curriculum.

    How could any honest person say otherwise. The onus is on the scientists who support the Darwinian paradigm not ID to falsify every possible avenue of natural macro evolution.

  387. —–Jack K: “We have talked about religion and science both. To the extent that the explanatory filter is about calculating the probability of certain events happening via law and chance, we are talking about something that is scientific. However, my position is that this concept has yielded nothing – that it has never been applied to realistic biological scenarios nor even has had proposed methodologies for doing so, and is unlikely to do so – so even though it is scientific in nature it is not something that will produce scientifically valid or useful results.”

    Naturally, I can’t let that stand. As I have pointed out all along, the issue is about the quality of the science, not the fact of the science. Whether ID has “yielded nothing” is a controversial value judgment and has nothing to do with scientific texture of the methodology.

    Result: Point not addressed.

    ——On the other hand, ID most definitely is about religion for many people. For instance, those that say the world “screams” design, and quote Romans 1:20 in doing so; or those who make it clear that their objection to “seeking natural explanations” is that that approach is atheistic, and that ID is necessary to open the door to theism; or those that say the goal of ID is to establish that John 1:1 is scientifically true, and so on, confirm that for them ID is irrevocably connected to establishing scientifically a particular sectarian view of God’s activity in the world.”

    Some ID advocates may be motivated by religion just as some Darwinists may be motivated by atheism. ID does have members who are unabashedly and aggressively Christian; On the other hand, Eugenie Scott is an aggressive atheist and Barbara Forrest is a proud member of the New Orleans Secular Humanist Association. If the motives of SOME of a movement’s leaders define the science, then Darwinism is less about science and more about applied atheism. So, using Jack’s logic, Darwinism is “irrevocably connected to establishing scientifically a negation of God’s activity in the world.”

    Result: Jack has applied a convenient double standard. For ID, religious advocates discredit the science. For Darwinists, atheistic advocates are irrelevant to the science.

    —–“On the more specific topic of the explanatory filter, Stephen asks “Why explore the questions and ignore the answers?, and refers me to an essay of Dembski’s. I have read Dembski’s response to Van Till, and quite a bit of Dembski’s other stuff. It’s not that I don’t understand his answers – it’s that I don’t think Dembski convincingly makes his case, and that he doesn’t really answer Van Till’s objections.”

    If Jack is capable of articulating his objection, which he clearly is, he should be capable of articulating the REASONS he found Dembski’s answers unsatisfactory. If, as indicated, he understands Dembski’s answers, and if, as indicated, he has definite problems with those answers, he should disclose them and make them explicit. As it is, he simply says that, to him, they are unacceptable.

    Result: This is a disappointing evasion. If he has really read Dembski’s responses, he should be making his objections on those terms rather than approach the subject with questions the preceded Dembski’s responses as if Dembski had never addressed them.

    Overall, I found Jack’s willingness to dialogue admirable. However, his dedication to Darwinism and his anti-ID sensibilities cloud his judgment on the most critical issue. He unfairly characterizes ID as a faith-based enterprise because he fails to make the logical distinction between motives and methods. Further, he confuses the fact of the science with the quality of the science, vacillating from one aspect to the other to serve his own purpose. That is the one thing I found most disappointing.

  388. Participants

    Having a few net access and offline challenges, so I must be brief as I stand here in a friend’s shop and borrow some net access.

    On looking on the onward developments, it seems a few remarks are still in order, on the Explanatory Filter, and also since Mr Krebs is so insistent, on Rom 1:19 – 23.

    1] Chance, Agency and Necessity

    The causal filter is not dependent on knowing the specific history or alternative paths to form an entity.

    What it depends on is a commonplace empirical observation, immemorial since the days of Plato: chance, necessity and agency are known causal factors or forces – each of which is associated with characteristic features and markers. Namely, first, mechanical necessity shows itself in natural regularities, so if we see a regularity we know that law is the likely reason. By contrast, high contingency is associated with chance or agency – specific outcomes may vary across configuration spaces. For instance, a tossed die can end up with any one of the sides uppermost. Thus, the real issue is to distinguish the action of two contingent forces.

    To do that, we have resort to the issue of complexity and specificity, in light of the principles that underlie statistical mechanics and other similar studies. Namely, when we have sufficiently large config spaces and we either know the distribution patterns or have no reason to estimate any one outcome as more or less likely than another [i.e. Laplacian indifference applies], the relative statistical weight of clusters of states is decisive. In thermodynamics, the direction of spontaneous change is towards macrostates with high statistical weights, relatively; for the excellent reason that they are overwhelmingly more probable. Similarly, when high contingency situations are in rare but functionally specified states, that is overwhelmingly not likely to be by chance, but by agency. (The microjets example in Appendix A my always linked gives more details. Onlookers, observe how the objectors have consistently failed to address this on the merits, and the underlying discussion in TBO’s TMLO chs 7 – 9.)

    So strong is this observation that the EF in EVERY case of relevance where we also happen to know the causal story, it judges “agency” accurately. That is, it is empirically very well supported, and it is easily falsifiable: bring forward just one solid counter-example. (Guess why, after over 400 comments, none has been put . . .)

    In short, the “you must know the history” and the “you have to work out every possible path-way” objections are plainly specious.

    2] Rom 1

    Here, what is being ducked is that Paul sticks his neck way out: if it can be shown that nature does not show evidence of design, then a key plank of his theology is empirically falsified:

    RO1:19 . . . what may be known about God is plain to [men], because God has made it plain to them. 20 For since the creation of the world God’s invisible qualities–his eternal power and divine nature–have been clearly seen, being understood from what has been made, so that men are without excuse.

    RO 1:21 For although they knew God, they neither glorified him as God nor gave thanks to him, but their thinking became futile and their foolish hearts were darkened. 22 Although they claimed to be wise, they became fools 23 and exchanged the glory of the immortal God for images made to look like mortal man and birds and animals and reptiles.

    For a long time, Darwin and his successors were thought by many to have shown good reason to infer just that; strangely enough, with abundant references to images made to look like men, birds, beasts and reptiles! But in fact, what has now plainly come out — including in the above thread! — is that they do not have much more than just-so stories backed up by rigged definitions that bar scientific reasoning from addressing the possibility of agency as a causal force whenever the evolutionary materialist story of origins may look a little threadbare.

    So, when I hear of “religion” as an objection [by those who too often are themselves militantly anti-religious], instead of seeing the sort of detailed laying out of evidence and dynamics as I am very familiar with in my own discipline, it tells me that the objectors don’t have a real answer on the merits, and – in context – are appealing to prejudice to cloud and poison the atmosphere.

    Looks like the old tentmaker from Tarsus is still in the running folks. Along with Cicero, Plato and a lot of other design thinkers from classical times down to today. So, when today’s chance champions — as we have seen above — try to rig the rules of the game and try to cloud the issue instead of confidently taking up the challenge on the merits, that is absolutely telling on what they really think about the quality of their own case!

    As to the notion that the design inference is unscientific, it has plainly long since fallen of its own weight.

    GEM of TKI

  389. jerry @ 406 – I guess I shouldn’t be surprised that you chose to be offensive, and I hope you won’t be surprised if I chose to avoid debating with someone who won’t be civil.

  390. —–kairosfocus writes, “In short, the “you must know the history” and the “you have to work out every possible path-way” objections are plainly specious.”

    Precisely. ID looks for “indicators” not “histories.” As I pointed out earlier, it is not necessary to know how an organism is formed to recognize patterns and information codes. Van Till either does not understand or refuses to accept that fact. Because Jack has accepted Van Till’s objection as meaningful, he has fallen into the same error.

    —–Jack Krebs: “On the other hand, ID most definitely is about religion for many people. For instance, those that say the world “screams” design, and quote Romans 1:20 in doing so; or those who make it clear that their objection to “seeking natural explanations” is that that approach is atheistic, and that ID is necessary to open the door to theism; or those that say the goal of ID is to establish that John 1:1 is scientifically true, and so on, confirm that for them ID is irrevocably connected to establishing scientifically a particular sectarian view of God’s activity in the world.”

    This is yet another example of confusing motives with methods. Whether ID MAY lead to God is no more a reproachment on the methodology than the possibility that random variation and natural selection MAY lead to atheism. Once again, Jack misses the point and allows his personal biases and prejudices to cloud his judgment.

  391. Bob O’H,

    When have you ever debated evolutionary biology? So to decline to do so on the basis of my uncivil behavior sounds like “?” You choose the right word or expression.

    You most often pick small points to disagree with and occasionally point out an erroneous interpretation. Your forte is picking apart mistakes about minutiae often by those who are not informed and staying away from any issues of substance regarding the debate. That is often worthwhile since a lot of the comments here are not quite accurate and should be more focused and not the result of emotions ruling the day. While that is good, I have not seen you actually debate much so why would you start now.

    You can make a claim about my uncivil behavior but I doubt that is the reason why you refuse to debate. For an evolutionary biologist not be willing to defend the theory he espouses speaks more than all the evokings of incivility. You have all sorts of opportunities to defend your side and what have you produced.

    I can understand your behavior. It is similar to Jack Krebs who has a background in evolutionary theory, writes standards for the educational curriculum of his state and then refuses to defend the standards when they relate to evolutionary theory. When he finally did for the first time in my memory on this thread he presented irrelevant material and demonstrated his lack of understanding of the issues. I assume the reason you never present anything is because it would immediately be shown to be irrelevant or false. So I understand your reluctance.

    Allen MacNeill to his credit admitted there was no science or credible hypotheses to back up macro evolution where novel functions appeared in the history of life. It was a breath of fresh air. And because of Allen we are being introduced to the latest in new thinking in evolutionary biology but this is at the micro evolutionary level.

  392. Participants:

    One last follow -up, leaping upon (and defuzing) the the John 1:1 Parthian shot “live grenade” left by Mr Krebs.

    For, Mr Krebs — as a Parthian shot, has made reference to a very familiar context, which tells us at once that much of his argumentation probably traces to the agenda-driven [and frankly too often uncivilly demeaning and misleading] advocacy of that leading light of the Louisiana Humanists (i.e. Atheists) and philosopher, Ms Barbara Forrest.

    I of course advert to his at length use of a reference that no-one else has had reason to raise in the thread until he brought it up: John 1:1. (It has not come up for the very excellent reason that it has nothing to do with the attempted re-definition of science, or the original theme of the thread, on claimed substantiation of hybridisation of proto-humans and proto-chimps leading to complex speciation. I find it very interesting to see which side — design thinkers — sought to address the merits, and which – Mr Krebs and ilk – has too often kept on raising distractors, especially those that would be calculated to stir up hostility and poison the atmosphere. One trusts that there will be enough common decency that responses to points raised by Mr Krebs and co will not be wrenched out of context to further cloud the atmosphere, here or elsewhere.)

