Uncommon Descent


12 March 2008

Complex speciation of humans and chimpanzees

Mario A. Lopez

John Wakeley1

Abstract

Arising from: N. Patterson, D. J. Richter, S. Gnerre, E. Lander & D. Reich Nature 441, 1103–1108 (2006); Patterson et al.

Genetic data from two or more species provide information about the process of speciation. In their analysis of DNA from humans, chimpanzees, gorillas, orangutans and macaques (HCGOM), Patterson et al.1 suggest that the apparently short divergence time between humans and chimpanzees on the X chromosome is explained by a massive interspecific hybridization event in the ancestry of these two species. However, Patterson et al.1 do not statistically test their own null model of simple speciation before concluding that speciation was complex, and—even if the null model could be rejected—they do not consider other explanations of a short divergence time on the X chromosome. These include natural selection on the X chromosome in the common ancestor of humans and chimpanzees, changes in the ratio of male-to-female mutation rates over time, and less extreme versions of divergence with gene flow (see ref. 2, for example). I therefore believe that their claim of hybridization is unwarranted.

[Bold added]

Just curious…How does interspecific hybridization occur between a Pan & Homo ?

 

These icons link to social bookmarking sites where readers can share and discover new web pages.
  • bodytext
  • del.icio.us
  • Netscape
  • Reddit
  • Fark
  • Furl
  • NewsVine
  • StumbleUpon
Print This Post Print This Post
571 Responses

1

PannenbergOmega

03/12/2008

5:08 pm

So this says that chimps and humans were interbreeding?

A. I thought ID believed that there was a great differnce between chimps and humans. That you can’t determine kinship by genetic similarity. It could be common design.

B. Dr. Dembski has said that the evidence doesn’t support Universal Common Descent. Maybe he is wrong?

What is going on here? Is ID full full of malarkey? Someone isn’t telling the truth here.


2

bFast

03/12/2008

5:22 pm

Just curious…How does interspecific hybridization occur between a Pan & Homo ?

We know that hybridization occurs between Bison (genus Bison) and cow, (genus bos). This is an equivelant hybridization.

Dr. Dembski has said that the evidence doesn’t support Universal Common Descent. Maybe he is wrong?

Other IDers, such as Behe, support common descent. I, for one, have concluded from the evidence that there is a common ancestor between chimps and humans. If there is any question of universal common descent, then the breaks in common descent happen far up the ladder. There is some validity in the argument that the cambrian explosion, for instance was not an event of common descent.

The nearer the split between chimp and human, the more potent becomes ReMine’s “Haldane’s dilemma” challenge. (ReMine, by the way, suggests that there is too much genetic diversity between human and chimp for there not to have been a De Nuveau creation. I beg to differ.)

Further, consider the HAR1F gene. It is different in 18 point mutations with the chimp. Big deal? It is ultra-conserved in chickens and mice! The bottom line is that this thing had to have all 18 mutations happen at the same time. Such an event is, in itself, beyond the UPB.

PannenbergOmega, there is a significant contingent of IDers who find no reason to question common descent. I think that we are more ready to question common descent than the darwinists, but common descent actually has strong supporive evidence.


3

Frost122585

03/12/2008

5:32 pm

The kind of science this article is talking about is mere speculative science. DNA is often similar and often not among species that are and are not related. My point is that the evidence the authors use is questionable as almost all of evolution science is. This is to be taken with a grain of salt. There are currently all kinds of opposing theories about how evolution and diversification happened. This is one of many and they cant all be right.


4

PannenbergOmega

03/12/2008

5:56 pm

Interesting. Thank you bFast.
It’s too bad (in my opinion) that there is so much evidence for common ancestry. I don’t see how you can reconcile it with the Biblical account of creation.

What I’m saying is, I wish the data undeniably supported the Biblical account of creation.


5

Paul Giem

03/12/2008

6:42 pm

I’d just like to second Frost’s (3) point. If I understand correctly, the article is claiming that the X chromosome is not as divergent between chimps and humans as other chromosomes are. If so, those are the facts. The proposed explanation of those facts appears to leave something to be desired. If there was hybridization, why was the X chromosome the only chromosome that got shared? Shouldn’t there be other chromosomes that were also shared? If the gene transfer went in only one direction, shouldn’t there be two widely divergent versions of the X chromosome in either humans or chimps, or if it went in both directions, in both? (Other questions come up. Was the sharing before or after the divergence between chimpanzees and bonobos? WHere do gorillas fit in?)

I’m not saying that there is no theoretical possibility that this could have happened. But it does seem that the model being proposed doesn’t explain the facts well.

On the other hand, If someone (or Someone) designed the two species, one could easily conceive of a re-use of some sections of code with minimal modification, like the X chromosome, and highly modified code in other areas, such as the HAR1F gene, and perhaps even areas of totally new code.

So, PannenbergOmega, I actually don’t see this as evidence of hybridization, let alone common ancestry.


6

Mario A. Lopez

03/12/2008

7:26 pm

bFast,

I disagree. First, the chromosomes are off by a couple, which will likely produce a sterile hybrid (an evolutionary dead end). Of course, this is just speculation, since the article says that “the X chromosome is explained by a massive interspecific hybridization event in the ancestry of these two species.” So, the hybrid event is only conjecture. BTW—I am not surprised that evolutionists would take this line of reasoning. You know, they will eventually have to point to the actual ancestors. Second, there are stark reproductive differences between chimps and humans. What is the likelihood that their ancestors were not? Third, the genetic differences are much greater than originally thought:

http://www.sciencemag.org/cgi/...../5833/1836

http://www.newscientist.com/article.ns?id=dn5044

Sorry, I don’t think that the evidence for common ancestry is as solid as you hope.