    The John 1 reference is in fact a well-known example of an atmosphere-poisoning distractor based on a professional philosopher acting as manipulative advocate by taking remarks out of context to make a rhetorical point when she should have known — and should have done — far better. (And, were I to for instance cite her behaviour as an all too typical example of the inherent amorality of evolutionary materialism driven atheism, the Darwinistas would scream in loudest protest that atheists can be decent people. Let us grant that, though it is clearly the case that evolutionary materialism, is logically and morally incoherent, as I have successfully argued at length at UD e.g. here. So, why then did she take a theological remark by one qualified to take his scientific findings up to a different level, as if that taints his scientific work qua science? Apart from destructive rhetorical tactics substituting for argument on the merits?)

    Let us address this, first by citing Jn 1:1 – 5:

    JN 1:1 In the beginning was the Word [LOGOS – logic, rational communication, reason], and the Word was with God, and the Word was God. 2 He was with God in the beginning.

    JN 1:3 Through him all things were made; without him nothing was made that has been made.4 In him was life, and that life was the light of men. 5 The light shines in the darkness, but the darkness has not understood it.

    a –> The first thing that jumps out is that in the very next verse to the one Mr Krebs alludes to, the Apostle John (right at the outset of his Gospel) commits himself, just as Paul did, to a point of potential empirical testing of a core component of his theology: if rational communication/information is not observably and traceably deeply embedded in reality, then there is potential for empirical challenge to – and even falsification of — Johannine theology.

    b –> In short, here again, foundational Christian thought is exposed to empirical test. Ms Forrest, as an informed philosopher, must be aware of that, and that this is a VIRTUE of the theology. [And of course, this very Easter Sunday morning celebrates that it is open to historical examination on a central claim: as 1 Cor 15;1 – 11 notes, namely, that Jesus rose from the dead, with over 500 eyewitnesses.]

    c –> Of course, just as with Rom 1, the rise of Darwinism — that which Mr Dawkins says makes it possible to be an intellectually fulfilled atheist [I beg to differ, as it can be shown that evolutionary materialism is inherently self-undermining] – has led many in Western Culture to believe that random chance plus blind necessity credibly account for life and its body plan level diversity up to and including us without any need to revert to an active rational principle.

    d –> But, as even this thread underscores, that traces more to a mood that has excluded inference to intelligent action from the outset [especially through the now notorious question-begging materialistic redefinition of science championed by Mr Krebs and co], rather than to having actually provided adequate evidence on the origin of life by chance + necessity, or of its macro-level biodiversification by chance variation and natural selection etc.

    e –> In that context, Mr Dembski, who holds doctorates in both Philosophy and Mathematics, has by championing the explanatory filter and associated techniques, has given us scientific tools for testing in very relevant contexts, the presence of credibly actively rational information/communication in the entities we see in the world around us. This pattern of reasoning – detractors and their many claims notwithstanding [cf. Above] – provides us with good grounds for concluding that, lo and behold, key features of the world do reflect intelligent design.

    f –> Now, also, Mr Dembski holds masters level qualifications in theology, and in that general context wrote an article in a periodical that addresses theological issues, Touchstone, in 1999, in which, having outlined the framework of the design inference Dr Dembski made the very reasonable onward theological comment that the discovery that key features of nature reflect intelligence is consistent with the Johannine claim.

    g –> Ms Forrest, unfortunately, sought to insist that this is the “definition” of ID; in a context where she could very easily have accessed the definition cited in this thread from 123 on, or near-equivalents. Here, let us cite this 2004 statement, as it also speaks to the latest wave of objections in the thread:

    Intelligent design is the science that studies signs of intelligence. Note that a sign is not the thing signified. Intelligent design does not try to get into the mind of the designer and figure out what a designer is thinking. Its focus is not a designer’s mind (the thing signified) but the artifact due to a designer’s mind (the sign). What a designer is thinking may be an interesting question, and one may be able to infer something about what a designer is thinking from the designed objects that a designer produces (provided the designer is being honest). But the designer’s thought processes lie outside the scope of intelligent design. As a scientific research program, intelligent design investigates the effects of intelligence and not intelligence as such. (William A. Dembski, “Chapter 1: Intelligent Design: What is intelligent design?” in The Design Revolution, pg. 33, The Design Revolution (InterVarsity Press, 2004)

    h –> In short, as already summarised, chance, necessity and intelligence as causal forces each leave characteristic signs that may be used to distinguish their influences. [And so we need not advert to mental states or the history of or possible alternative design and development pathways etc to infer to intelligent action using the explanatory filter.] The first such sign is presence/absence of high contingency. If there is high contingency, the dominant causal force is not a natrural regularity rtracing to mechanical necessity. Similarly, if the outcome in the context of sufficiently high contingency is a relatively rare functionally specified state – i.e. one which a chance process making a random walk from an arbitrary initial point in the config space would exhaust probabilistic resources before finding – it is better explained by intelligence than by chance.

    i –> Thus, we see that there was an easily accessible context that would have given a far more innocent and reasonable understanding to Dr Dembski’s remarks on John 1 in the 1999 Touchstone article. That is, the attempt to turn it into a pivotal argument against the scientific status of the inference to design is, sadly, yet another strawman soaked with ad hominem oil and ignited to cloud and poison the atmosphere. Ms Forrest – at minimum – should have known and should have done better, muchbetter.

    In sum, again, the attempt to plaster the inference to design with the notion that it is an improper attempt to inject “religion” into “science” fails.

    GEM of TKI

  393. The John 1 reference is in fact a well-known example of an atmosphere-poisoning distractor based on a professional philosopher acting as manipulative advocate by taking remarks out of context to make a rhetorical point

    You mean all this time it wasn’t Dr. Dembski, but Barbara Forrest, who said that “Intelligent design is just the Logos theology of John’s Gospel restated in the idiom of information theory”? Well, that was a dirty trick of the Darwinists to make it sound like Dr. Dembski said that. And to make it that much worse Judge Jones bought it hook, line, and sinker.

  394. to KF:

    I mentioned John 1:1 in the context of responding to Stephen’s question about whether ID was religious. Although I wasn’t clear about my reference, it had nothing to do with Dembski or Forrest.

    Rather I was thinking of the following two quotes:

    We will discover that “in the beginning was the Word” is fact not fantasy. It’s as true scientifically as it is spiritually or Biblically …

    (Phillip Johnson, Northshore Church in Washington, April 19, 2001)

    And in a speech called the Wedge Strategy, which I attended,

    The second goal [of the Wedge strategy] was to establish a position which would tend to unify the religious world. … In the beginning was the Word: in the beginning God created: – true or false.

    (Phillip Johnson, John Calvert’s IDnet DDD2 Conference, June 28, 2001)

  395. —–Jack Krebs: “Rather I was thinking of the following two quotes:

    We will discover that “in the beginning was the Word” is fact not fantasy. It’s as true scientifically as it is spiritually or Biblically …

    (Phillip Johnson, Northshore Church in Washington, April 19, 2001)”

    Johnson believes that science will confirm scripture, no more no less. In order for science to confirm Scripture, science must be different than Scripture. You are taking that phrase by Johnson to make it appear that ID religiously based, when, by definition, it cannot be religiously based and confirm religion at the same time.

    In effect, you are trying to discredit ID science by finding quotes that place science in a theological context. Once again, you are making the logical error of confusing motives with methods. Make no mistake, this is, indeed, an error in logic.

  396. kf-

    Having a few net access and offline challenges, so I must be brief as I stand here in a friend’s shop and borrow some net access.[my bold]

    That’ll be the day.

    So strong is this observation that the EF in EVERY case of relevance where we also happen to know the causal story, it judges “agency” accurately. That is, it is empirically very well supported, and it is easily falsifiable: bring forward just one solid counter-example.

    There are three rocks in my backyard that make a triangle.

    Law, chance, or agency?

  397. I’d sworn off this thread, and now here I am again. I need more self-control. :-)

    kf,

    So strong is this observation that the EF in EVERY case of relevance where we also happen to know the causal story, it judges “agency” accurately.

    First note that kf is here agreeing with me that the EF is about the “causal story” – that is, the history – of an object, and not just it’s current state.

    Second, kf’s statement is tautological and/or illogical. if we know “happen to know the causal story” and know that an intelligent agent was involved, then how would you apply the EF to that situation? The EF is supposed to detect design by eliminating law and chance: if you eliminate law and chance because you already know design was the cause, then what have you accomplished?

  398. stiabehbtetca
    ludclaecotfde
    rfiuqgerthonsi
    iyrjotskihal
    wohmwohnstaoh
    tspelpqmaxred
    esdivtorpuydav
    erlwai,xkcayj
    nizagayrtes
    aelp

    These are single-byte coded graphic characters. There are 256 possibilities per character. Each takes 8 bits to encode. There are 120 characters. So 960 bits.

    The Explanatory Filter

    EF example

    Node 1. No. 960 bits.

    Node 2. No. 960 bits.

    Node 3. You tell me.

    Knowledge of history of character string required in order to consider the specification (or lack thereof)? Nope.

    This explanation of information theory may help:

    http://www.cs.cmu.edu/~dst/Tutorials/Info-Theory/

    You might respond that my example did not involve biology. DNA carries information in a very computer-like way, and we can measure the genome’s capacity in informational bits via its quaternary code. The unit of information can be T, A, C or G so it takes 2 informational bits to represent it.

    The total capacity of a genome that is actually used is still not the same thing as the true information content when compression is taken into account (never mind epigenetic factors). Frame-shifted reading can allow two messages for the price of one (supposedly, you could even get three messages). The ENCODE results noted on UD a while back looked into this complex, interwoven system.

    Now one could argue that since we’re still figuring out how this complex system functions that calculations for biological information content are not accurate (they should be viewed as a minimum). But the point still remains that knowledge of a biological object and its corresponding code’s history or some hypothetical indirect pathway is not required to merely make these calculations.

    And of course there’s the issue of a designer trying to disguise a signal as noise (which I might have done in the above example). But that’s only a potential for the EF to produce a false negative, and an issue that’s been addressed many times over (so I won’t repeat those arguments yet again).

  399. Participants and onlookers:

    Sometimes, I am astonished by the tactics used by defenders of the Darwinst agenda. This rainy morning in Montserrat — we gotta have the wet part to get tot he emerald part of the “Emerald isle of the Caribbean” — is one of those times. Sigh.

    Let’s take a look at a few all-too-revealing comments:

    1] Congregate, 416: There are three rocks in my backyard that make a triangle. Law, chance, or agency?

    Evidently C does not realise that, apart from the case where three points are co-linear, they MUST spatially specify a triangle and thus a plane. And that natural regularity often used to make three-legged stools and tripods, is before we even get to contingency and complexity on the order of 500 – 1,000 bits of information storage capacity, much less functionality.

    In short, unfortunately, C has evidently not even paused long enough to try to understand what s/he is criticising. Sadly revealing.

    2] Mr Krebs, 417:

    [cites GEM:] . . . the EF in EVERY case of relevance where we also happen to know the causal story, it judges “agency” accurately.

    [K:] First note that kf is here agreeing with me that the EF is about the “causal story” – that is, the history – of an object, and not just it’s current state.

    Second, kf’s statement is tautological and/or illogical. if we know “happen to know the causal story” and know that an intelligent agent was involved, then how would you apply the EF to that situation? The EF is supposed to detect design by eliminating law and chance: if you eliminate law and chance because you already know design was the cause, then what have you accomplished?

    Here, Mr Krebs inadvertently – and, given his status as a science education curriculum developer for the state of Kansas — sadly reveals that he not only does not understand the EF, yet again, but that he also evidently does not understand the nature of scientific empirical testing – rthe point of repeatability and reliability of scientific findings. Let us take this step by step:

    a –> We have cases where since we do directly know the causal story – like for comments in this blog, we can look at the EF in action unde3r known circumstances; to see if it reliably gives a correct “intelligence” verdict.

    b –> For instance, cf. My remarks in 364 – 5 above, in which inter alia I analysed how the EF looks at one of JK’s paragraphs, which presumably is a known artifact of agency:

    m –> But, let us observe: letters are contingent, so not mere natural regularities tracing to mechanical necessity.
    n –> Further, sufficiently complex to be relevant to the EF: 292 characters inclusive of spaces, and including non-letter characters. So we are looking at, at minimum, 7-bit per letter ASCII code [128 characters . . .], or a config space of 128^292 ~ 2.02 *10^615, well beyond the UPB.
    o –> Within that space, relatively very few strings chosen at random will be SPECIFIED as “messages in English,” much less, such in the context of the discussion in this thread; as Denton long ago noted, it is empirically very hard indeed to generate 7 – letter words [avg. English lang word length] at random in text space, and that is before we get to grammar etc. [This point BTW is one reason why the old million monkeys typing Shakespeare by chance saw is so destructively misleading.] We therefore confidently and intuitively infer that the coded message was sent by an agent. Onward, contextual cues allow us to infer (with a far higher probability of error BTW) to the likely identity of the agent, one certain JK.

    c –> At the time, JK made no comment on this so perhaps he ignored it, att he cost of later revealing his ignorance.

    D –> but more tot he point, even if he were ignorant of such, the excerpt above is a demonstrrable piece of word-twisting to get a strawman to knock over. For, plainly one only refers to cases where one does know the causal story directly in the context of empirical testing, if the objective is per the inductive method of science we all learned in grade school, to infer to cases with reasonable confidence, where we do not so know the causal story directly.

    E –> the strawman attack deteriorates from there. For there is an EXCELLENT reason to test the Ef in known cases – to calibrate and test its reliability. And, observe, onlookers: JK cannot come up with a counter-instance so he tries to ridicule a basic application of the scientific method instead.

    That tells us a lot about the basic want of substance in JK’s case.

    3] JK, 414:

    here, he tries to use two quotes from non scientists on the wider worldview and culture conflict issues, to distract attention from the scientific issues att he heart of the discussion – and BTW neatly ducks the point I made on both Rom 1 and Jn 1, namely that Christian theology here puts major claims at empirical test, which are open to scientific challenge.

    Onlookers, observe, JK cannot – that is why he does not – show that design is not evident in the cosmos, but instead seeks to tag one side of the discourse by what is in certain quarters likely to be viewed with hostility. In short he dodges addressing the merits on the scientific question to hasten on to clouding and poisoning the atmosphere. No prizes for guessing why.

    That is telling, sadly telling.

    4] The quotes:

    JK cites Philip Johnson, a lawyer who has — for good reason — challenged the quality of the reasoning behind darwinism:

    We will discover that “in the beginning was the Word” is fact not fantasy. It’s as true scientifically as it is spiritually or Biblically …

    The second goal [of the Wedge strategy] was to establish a position which would tend to unify the religious world. … In the beginning was the Word: in the beginning God created: – true or false.

    In short, Mr Johnson accepts that John has opened the Christian faith to empirical test, and expresses confidence that SCIENTIFIC testing will vindicate the old Apostle. FYI Mr Krebs, willingness to subject one’s faith to empirical test – regardless of degree of confidence expressed that it will pass a fair test — is an epistemic VIRTUE, not a vice.

    In the second instance, the issue of truth is explicitly decisive and set in the context that laready we have seen a radical evolutionary materialist agtenda that – as YOU represent – has now sought to distort even the definition of science taught in school. So, the resentment at resistance to the radical agenda you represent smacks very much of “He hit BACK first.”

    So, while at this stage I doubt that I will persuade you or your ilk, onlookers can see your tactics exposed yet again.

    5] Poachy, 413: You mean all this time it wasn’t Dr. Dembski, but Barbara Forrest, who said that “Intelligent design is just the Logos theology of John’s Gospel restated in the idiom of information theory”? Well, that was a dirty trick of the Darwinists to make it sound like Dr. Dembski said that. And to make it that much worse Judge Jones bought it hook, line, and sinker.

    Of course, it is a handy quote to take out of context and indulge in some quote-mining with, isn’t it?

    Pity that the matters of context and substance had already been addressed but ignored by you in your haste to set up and knock over strawmen.

    As to Mr Jones, I have not the time here to dis-assemble his foolish and ill-informed ACLU-copycat ruling point by point, so I link to the appendix to my always linked that does a little bit of that. Let’s just say that the judge unfortunately swallows the line that evolutionary materialism has defined science for centuries and so has begged the question from the outset. In short, judge Jones is hardly a worthwhile authority to cite, and your citation of this judge as if he were credible is utterly and sadly revealing.

    ———————

    Onlookers, observe the obvious balance of the thread on the merits. Then, let us think about what it means for us to hand over control of the education of our children to men like this with agandas and rhetorical tactics as we have seen. It is time to do something serious about that – and if the systems are as resistant to real reform as they seem to be, it is time to expose the agendas, take our children out of such untrustworthy hands, defund the propaganda mills posing as education institutions, and build serious alternatives. Alternatives that we will plainly have to guard from attacks by the same radicals who now so arrogantly assume they have a right to distort science education and twist our children’s’ minds.

    GEM of TKI

  400. —–Jack Krebs: “First note that kf is here agreeing with me that the EF is about the “causal story” – that is, the history – of an object, and not just it’s current state.”

    Mr. Krebs, let’s take if from the top, once again. It is not necessary to know how an organism is formed to detect design. I need not know how an ancient hunter constructed his spear to infer design from the artifact. The filter looks for “indicators” not “history.” That means that the history of a thing is irrelevant to design detection. When 500 bits of coded information are present, that is an INDICATION that design is present.

    You must understand that Van Till is intruding his Darwinistic paradigm into Dembski’s ID paradigm in order to maintain his objection. For Van Till, the history of an organism matters, because he is thinking of (indeed cannot think of anything else) how the organism MUST have evolved via an evolutionary pathway). Thus he imports that bias into his analysis of the explanatory filter. I hope that helps.

  401. —–Poachy, 413: You mean all this time it wasn’t Dr. Dembski, but Barbara Forrest, who said that “Intelligent design is just the Logos theology of John’s Gospel restated in the idiom of information theory”? Well, that was a dirty trick of the Darwinists to make it sound like Dr. Dembski said that. And to make it that much worse Judge Jones bought it hook, line, and sinker.

    Dembski speaking as a theologian (he is one, you know) is qualified to speculate about the meaning of Scripture and its relationship to science.

    Dembski speaking as a mathematician and a scientist can design a scientific methodology for design independent of Scripture.

    That is why Sir Isaac Newton, could, on the one hand, say he was “thinking God’s thoughts after him,” and, on the other hand, look for natural explanations.

    It’s a little thing called context, a perspective that is beyond Barbara Forrest’s comprehension. Let us hope that it is not beyond yours.

  402. It’s a little thing called context, a perspective that is beyond Barbara Forrest’s comprehension. Let us hope that it is not beyond yours.

    You know, if you and Kairos want to hurl insults at Darwinists all day long, I don’t really care. But, I do not appreciate you pulling that tone with me just because I asked an honest question.

  403. kf-
    So the user of the EF needs to know more information about the triangle of rocks in my back yard before he or she can determine whether they were placed in their current location via the action of law, chance or necessity?

    Perhaps some information about the causal history might help it out?

  404. to kf: I am not a materialist, and don’t have a materialist agenda. I, like many non-materialists (theists and non-theists) accept the definition of science offered in the Kansas science standards and accept evolutionary theory.

    You offend me by presuming to know what my religious beliefs are based on your own prejudices that anyone who does not share your support of ID can’t possible have religious beliefs.

  405. Very good, congregate!

  406. StephenB #420:

    It is not necessary to know how an organism is formed to detect design. I need not know how an ancient hunter constructed his spear to infer design from the artifact. The filter looks for “indicators” not “history.” That means that the history of a thing is irrelevant to design detection.

    Then of what use is “design detection”? Is not the whole point of evolutionary science to understand the history of life?

    On the Origin of Species

  407. kf-
    So the user of the EF needs to know more information about the triangle of rocks in my back yard before he or she can determine whether they were placed in their current location via the action of law, chance or necessity?

    Perhaps some information about the causal history might help it out?

    Congregate, you missed KF’s response (or ignored it). In this case, we could not conclude design from just three rocks in a “triangle”, even if they were put there by design, since any three rocks will form a triangle and define a plane.

    The EF is conservative in that way, which should raise our confidence in it.

  408. Atom’s point is correct.

  409. OK, Atom, kf in 408 said-

    the EF in EVERY case of relevance where we also happen to know the causal story, it judges “agency” accurately. That is, it is empirically very well supported, and it is easily falsifiable: bring forward just one solid counter-example. (Guess why, after over 400 comments, none has been put . . .)

    [emphasis in original]

    If you don’t think the EF judges agency accurately in EVERY case, I agree with you. Sadly revealing.

    How about if the rocks make a right triangle? I measured the distances between them with a wooden yardstick, marked in 1/8 inch increments. Is the probability of their alignment above the universal probability bound now?

    How is the specified complexity or probability of that measured?

    Is a 90-45-45 triangle more or less specified than a 90-50-40 triangle?

    I guess I’m mixing up two points now. The first is that the explanatory filter gives different answers depending on how much you know about the phenomenon you are seeking to explain. The second is that accurately determining the probability of a phenomenon’s arising by law or chance is a little more complex than most implementations of the EF acknowledge.

  410. —–poachy: “You know, if you and Kairos want to hurl insults at Darwinists all day long, I don’t really care. But, I do not appreciate you pulling that tone with me just because I asked an honest question.”

    I aasumed that you had heard the objection and the answer to it many times. If I was wrong, and this was the first time, I will apologize profusely. So, is this the first time you have learned that Barbara Forrest took Dembski out of context in a dishonest attempt to discret ID? All you have to do is provide a one word answer (Yes) and you will receive my immediate apology.

  411. If you don’t think the EF judges agency accurately in EVERY case, I agree with you. Sadly revealing.

    False negatives have been addressed many times over. They are a valid minor issue with formalized design detection. But we’re really only concerned if there is a false positive.

    Just because something doesn’t meet the criteria for a positive design inference, it doesn’t follow that it wasn’t designed. Some things that are designed may simply fail to meet the very strict criteria for making a positive inference. The reason for such strict standards is to eliminate false positives. So if we pick up a rock and try to make a design inference and cannot it doesn’t mean the rock wasn’t designed. It only means we can’t look at it and find any sure evidence that it was designed. It may very well still be designed.

    Design detection is not done in a void. Causal history is not the only thing you can look for. The composition of the rocks can be considered. Whether or not these 3 rocks are in a rock garden of thousands is another clue. Also, if a false negative is produced I don’t see why you could not user OTHER design detection methods. Investigate the causal history if you must. It’s probably far easier to ask the owner of the household whether a rock arrangement was designed than it is to run the calculations for the EF.

  412. congregate wrote:

    If you don’t think the EF judges agency accurately in EVERY case, I agree with you. Sadly revealing.

    I don’t think there is anything sad about it. What KF most likely meant (he can correct me if I’m wrong) is that by “judging ‘agency’ accurately” he meant has “not yet given a false positive.”

    It is well known, and has been since Dembski’s The Design Inference, that the EF is vulnerable to false negatives. That is not an issue; again, it shows us that the EF is not rigged in favor of detecting design, but rather, is conservative in its application.

  413. 413

    Congregate don’t jump to conclusions. Listen to Atom, he is one of the smartest bloggers here at Uncommon Descent.

  414. OK, so we’re all agreed that the explanatory filter is not reliable with regard to designed items. Sometimes it doesn’t recognize them.

    Tell me again why then we should assume that it is reliable with regard to non-designed items? (that is, it never mistakes them for designed).

    Under some circumstances the explanatory filter would say that the constellation of rocks in my backyard was designed. What inputs need to be put into the filter to reach that result?

    Does anybody here understand the filter well enough to give some examples of how to use it in this “concrete” situation? Where is the tipping point between maybe designed and definitely designed in the case of some rocks in a backyard? Where do the possibly false negatives end and the indubitably correct positives start?

  415. congregate wrote:

    Tell me again why then we should assume that it is reliable with regard to non-designed items? (that is, it never mistakes them for designed).

    It is relaibe in terms of both designed items as well as non-designed items: if by “reliable” you mean “is not likely to give a false positive.”

    The difference between false positives and negatives is this: an intelligent agent can design objects that do not display CSI, whereas an unintelligent cause cannot create objects that display CSI.

    In layman’s terms, I can purposely knock a bottle of ink onto paper and you wouldn’t be able to tell if the blotch was designed or not (modern art or an accident?). But knocking over a bottle of ink will never write a coherent paragraph – unintelligent forces cannot do what I can, but I can do what they can.

  416. Listen to Atom, he is one of the smartest bloggers here at Uncommon Descent.

    Thank you PannenbergOmega, but I can’t really claim that as there are tons of really smart commentors and contributors here on UD. I appreciate the vote of confidence, however. :)

  417. 417

    True, no disrepect to anyone intended.

    You’re welcome.

  418. Atom-
    I understand the difference between false positives and false negatives.

    The question is why do you assume that the EF doesn’t create one, when it obviously does create the other type of error?

    And I guess your response is that CSI is unmistakable. But the explanatory filter as shown above just says if the probability is too low, it must be designed, it doesn’t mention CSI, does it?

    If CSI is the key factor, where is the tipping point between CSI and not CSI in the rocks in my backyard? Is it impossible for three rocks to demonstrate CSI?

  419. —–Daniel King: “Then of what use is “design detection”? Is not the whole point of evolutionary science to understand the history of life?”

    To know that something is designed is to already know something of its history. Once one understands that an organism is the product of design and not chance, one is in a position to learn a great deal more about its history.

    In any case, you are conflating two questions as if they were one. Whether or not the explanatory filter will help mankind is distinct from the question of whether or not the filter is efficient at detecting design.

  420. For the rocks in the backyard I’ll assume a configuration space of 100×100 feet, which is quite a big backyard. You gave the smallest placement measurement as 1/8 inch. We’ll measure the orientation in whole degrees.

    100*100*12*8*360=345,600,000

    For 3 rocks.

    1/345,600,000 * 1/345,599,999 * 1/345,599,998 = 41278242457681920691200000

    Now in that configuration space there’s going to be many rock positions/orientations that form a triangle. I’m not going to bother calculating exactly how many, but increasing the size of the backyard would also only increase the size of the target. Even if there was only one target in that configuration space it’s still not anywhere near 10^150. Also, even if there were more rocks forming English words (which would dramatically decrease the size of the target in the configuration space) there would have to be a certain numbers of letters/words before it exceeds 10^150.

    But the explanatory filter as shown above just says if the probability is too low, it must be designed, it doesn’t mention CSI, does it?

    CSI = Complex Specified Information. The probability in the picture refers to the complexity. Node 3 is where the Specification comes into play.

  421. Congregate: This is the part of the conversation where you are supposed to say the following: “OK, now I understand that the history of the rock formation is irrelevant to the science of design detection. At this point, we can move on to discuss the patterns involved.” There is no reason for Atom and the others to jump through all kinds of hoops explaining the significance of the patterns if, in the end, you intend to frustrate their efforts by revisiting the history question.

  422. Thank you Patrick for a concrete answer. Your math isn’t quite correct; it should be 1/412782 . . . etc., right? But I see very clearly where you got your answer.

    I wish my backyard were that big, but we’re working with approximations here, so 100×100 is fine. So if I use a laser measuring device and determine the placement of the rocks within .01 of an inch, and find that they still form a right triangle, the probability is even lower, but probably not at the UPB yet.

    What if the rocks have my initials on them, and, looking out from the living room window, and going from left to right, they are in the order of my names?

  423. your math isn’t quite correct; it should be 1/412782 . . . etc., right?

    That’s assuming there is only one target, as I already mentioned in my last post. There should be many positions/orientations that form triangles (the specification) which is sort of like ley lines where if you have enough samples in a configuration space there will be an increasing number of alignments.

    So if I use a laser measuring device and determine the placement of the rocks within .01 of an inch, and find that they still form a right triangle, the probability is even lower, but probably not at the UPB yet.

    I knew you might make that objection, as I already said, “increasing the size of the backyard would also only increase the size of the target.” You cannot arbitrarily increase the size of the backyard in order to game the EF.

    What if the rocks have my initials on them, and, looking out from the living room window, and going from left to right, they are in the order of my names?

    If there are only 3 rocks that’s 3! = 6 possible arrangements but that doesn’t make sense as a basis for calculating the complexity since we both “know” there should be a different level of representation. Honestly I would want to talk to a mathematician for that one.

  424. StephenB-
    I don’t understand that yet. I’m trying to narrow in a little on where and how design is detected.

    Patrick-
    Sorry, I missed the last paragraph of your last response the first time I looked. So is CSI interchangeable with low probability?

  425. So is CSI interchangeable with low probability?

    No, that’s why there is the Specification. Mere low probability is not enough. Otherwise we could look at ANY old object and say it was designed.

    Dembski is extending information theory. Shannon’s definition of information is quite general. Its value is proportional to the base 2 logarithm of the ratio between the total number of elements of a certain set and the number of elements chosen from that set. These elements can be symbols or whatever else. Thus per se information theory says nothing about the level of representation and gives us a lot of freedom.

    Now one could raise the accusation of “cherrypicking the specification”. For example, why can’t the Specification be an arbitrary atomic configuration and thus the EF is useless?

    In regards to calculations, unless there is information encoded into the atomic structure, which I doubt, it’s irrelevant. The level of representational abstraction, or the pre-specification, is entirely dependent on whether the lower physical layer modifies the calculations. For example, ASCII characters only have a probability space of 256 (8 bits). So my name, Patrick, is 56 informational bits whether the storage medium is RAM or a hard drive. But if my name were written on the wall with paint in the middle of a splash pattern the probability space is much higher, and thus the informational bits would likely exceed 500. The information itself–my name–is not changed at all by the storage medium but the probability, and thus the informational bits required to represent my name, can be greatly influenced.

    The reasons why the objection about atomic states is a real red herring can rigorously be shown to be so. The point is that the atoms really are totally irrelevant. Take the paint example. Suppose there are 10,000 drops of paint, each of area A (assume non-overlapping for convenience, though it would change nothing fundamental), on a wall of area 10,000,000A. To use informal Mathematica notation, there are roughly N = Binomial[10000000,10000] different possible configurations of paint on this wall (where Binomial is the binomial coefficient.) (This is assuming the paint is all the same color). Now a very tiny proportion of these, say M of them, will represent a pattern that would be considered “spelling your name” — in ANY script, on any position of the wall. If I understand aright (this might be wrong in detail, but it’s not crucial to my argument), this would represent an information content of I = -log(M/N), where log is base 2: I would be a reasonably large number.

    But what if we consider atomic states instead of “paint states”? The crucial thing is, atomic states are completely orthogonal to paint states. What I mean is, each “paint state” has precisely as many atomic states representing it as any other paint state. So consider the (very improbable) paint state where a square of 100×100 “pixel” area in the top left corner of the wall is filled in, and the rest is blank. This is a macroscopic description, dealing with “paint” and “wall” etc. If you examine all the vastly different atomic states (“microstates”) that would yield this macroscopic state (“macrostate”), it would be some phenomenally huge number, say L. But from the atoms’ perspective, there is nothing special about this state! EVERY possible state — all N of them — correspond to about L different atomic configurations (the variance would be very, very tiny). So if you want to work on the atomic level, there are NL different configurations, and ML of them correspond to your name, so the information is I = -log(ML / NL) = -log(M / N). So this changes nothing.

    The only time this WOULD change something is if, for some odd reason, the macrostates associated with spelling my name each had a higher average number of associated microstates (atomic configurations), in which case, such a configuration would indeed represent lower information than otherwise expected. However, this would be extremely odd, and would itself require a lot of explanation (why should the atoms prefer to spell my name than not?). In this example, of course, this would not happen, but even if it did, in my estimation it would merely push the question up a level to needing to examine why my name was a privileged macrostate.

    So moving between levels of representation only changes the analysis if the lower level for some reason privileges certain messages/states.

    Paradoxically, the best way to respond to the accusation of cherrypicking when choosing the level of representation is to give our debaters the right of choice of the model (and in turn the sets from which to choice).

    Back to biology. ID supporters haven’t specified the system. Darwinists have specified the system saying that organisms are made of cells containing four-bases-coded digital “firmware” (billions-bases-long genomes) and that random variation within this firmware, selected by natural selection, generated entire new organisms. Thus Darwinism itself has chosen the level of representation of the biological systems.

    Of course, by doing so Darwinists have shot themselves in the foot because, given the genome of an ancestor species A and the genome of a derived species B, one can calculate the Hamming distance between the two, the probability that random variation (whatever the mechanism) is able to “cover” this distance, and the functional information implied.

    In a sense indeed the discovery of DNA was the conclusive nail in the coffin of Darwinism because reduced the problem of origin of species to the problem of comparing strings of symbols. Strings of symbols are what it is easier to deal with, both for information theory and for intelligent design theory.

  426. Give me some time but I’m going to try and produce an example more relevant to biology. Might not happen soon since in general the work is more difficult and requires access to information which often costs $, which is probably why Dave generalized his calculations back at #172. If Bill has time I’ll run it by him. Heck, I hope I’ll have time for it myself, period.

  427. Patrick-
    Is that your final answer? You’ve changed your post at least twice since I composed my first reply. It makes it hard for others to follow the discussion.

    The notion that the size of the backyard and the quality of the measuring device matter are not an objection that I was raising, but since you mention it . . . Your calculation of the probability of my rocks included the size of the yard and the sensitivity of the measuring tool, didn’t it?

    Anyhoo. My point is that it is extraordinarily complicated to calculate the probability of any event in the real world. You’ve given it a valiant try in this simplified example. But I didn’t mention that I live at the bottom of a mountain, where rock slides are common. And my hobby is painting my initials on rocks and throwing them up on the mountainside. And there could be a thousand other complicating factors.
    If we are attempting to calculate the probability that a certain state of affairs (an arrangement of rocks in my backyard, or of nucleotides in a genome) would come to exist, don’t we need to know what the prior state of affairs was? If not the causal history, at least the factual history.

    Given the uncertainties involved, I think that the applications of the EF that purport to exclude the possibility of naturalistic evolution from ape to human, or land animal to whale are at the present wildly speculative. As a result, I believe that the explanatory filter as it is currently formulated does not provide any benefit over intuition in detecting design.

  428. patrick-
    We crossed in the mail. I worked way too long on my last response.

  429. congregate wrote:

    Anyhoo. My point is that it is extraordinarily complicated to calculate the probability of any event in the real world.

    (Sorry Patrick if I’m stepping on your toes…if you want to answer alone, let me know, and I’ll leave you to it).

    congregate, let’s say I show you 600 dice that are all snake eyes (the “1″ side up) and tell you it was the result of a random throw. I said I shook up the dice and let them fall, and they all fell snake eyes up.

    Could you calculate the probability of that happenening by chance (like I claimed)? Yes, it would be:

    1 / (6^600)

    It isn’t that hard to calculate probabilities if the number of possible states is known before hand and the number of “functional” states is also known. That is the point everyone is trying to make you see. In this case, there is only one functional state that matches “All 1 sides up”, so that makes our calculation easier. For more than one functional state that satisfies our constraint, see the KD Kalinsky paper just posted by idnet.com.au earlier.

    You also wrote:

    If we are attempting to calculate the probability that a certain state of affairs (an arrangement of rocks in my backyard, or of nucleotides in a genome) would come to exist, don’t we need to know what the prior state of affairs was?

    Nope, as in my example you didn’t have to know how the dice were positioned before I threw them or whether or not I threw them all at once, or took regular intervals, or threw them in groups, etc; all that mattered was the number of functional states in relation to the number of possible states and the likelihood of reaching a functional state by chance, as it were. This is where both complexity (low probability) and specification come into play.

    Ok, Patrick, I’ve added my two cents. Feel free to take over from here.

  430. Atom writes,

    congregate, let’s say I show you 600 dice that are all snake eyes (the “1? side up) and tell you it was the result of a random throw.

    But Atom, when you tell us that this was a “the result of a random throw” you are telling us abut its causal history. If you don’t tell us how the dice got that way, your probability calculation is not very relevant.

    As I have repeatedly said, calculating the probability based on the hypothesis of pure chance only tells us something about the case where pure chance is the cause. It doesn’t address the many cases where multiple steps, each a combination of law and chance, have operated.

    A simple example is the game of yahtze. The chances of throwing the same number on 5 dice in one throw is 6^4, or 1/1298. However, if you had a yahtzee playing machine that followed certain laws (always keep the number that occurs most often and when there are two choices pick one of the numbers at random to keep), then the probability of getting all 5 dice the same is quite a bit less. I tried figuring this out one time, but there were too many pathways to do this longhand.

    So if you see 5 dice all the same, you get different probabilities based on whether you think they were all thrown at once or whether you think they were the result of a round of yahtzee.

    And if you know nothing about the causal history, you have no way of telling which of these (or many other) hypotheses are relevant.

  431. Atom,

    I’m done for today. Although it should be noted that a lack of background details can dramatically change results. Musgrave purposefully withheld such information in order to rig his challenge (also, I answered the objection that we must know properties about the Designer(s)).

    So as evidence is uncovered things can change. That is why ID is open to being falsified by an unknown law or positive evidence showing that uniformly-working mechanisms can produce CSI via Indirect Pathways. But Darwinists lack that evidence as already discussed in detail.

    Jack,

    I don’t know why you keep trying to defend your misstatement. Atom already answered you: “in my example you didn’t have to know how the dice were positioned before I threw them or whether or not I threw them all at once, or took regular intervals, or threw them in groups, etc; all that mattered was the number of functional states in relation to the number of possible states and the likelihood of reaching a functional state by chance, as it were.” I already answered you with the simple example using my name. It doesn’t matter how a Genetic Algorithm might generate my name, the methodology involving the EF would still result in 56 informational bits. Thus we know via the EF that whatever pathway the GA might take my name can be produced by chance. Quit trying to insist that your strawman must be true, although I do realize that emotionally you “need” it to be true in order to justify your rejection of ID. I emailed Bill and asked him to doublecheck me and he verified what I said while also stating where he addressed your objection (albeit vaguely…I don’t even remember myself where in that part of the book he covered this topic). Unless you have positive evidence that indirect pathways can produce CSI why don’t you retire from this thread? Also, we KNOW that Darwinian mechanisms have operated in the causal history of biology. The real question is, to what extent. So far the only positive evidence says “very little” although as I noted in my recent conversation with MacNeill that the “evolving holistic synthesis” has the potential to change the situation.

  432. But Atom, when you tell us that this was a “the result of a random throw” you are telling us about its causal history

    Jack, in my story, I was lying about throwing them (which I thought would be clear to everyone), so you would no nothing about the causal history – you’d only know the story I made up, which doesn’t reflect reality.

    So the causal history would not have to be known to infer design in this case. We infer design (correctly) without knowing the true causal history.

    It is common sense from hundreds of years of empirical studies that there is no Law of Nature forcing dice to always land snake eyes up. So contingency is necessary for the pattern; This is where contingency comes in on the EF. Would you like to argue against contingency in biology?

    Atom

    PS It is the same way with plagarism; we don’t throw our hands up and say “We don’t know how this text came to be similar to a previous passage (causal history), therefore we cannot rule out natural forces.” No, we correctly conclude design without knowing the causal history, as the most likely explanation. Not logically proven, but empirically sound.

  433. Atom-
    I agree with Jack; my shorter answer is that the probability of 600 ones is indeed different depending on whether you started with 600 dice in your hand and rolled them all at once, or whether you had 599 ones on the table, and rolled the 600th die.

    You mention the likelihood of reaching a functional state. The likelihood of reaching something depends inevitably on where you start from. Am I likely to reach the beach at Hawaii by swimming? It matters whether I start from the deck of a cruise ship in the harbor or from LA!

  434. So as evidence is uncovered things can change. That is why ID is open to being falsified by an unknown law or positive evidence showing that uniformly-working mechanisms can produce CSI via Indirect Pathways. But Darwinists lack that evidence as already discussed in detail.

    Yup. For your Musgrave Example, you lacked the information regarding functional states, which is necessary (as it affects how “tight” the specification is) to know or at least reasonably estimate. You still got it though. :)

    It doesn’t matter how a Genetic Algorithm might generate my name, the methodology involving the EF would still result in 56 informational bits.

    Bingo.

  435. Allen_MacNeill: “Yes, but have you shown (using empirical tests), that we can show you that intelligent causes DID produce machines and codes?

    Whoa. Back up there. Are you implying that Darwinism can meet this sort of standard? I’d love to see the evidence of that. So far, all I’ve seen are inferences from similarity to macroevolution.

  436. I agree with Jack; my shorter answer is that the probability of 600 ones is indeed different depending on whether you started with 600 dice in your hand and rolled them all at once, or whether you had 599 ones on the table, and rolled the 600th die.

    So, please tell me what the probability is of:

    A) Rolling one die at a time for 600 dice and getting them all 1′s side up.

    b) Rolling them all at the same time.

    c) Rolling in groups of 10.

    If you can find a difference in the probabilities, please tell us. And I am serious, I’d like to see how the probabilities differ for these different causal histories…

    And before you try to get smart with my example, you are not allowed “re-rolls” – I am talking about the probability of rolling each dice once.

    Hope you don’t mind me merging the 2 comments. -P

    Atom

    PS As for “reached” it was just an expression: translate that as “hit” a functional state and your objection disappears.

  437. Atom-
    If you refuse a priori to consider certain causal histories (such as those where re-rolling is allowed) you may not be able to follow the evidence where it leads. Be careful, that way “Darwinism” lies.

    And whether a functional state is reached or hit, there must have been some prior state. Either the dice had been rolled with some result, or they were unrolled.

  438. Patrick, quoting Atom,

    “in my example you didn’t have to know how the dice were positioned before I threw them or whether or not I threw them all at once, or took regular intervals, or threw them in groups, etc; all that mattered was the number of functional states in relation to the number of possible states and the likelihood of reaching a functional state by chance, as it were.”

    Look, I teach stats and probability, so I’m not clueless. I know that it makes no difference how you throw your 100 dice, but you again limit your analysis to pure chance!

    I gave an example, using the dice game of Yahtzee, where a combination of law and chance produces a difference probability than pure chance, and pointed out that just by looking at the current state you can not conclude what the probability of that state existing is.

    Would either of you like to respond to that example?

    Patrick says,

    Unless you have positive evidence that indirect pathways can produce CSI why don’t you retire from this thread?

    Right now I am discussing the simple theory of the EF, using non-biological examples just as many others often do.

    I am primarily interesting in establishing that the idea of the EF has to include information about the causal history of the state involved, and that it is a mistake – a useless, irrelevant mistake in practice – to limit the discussion to the pure chance hypothesis.

    I’m still interested in discussing that, so I don’t think I want to retire right now.

    So a simple question: I see 5 6′s lying on the table. Is the probability of that 1/1296, or not? How do you know?

    Once again, given that the EF is based on probabilities, it seems obvious to me that it has to address the problem of computing probabilities. Even in simple introductory high school stats I teach some of the complexities of probability trees, and I show students that simple combinatorial calculations are just the starting point in calculating more complex situations.

  439. Patrick,

    Thanks for the merge, no problem at all.

    Jack and congregate,

    You can include all the empirical knowledge you want about known natural laws; you should. The EF is based on probabilities as well as contingency and specification. As I said before, in your examples you’re now saying “what if there was intelligent manipulation beforehand” (which the EF would pick up, btw, if it left sufficient CSI, as the EF did with my dice example) or “what if there is some natural law that caused it to be not the result of chance” (i.e. not contingent, which would cause our EF to reject it at the first node.)

    So, known natural laws are important. They play a role in the contingency node.

  440. So a simple question: I see 5 6’s lying on the table. Is the probability of that 1/1296, or not? How do you know?

    We know a little about dice. If they’re fair dice, we know that any side has a 1/6 chance of showing up on a roll. We can examine your dice and conclude that they are in fact fair.

    We also know that empirically over hundreds of years we have not found any laws of nature dictating that dice are more likely to land snake eyes up when thrown, either together or spearately. The moment we find such a law, we plug it into our probability forumla – but not a moment before that. (So no appeals to unknown, mystical, organizing principles in nature.)

    So, with those facts in hand, we can calculate the probability that unguided mechanisms (known natural laws plus chance) can come up with snake eyes on five thrown six-sided die:

    1 / (6^5) = 1/7776 chance

    Now this number is not enough to rule out chance, since the probability is not anywhere near approaching the UPB. So in this case we’d say: “Cannot infer design.” And we’d be done with it.

    But now let’s change it up and say that there is a law that we discover that makes snake eyes come up 50% of the time when a six-sided die is thrown. How would that affect our calculation?

    It would plug directly into our probability calculation:

    (1/2) ^ 5 = 1/32 chance

    So we’d take this new empirical knowledge into consideration. We still don’t conclude design, but especially now, since the probability is even greater that unguided mechanisms (known natural laws plus chance) can give us such a result.

  441. Atom-

    I hope I’m not stepping on Jack’s toes, but you are still assuming that the causal history of the situation is that all six dice were thrown in one roll, and the result determined by chance. Another causal history would result in a different probability.

    As Jack posited this example, an adjusted set of the “rules of Yahtzee” are standing in for “laws of nature”. In that scenario, random chance determines how the first roll of the dice goes. After that the rules interact with chance. If two ones are rolled, those are retained, and only the other three dice are rolled. If another one is rolled from among those three, it is retained for the next roll, and so on.

  442. congregate,

    If Jack’s “Rules of Yahtzee” supplement our set of natural laws, then we can treat them as another natural law. And again, this would affect the contingency of the situation and the probability calculation. Too much “guidance” by the new rules, and there is no contingency, which means no design inference. Just a little bit, and it changes our empirical probability calculation.

    So yes, the known natural laws do affect our calculations. These “Yahtzee Rules” act as new known natural laws. So once the laws are known, they play into the probability calculation.

    There is a difference between rules & current configuration of the game (analagous to our known natural laws and functional search space) and the history of the game (your and Jack’s Causal History). One affects the probabilities of the what will happen next, the other has no bearing whatsoever on it. It doesn’t matter if I landed 20 snake eyes in a row, the probability of me throwing a snake eye on my next throw is still 1/6. Perhaps this is where you and Jack are becoming confused?

  443. To sum up for the day,

    congregate wrote:

    …but you are still assuming that the causal history of the situation is that all six dice were thrown in one roll, and the result determined by chance. Another causal history would result in a different probability.

    [A]n adjusted set of the “rules of Yahtzee” are standing in for “laws of nature”. In that scenario, random chance determines how the first roll of the dice goes. After that the rules interact with chance. If two ones are rolled, those are retained, and only the other three dice are rolled. If another one is rolled from among those three, it is retained for the next roll, and so on.

    First off, I am not assuming anything about the causal history of how the dice got to be that way; I am simply calculating what the probability of unguided mechanisms (law, chance and their interaction) hitting a functional configuration. Again, our knowledge of the known laws plugs into this formula.

    Using this information, I can then possibly make a tentative inference to design, if my assumptions hold. If they do not hold (for example, maybe I missed a law that aligns dice when thrown) then my inference will be overturned. But the mere possibility of such a future discovery cannot be used as current evidence against my inference.

    So you are free to claim that our assumptions do not hold (we are missing a relevant natural law, the search space has more functional configurations than we’re estimating, the search space is smaller than assumed, etc), but simply stating that this tentative nature of the EF is somehow grounds to dismiss it is illogical. All empirical science is tentative.

    As for the causal history, we sometimes don’t know it. When we do, we can test the validity of the EF. When we don’t, we can use the EF to give us insight to whether or not that history required Intelligence for a given set of data. In my first example, Jack admitted he didn’t know it (since he guessed the wrong history accidentally) but was still able to conclude design. So notice, the causal history of an object/event does not affect the probability of such an event coming about by unguided mechanisms. We can estimate that based soley on the known laws of nature plus our knowledge of the search space / configuration space.

    Get this point, as it is vital: the probability of throwing a die and getting a snake eye is independent of whether or not I actually placed a die on the table in a snake eye position. I did not leave it to chance in the latter case; but that does not affect in any way what the chance probabilities are of it occurring naturally.

    If my actions are taken as a part of nature, then you’d have to include it in your probability calculation. But not until you know about my actions and their effects. (Again, no appeals to magical unknown principles.)

    Hopefully that clarifies everything for you guys. If not, please let me know what is still an issue.

  444. So you are saying that if we don’t know how something has come about, we are justified in assuming that it was by pure chance, and therefore if it contains over a certain number of component parts leading to a simple combinatorial probability greater than 2^500, the default explanation is design?

    And I am absolutely not confused about the fact that a prior state does not affect the next occureance of an independent chance event: the fact that ten heads in a row doesn’t influence the probability of the next coin toss is taught in about day two of my course.

  445. Jack Krebs wrote:

    So you are saying that if we don’t know how something has come about, we are justified in assuming that it was by pure chance

    This is not what I am saying. We do not assume anything about how it came about; this is what we are investigating. What we do estimate objectively is the probability that it could come about by chance given the known laws of nature plus chance.

    and therefore if it contains over a certain number of component parts leading to a simple combinatorial probability greater than 2^500, the default explanation is design?

    If we estimate that given what we know about the operating ordering principles in nature, chance, and the configuration space, that natural law plus chance was unlikely (to the UPB) to produce such an effect, then something other than unguided mechanisms was most likely responsible. If I see the Candlabra in Peru, I don’t have to know anything about the causal history of how it actually got there (we don’t know, btw) to empirically calculate what the probability is that unguided mechanisms could form such a pattern by chance. (It is a little tricky with sand, but not impossible if we approximate. Forgive my choice of analogy, Peru is just dear to my heart.)

  446. OK, let’s try this.

    I have a large table with a sheet metal top and on it are 1000 dice scattered more or less uniformly about the table top, with a random distribution of sides showing (approximately 166 1′s, 166 2′s, etc.)

    A machine under the table top vibrates it in various places and in various amounts of intensities more or less randomly so that every five minutes all parts of the table are jiggled hard enough to toss all the dice at least once.

    Also, each of the dice has a small magnet embedded under the surface of the 1, and the magnet is just strong enough that if the die lands on with the 1 down (and thus a 6 up), the die will stick and stay stuck unless a particularly large vibration coupled by being hit by another die dislodges it.

    Suppose also that I know that these are the basic facts, but I don’t know exactly what all the parameters are – how hard the table jiggles, how often a stuck die gets unstuck, and so on.

    Now then I turn on the table and let it start to run for 2o hours, after which time it turns itself off. I also leave the door unlocked so the table is unsupervised and someone could come in unseen while I am gone.

    I return in a day and find that 800 of the 1000 die are 6′s.

    Was this designed, or did it happen naturally according to the combination of laws and chance operating in this situation?

    How could you tell? What research and what calculations would you have to do to apply the EF to this situation?

  447. Atom at 463:

    There is a difference between rules & current configuration of the game (analagous to our known natural laws and functional search space) and the history of the game (your and Jack’s Causal History). One affects the probabilities of the what will happen next, the other has no bearing whatsoever on it. It doesn’t matter if I landed 20 snake eyes in a row, the probability of me throwing a snake eye on my next throw is still 1/6.

    The history and the rules of the game are not separable. In the adjusted yahtzee example, the preceding rolls of the dice affect the number of dice rolled on the next turn. In chess the moves that are available are determined by where pieces have been left after previous moves.

    Well, I think my original point in this meandering discussion was that the EF is currently no improvement over intuition, and that given the difficulty of making probability calculations in the biological context, I doubt it will ever be useful. I also doubt we’ve convinced each other of much.

    Good night all.

  448. Was this designed, or did it happen naturally according to the combination of laws and chance operating in this situation?

    First, we’d have to observe the “natural laws” in this case, what patterns the table creates when run for long periods. (This would be analagous to our observations of the laws of nature.)

    If we find that even with your magnets and jiggles that the dice behave normally and are usually regularly distributed, but turn up 80 percent 6′s up, we could calculate how many different configurations give us that “80% 6′s up pattern” and if the specification is tight enough and improbability great enough, with the contingency already established by our previous observations, we could then possibly infer design.

    So your adding a new known law of “nature” (notice I keep bolding known, because it is important you finally get the import of that) implies that we know how the law affects the system and how the probabilities are affected by it. This is where empirical observation comes in.

    Again, I fail to see your point; contingency (or lack thereof) is already taken into account in the EF. If you want to come up with an example where you say “See, you can’t tell me if it was designed or not” be my guest; that would only prove that (again) the filter is vulnerable to false negatives.

    Good night everyone.

  449. Participants (and onlookers)

    Right now, Mr Krebs, I vex. And for good reasons, as you waste a lot of our time and energy over these past few days.

    Onlookers, let me explain.

    Let us begin with a telling citation from Mr Jack Krebs, at 459; in light of a point I called his attention to all the way back at 123 – 4:

    Look, I teach stats and probability, so I’m not clueless

    So, could you kindly explain your silence ever since 123 – 4 on:

    . . . c –> Further to this, I observe that statistics is a major tool used in observational and experimental studies in science, and that in hypothesis testing, it in fact articulates several tools that are precisely useful for distinguishing [I] chance, [II] law-like natural regularities and [III] design/intent/agent action as possible causal factors, in the context of situationally plausible alternative hypotheses.

    d –> Indeed, these tools are commonly used in the design of experiments, e.g. the use of control cases and various treatments, leading to ANOVA to analyse the impact of various factors to appropriate levels of confidence. So it is simply falsehood backed up by slanderous allusion, to say that “science currently has no tools to test explanations using non-natural (such as supernatural) causes.”
    e –> For: [a] non-natural has a very relevant meaning, i.e “[intentional, intelligent] agent,” and [b] all of this is in the unacknowledged context of the too often INTENTIONAL misrepresentation of Intelligent Design as being about claimed scientific inference to the supernatural, where [c] in fact ID and a lot of pure and applied science works in a context where agent-cause is a relevant consideration and methods have been developed for addressing agent action – which is in this context a very relevant meaning of “non-natural.”

    f –> I say “too often intentional,” as: if you and others of your ilk don’t know the basic context of the design inference across chance law-like regularity tracing to mechanical necessity and design, that is because of willful refusal to do basic homework on the nature and context of design theory. Sorry if that sounds harsh, but it is time to call you and your ilk to basic intellectual duty.

    Now, 300 or so posts later, JK admits to being a stats teacher. So, in plain words, his silence was because he did not want to acknowledge the plain, known/knowable, decisive truth. That is, the whole length of the thread since, and all the belaboured objections we have subsequently seen, are little more than red herring distractions from the core falsehood in the Kansas attempted re-definition of science, in the interests of serving evolutionary materialism disguised as science, and the twisting of education into indoctrination through that agenda.

    This is sad.

    I therefore find it far less than amusing this morning to see the amount of sledgehammer used overnight to belabour a peanut!

    So, I first pause to bring our attention back to a key, and in fact very simple to understand point I made. Namely, that in every case where the EF has been applied and we independently know the causal story, the EF correctly rules “agency.” (Note, this simply says that we have a track record where we can directly cross-check and calibrate, and the EF works as intended. In particular, whether it might not rule design in cases of insufficient complexity is irrelevant – it has not ruled intelligence; and, it is not intended to serve as a general test for design, only as a highly reliable criterion for certain cases.)

    A few remarks on context are in order:

    a –> Onlookers, first note: objectors are unable to cite a valid counter-instance — dice loaded tables and Yahtzee rules etc notwithstanding. For instance observe the silence on the concrete case of a paragraph by JK which led me to calculate the config space and remark on the rarity of functional states in it. DNA is a similar digital text string, and functional states in such strings of the sort of lengths in living systems are most assuredly exceedingly rare [just think of the impact of how easily we get to a stop codon in the code, as well as the known vulnerability to perturbation]. In short, their silence on the material point is telling: once we can use the filter, and it rules agency in a situation where we cross-check through direct knowledge of the history of an entity, it is accurate. On applying to a directly comparable casw where we do not know the full causal story directly, it points strongly on induction to design. Is there good evidence from OOL studies and that of origin of body plan level biodiversity to show that we should infer a false positive? Not at all, absent question-begging. [For details cf my always linked.]

    b –> Do the objectors now acknowledge that key point? Not at all – they simply rush on to the handiest next objection (often on an irrelevancy) as if they have not seen a very important — and scientific — principle at work. This alone, tells us much on motivation and attitude that lies behind such resort to unresponsive objectionism.

    c –> As to the “history” objection, let us underscore again: we have long known that chance, necessity and intelligence are causal factors that may or may not obtain in any given situation, and that they may be involved in different degrees or aspects of it. But also, we know that necessity leads to natural regularities that may be observed. So, once we see that high contingency is involved, we know that necessity is not the dominating causal factor. This does not require knowledge of the history of a specific entity, it only requires observation of degree of contingency.

    d –> And, in the case of DNA, we have known since 1953 or so, that we are dealing with a digital code-bearing molecular information string. For decades, we have known that that string ranges from about 300 – 500 000 base pairs up to 3 billions or so. 4^300 000 gives a mind-boggling config space, in excess of 10^180,000 cells.

    e –> Further to this, bio-functionality is identifiable and specific. That in a context where – to cite just a common-sense undeniable instance — all the headlines for decades on genetically linked diseases [including cancers] tell us just how specific. So, we have little reason to conclude that the degree of complexity and specificity we observe are the likely result of random walks from arbitrary initial configs of molecules in prebiotic soups of any even very generous composition. THAT is why evolutionary materialism-inspired OOL research is in open despair. DESIGN EASILY ACCOUNTS FOR SUCH FSCI.

    f –> Similarly, ever since the days of Darwin, the Cambrian life revolution has stood as an unexplained example of the sudden emergence and stasis that DOMINATE the fossil record. And, there is similarly no empirically validated mechanism for such body plan level biodiversification. Just extrapolations from micro-evolution as if there were no probabilistic hurdles! AGAIN, DESIGN EASILY ACCOUNTS FOR WHAT IS OBSERVED.

    g –> When it comes to the chimp-man story which is where this thread began, what do we observe? Just-so stories that do not add up and cannot answer to basic questions like explaining the difference between our fully opposable thumbs and those of the ape family, or our full verbal language ability, and worse.

    h –> So, what do we see on the part of science educators? Suppression of material facts, question-begging, imposition of unjustified question-begging re-definitions of science and refusal to even expose children in school to the simple fact that darwinist theories have always been controversial and evidence-challenged. What does that tell us about what is going on?

    Patrick et al, pardon the bluntness of my conclusion: DECEPTION, not education.

    Indeed (and further pardon my disgust with what is now all too plain, moderators), it reminds me of a very telling classical remark by an often unacknowledged founding figure of our civilisation:

    Rom 1:19 . . . what may be known about God is plain to them, because God has made it plain to them. 20 For since the creation of the world God’s invisible qualities–his eternal power and divine nature–have been clearly seen, being understood from what has been made, so that men are without excuse.

    RO 1:21 For although they knew God, they neither glorified him as God nor gave thanks to him, but their thinking became futile and their foolish hearts were darkened. 22 Although they claimed to be wise, they became fools 23 and exchanged the glory of the immortal God for images made to look like mortal man and birds and animals and reptiles [yesteryear, in temples, today, often in museums, magazines, textbooks and on TV] . . . .

    RO 1:28 . . . since they did not think it worthwhile to retain the knowledge of God, he gave them over to a depraved mind, to do what ought not to be done. 29 They have become filled with every kind of wickedness, evil, greed and depravity. They are full of envy, murder, strife, deceit and malice. They are gossips, 30 slanderers, God-haters, insolent, arrogant and boastful; they invent ways of doing evil; they disobey their parents; 31 they are senseless, faithless, heartless, ruthless.

    I vex, for good reason!

    Cho, man, do betta dan dat!

    GEM of TKI

  450. 450

    To StephenB:
    I posted a response to your #440 at about 5 PM on 03/24, but it has not appeared, so I am trying again.
    (Thanks for noticing me in the midst of all this crosstalk!)

    —–Daniel King: “Then of what use is “design detection”? Is not the whole point of evolutionary science to understand the history of life?”
    To know that something is designed is to already know something of its history. Once one understands that an organism is the product of design and not chance, one is in a position to learn a great deal more about its history.

    What have you learned so far (or what do you expect to learn in the future) about the history of any organism (or organ, such as a flagellum) from a design inference?

    In any case, you are conflating two questions as if they were one. Whether or not the explanatory filter will help mankind is distinct from the question of whether or not the filter is efficient at detecting design.

    Not conflating. You have restated my question. It’s one question: is a design inference of value to evolutionary biologists? If so, how?
    If not, to whom is it of scientific value?

  451. kf writes,

    Right now, Mr Krebs, I vex. And for good reasons, as you waste a lot of our time and energy over these past few days.

    You don’t have to pay any attention to me, much less respond. You’re responsible for what you chose to spend time and energy on – if you feel it’s wasted time, then you should examine your own behavior and priorities. Don’t blame me for what you chose to do.

  452. So there’s a law in nature that reduces the infinite improbability of abiogenesis to more manageable levels. Great! Now all we have to do is demonstrate the existence of this law in the lab, and then we can start calling Darwinism “science.”

    (Glug, glug…)

  453. Jack Krebs:

    Excuse me for my intrusion, but I believe that it is perfectly natural, and correct, to blame someone who, in a reciprocal discussion on an open blog, behaves unfairly and profits of the sincerity and good faith of his interlocutor.

    Your “Don’t blame me for what you chose to do.” is just the last (I hope) expression of your wrong attitude, arrogance and unfairness. And, from now on, everybody who agrees on that can feel justified in not giving any consideration to your messages. By by.

    (By the way, I definitely chose to post this mesage for you, and I will certainly not blame you for that.)

  454. PS to 470:

    A few follow-up, corrective notes on points:

    1] Poachy, 422: if you and Kairos want to hurl insults at Darwinists all day long

    Poachy, instead of accusing SB and I of hurling insults, why not show that we are wrong on the merits, for that has been the focus of what we have to say.

    2] Congregate, 423: the user of the EF needs to know more information about the triangle of rocks in my back yard before he or she can determine whether they were placed in their current location via the action of law, chance or necessity?

    I long since showed that the pattern in a triangle is constrained by natural regularities, and has not got in it sufficient complexity [nowhere near 500 – 1 000 bits of information storage capacity] to be relevant to the EF. Your attention was drawn to this, but it seems you have again either ignored or overlooked, save for the implication of speaking to having your initials inscribed therein and being in such an order as to thereupon spell out these initials in order. In short, you do know what having sufficient information looks like. Just, it does not fit where you evidently want to go rhetorically..

    Why not address the cases which were cited as being actually relevant to the EF, e.g. as again in 470?

    3] JK, 424: You offend me by presuming to know what my religious beliefs are based on your own prejudices that anyone who does not share your support of ID can’t possible have religious beliefs.

    Now, as to your taking offence, pardon a few direct words. For, given the tactics you have used across years, and the people you have harmed thereby — as I have for instance summarised at 470 and elsewhere, you are hardly in a position to claim to be the seriously harmed party. JK, instead of taking offence at what is not 1% of what you have done to others, you need to do some serious soul-searching and then get up to help undo the harm you have done.

    Now, as touching the substance: where have I claimed to know your religious beliefs, instead of – since 123 – 4, addressing the worldview-level AGENDA behind the question-begging attempted redefinition of science which you have advocated for, and have in so doing exhibited not only dubious rhetorical tactics but also a plain want of knowledge of how science works? [In short, onlookers, this is yet another ad hominem-laced strawman.]

    FYI, I am very aware that people are often logically incoherent, especially at worldviews level. Indeed, one of the key comparative difficulties tests for worldviews is precisely, coherence. Similarly, factual adequacy is a key test and in that context I have repeatedly held up claims you have made to empirical tests. Your arguments — as the thread above has repeatedly shown — have failed both the tests of coherence and empirical adequacy.

    So, were I you, I would seriously rethink my positions and policies, for instance:

    4] I, like many non-materialists (theists and non-theists) accept the definition of science offered in the Kansas science standards and accept evolutionary theory.

    Onlookers, again, the relevant standard circa 2007 in relevant part [cf 123 – 4] reads:

    Science is a human activity of systematically seeking natural explanations for what we observe in the world around us. . . . Scientific explanations must be testable and repeatable, and findings must be confirmed through additional observation and experimentation. As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes.

    Here, again, is the still-standing rebuttal from 123 – 4:

    a –> Since there is a clear context in which “natural” in effect in context means evolutionary materialist [i.e. “the best materialistic explanation of the cosmos from hydrogen to humans”], the second excerpt clearly and improperly begs a lot of big questions. [I now add: In short, “natural explanations” imposes a question-begging, historically and philosophically unwarranted criterion; the definition of science being a project at he intersection of history and phil] . . . .

    c –> Further to this, I observe that statistics is a major tool used in observational and experimental studies in science, and that in hypothesis testing, it in fact articulates several tools that are precisely useful for distinguishing [I] chance, [II] law-like natural regularities and [III] design/intent/agent action as possible causal factors, in the context of situationally plausible alternative hypotheses.
    d –> Indeed, these tools are commonly used in the design of experiments, e.g. the use of control cases and various treatments, leading to ANOVA to analyse the impact of various factors to appropriate levels of confidence. So it is simply falsehood backed up by slanderous allusion, to say that “science currently has no tools to test explanations using non-natural (such as supernatural) causes.”
    e –> For: [a] non-natural has a very relevant meaning, i.e “[intentional, intelligent] agent,” and [b] all of this is in the unacknowledged context of the too often INTENTIONAL misrepresentation of Intelligent Design as being about claimed scientific inference to the supernatural, where [c] in fact ID and a lot of pure and applied science works in a context where agent-cause is a relevant consideration and methods have been developed for addressing agent action – which is in this context a very relevant meaning of “non-natural.”

    5] DK, 426: Is not the whole point of evolutionary science to understand the history of life?

    When we reasonably and reliably may infer to design as a key causal input to the history of life, it significantly constrains the sort of stories that may credibly be used to account for it.

    6] LS, 427: It is entirely possible that he has applied the Explanatory Filter to your numerous posts here and, your protestations to the contrary, has arrived at the inescapable conclusion (with a confidence within the UPB) that you do indeed have religious beliefs and they are wholly consonant with the tenets of First Reformed Church of Darwinism, Wichita Conference.

    FYI Leo, you are again beating up on a strawman. FYFI, all men have first plausibles in their world views, thus the functional equivalent of key religious beliefs. FYSYFI, not all sets of these beliefs are coherent or empirically adequate, and indeed, many people hold partly overlapping and internally inconsistent sets of beliefs drawn from even opposed systems of belief.

    That is the context in which I have not tried to address Mr Krebs’ theological core commitments, but have instead pointed out the underlying worldview commitments in the agenda he has served and publicly advocated for at education policy level for years. In particular, the definition of “science” he advocates is an evolutionary materialistic one, period. As I have repeatedly shown.

    In so advocating, he has sought to redefine science away from what it has historically and in light of phil of sci best praxis, been understood to be. That this is so is easily seen form the fact that he can only cite what current agenda-riddled institutions advocate,a nd has for over 300 posts been unable to engage the matter on the merits.

    Don’t let the usual ad honinem oil-soaked strawmen blazing and smoking away distract you.

    7] C, 439: why do you assume that the EF doesn’t create one [a false positive], when it obviously does create the other type of error [a false negative]?

    First, science is about defeatable, empirically anchored reasoning. That the EF can be empirically tested and possibly refuted is simply a sign that it is scientific.

    So, the objection that possibly there may be a false positive does not affect its status relative to other scientific inferences. Maybe, there will be a violation of the 2nd law of thermodynamics. But, that does not mean that you should put your money into a perpetual motion machine that claims to successfully violate it. For, on many empirical tests, 2 LOT has shown itself EMPIRICALLY RELIABLE. (Onlookers, observe how we have yet to see a valid counter-example.)

    And, that is the exact point on the tests applied to EF on cases where we do know the causal story directly is: it is reliable – as per its design, it is highly resistant to false positives. No surprise, given a criterion of probability beyond 1 in 10^150. False negatives, we cheerfully accept, as it is not the be all and end all of design detection, and because of the significance of the key cases where it does rule design.

    8] Patrick, 441: on rocks in back yards

    If the rocks were spelling out a word in English, in roman letters, say, then that moves us to a different config space.

    That is, we are looking at scattered vs clumped at random vs functionally clumped states [rocks laid out as pixels making up an English word spelled with Roman letters, e.g. “Patrick”], and the issue of configuration involving spatially oriented elements becomes a far more exacting constraint. For, the [low] functionality in a triangle is vastly different from that in a spelled out message in a defined set of letters and language, where rocks play the role of pixels.

    GEM of TKI

    PPS: Thank you, GP.

  455. 455

    Kairosfocus, I guess I’m a little thick. How is what you wrote a ‘rebuttal’ of the science standards? I just don’t see that. The standards simply say, if you want to explain something in scientific terms, this is how you do it. It doesn’t say there are no other explanations or that natural things are the only things there are.

  456. PPPS:

    JK,

    Your non-responsiveness to 470 on the substance is equivalent to implying that you are guilty as charged — and as inadvertently self-exposed; but you care not one whit for the harm you have done to others, since at least 2005. Sad, but telling.

    Onlookers:

    THIS is what we are up against in the science and education establishments.

    We must act to rescue such valuable institutions — and especially our children now, and with a grim resolve that is based on understanding the sort of unreasonable, high-handed and uncaring, agenda-driven, truth-suppressing, manipulative and willfully misleading people we are dealing with.

    Such in the end — absent a Damascus Road experience — will only grudgingly yield to being repeatedly and predictably exposed, refuted, and defeated in their agendas, then removed from positions of trust and power that they have abused. Sadly, half-measures and compromises, they will view as signs of weakness, and will turn into opportunities for further abuse.

    In short, we have a real culture war on our hands.

    GEM of TKI

  457. LNF:

    Why don’t you simply read 123 – 4 and respond on the merits?

    [You might also want to read this, to see a bit of an idea of the background questions, issues and facts that are being manipulatively begged by JK and ilk.]

    GEM of TKI

  458. larrynormanfan,

    The major issue I have is that it comes down to asserting that a currently popular philosophy of science IS Science itself. I think that public school standards should attempt to be as neutral as possible in regard to these various philosophies. Many people are not even aware that there are many schools of thought (btw, Bill apparently likes Pragmatic Naturalism). Also, I’m not saying that any particular philosophy of science is right or wrong (they all have merits depending on the nature of reality). In fact, my preference would be that schools briefly outline the various philosophies in addition to a neutral definition like this one:

    science: a branch of knowledge conducted on objective principles involving the systematized observation of and experiment with phenomena

    After all, we’re talking about education, not indoctrination…which is what public education becomes if only a particular philosophy is taught as being the only option. Some may object that discussions of philosophy of science is too complicated and should be left for college. Well, personally I think we’re dumbing down the public education system enough as it is.

  459. I, too, have noticed a remarkable degree of dissimulation in these discussions. In the first instance ID critics engage in what I would characterize as the “selective response syndrome.” You heard it here first folks, because I just coined the term. The idea is to ignore those points that totally refute one’s position, and cling to those areas that are murky enough to muddy the debate waters. So, if there position is “slam dunked” by an irrefutable argument, they simply ignore the point, change the subject, and continue on as sleek as ever.

    At times, they integrate this technique with the “mangled definition syndrome,” the most useful application of which consists in confusing ID motives with ID methods. Thus, the critic ignores the relevant subject of the design inference and alludes to the irrelevant subject of religious fundamentalists and their unfortunate proclivity to link ID to salvation history. Of course, this ploy is only good for buying a little time. When scrutinized, it loses all of its force. That’s when they immediately resort to perhaps their best rhetorical dodge, the “down the road” syndrome.”

    If an argument is being lost, one can always de-emphasize the present and focus on the future. Is ID science? Well, let’s reflect on what will happen “down the road.” Will ID benefit mankind? If this technology is all that it says it is, it should need no defense; the benefits that flow from its application will automatically refute Darwinism. IDers, as the critics would have it, ought to dispense with the polemic and invent something of real use to mankind. Hence, the discussion about the FACT of the science gives way to endless speculations over the QUALITY of the science. Even if it is science, one gathers, it is not a science of a high enough quality. Eventually, this argument fails, at which time, the critic resorts to the distraction of last resort—the “Socrates is back” syndrome.

    Everyone remembers Socrates, that wise old philosopher who abandoned the lecture format and made a career of asking hard questions. Unfortunately, ID critics have little in common with Socrates, so when they try to mimic his approach of true intellectual inquiry, they lower rather than raise the quality of the dialogue. In effect, they feign confusion by asking the same question over and over in creatively different ways, as if the answer had not already been provided. So, they ask: How can one detect design in an artifact without knowing something of its “history?” I point out that it doesn’t matter. “But wait,” come the response. “Van Till thinks it matters.” Van Till raised that question six years ago, and Dembski answered it five years ago. Does that matter? Well, no. Why not? Dembski didn’t convince them.” Why not? There is no answer. But that doesn’t prevent them from beginning again as if the subject had never been addressed. I have no doubt that while Patrick, Atom and others are laboring to work out the math, the critics are already preparing to revert back to the “selective response syndrome.” And so it goes.

  460. First paragraph 481. Change “there” to “their.”

  461. to allanius: I have not been discussing abiogenesis at all.

    to gpuccio: How have I been “behaving unfairly”?

    to Leo: I agree: Atom is a good person to discuss with, for the reasons you mention.

    And now, to Atom:

    I made up my jiggling table example to both bring up in a more concrete way some important issues and also as a way of pointing out that the real world is vastly more complicated that the pure chance scenario which is offered by those who present simple calculations based on nothing but the formula p^n.

    First, Atom writes,

    First, we’d have to observe the “natural laws” in this case, what patterns the table creates when run for long periods. (This would be analagous to our observations of the laws of nature.)

    Yes, this correct. In the table example, the probabilities are not known in theory, but must be determined by empirical