7

Frost122585

03/12/2008

7:30 pm

In regards to what Paul is saying,

Id like to aso add that if in fact man bread with apes and we are the result of such an evolutionary mechinism- then we apparenty aren’t man.

Apparently man lived along time ago and disappeared. So I guess we should address each another not as fellow man but fellow hybrid.

I. Don’t. Buy it.

However, looking at the three apes we have running for president: Hillary, Obama and Mccain; I dont think we can totaly rule out the above hypothesis.


8

Allen_MacNeill

03/12/2008

8:04 pm

Paul Glem asked:

“If there was hybridization, why was the X chromosome the only chromosome that got shared?”

It wasn’t; it was the only one “studied” in this investigation. There are many other pieces of genetic evidence pointing to the same conclusion. Perhaps one of the best is the discovery that human chromosome 2 is actually two chromosomes glued together: two chromosomes that are separate in chimpanzees (and all other primates). That is, in the divergence between the line of primates that evolved into chimps (genus Pan) and humans (genus Australopithecus and genus Homo) one of the significant genetic changes that occurred is that two of the chromosomes of the ancestral ape-like primate became fused to form the human chromosome 2.

In other words, there are multiple lines of evidence all supporting the assertion that chimps and humans diverged from a common primate ancestor somewhere around 6 million years ago.


9

Allen_MacNeill

03/12/2008

8:17 pm

Furthermore, I think there is some confusion here. The authors of the report didn’t assert that chimps and humans hybridized. What they concluded (based on multiple lines of genetic evidence) is that the early diverging lines of primates that would eventually become chimps and primates that would eventually become humans interbred for quite a while.

This is a well-known phenomenon among diverging lines of eukaryotes, especially animals. For example, mallard ducks (Anas platyrhynchos) and wood ducks (Anas rubripes) readily hybridize in zones of overlap (such as within walking distance of my house here in Ithaca), as do blue warblers (Vermivora pinus) and golden-winged warblers (Vermivora chrysoptera) in the Adirondacks where my family goes camping. In the latter case, there are multiple hybridization events, similar to what has been inferred for the divergence between the line that became chimps and the line that became humans.

That is, in the early stages of the divergence between two incompletely isolated populations, hybridization is common. It is only after considerable divergence has occurred that complete reproductive isolation eventually takes place.

And sometimes it doesn’t (or it breaks down) and what were two separate populations go back to being one species again. This has apparently happened between the coyoté (Canis latrans) and the red wolf (Canis rufus) in the southeastern United States.

Also, this should answer the question of how it is that chimps and humans hybridized. The simple answer is: they didn’t, their ancestors (which were almost phenotypically indistinguishable) did.


10

Allen_MacNeill

03/12/2008

8:20 pm

Mario Lopez wrote:

“First, the chromosomes are off by a couple, which will likely produce a sterile hybrid (an evolutionary dead end).”

This subject has been addressed before, in this blog and at mine. For more on the subject, I refer you to:
http://evolutionlist.blogspot......eding.html


11

jerry

03/12/2008

8:45 pm

If anyone wants a fun read on something related to this topic, get Michael Crichton’s “Next.” I read all 423 pages in two nights reading. Lost a lot of sleep because I couldn’t put it down. It is a novel that has a bibliography.

It is all about genetics issues and the two most enjoyable characters in the book are a transgenic chimp/human named Dave and a transgenic parrot named Gerrard who can do math and repeat everything he ever heard. I got to believe Gerrard will win an academy award if they make a movie of the book.

The main theme of the book is about who owns genes and how they can be used in research and medicine and the ethics of cloning and creating transgenic species.


12

PannenbergOmega

03/12/2008

8:47 pm

This is nuts. People are not chimps.
Or chimp/human hybrids.


13

Borne

03/12/2008

9:00 pm

bFast: “I, for one, have concluded from the evidence that there is a common ancestor between chimps and humans.”
Have you indeed? I say, baloney on that conclusion! :-o

All the evidence you may wish to point to must be speculated upon, extrapolated and conjectured into Darwinian theory before any such conclusion can be made.

The same data can be interpreted quite differently into the ID paradigm of a common designer.

We supposedly share 50% DNA with bananas. Does that mean we also share common ancestry with them? Or toads? Or mice? Or any organism you care to mention?

Under this common ancestry line of reasoning we ought to consider the following:
How about canning Darwins’ man descending from primates and rather saying that primates descend from us?

Really! By what rule must it be the contrary? Absolutely not the laws of thermodynamics at any rate.
So what is it?

Why are we so convinced of our own “superiority” or being “higher”? How does descended from = higher?

Under real Darwinism (ie Darwinism taken to it’s logical conclusions) there is no such thing as superiority, only different levels of complexity and intelligence etc. It’s all just an illusion of superiority since nature knows nothing of superior, inferior etc.

Materialism has no grounds whatsoever for declaring intelligence or anything at all a basis for so-called “higher” and “lower” terms applied to life forms.

If materialism is true then intelligence itself is meaningless - just like the whole universe.
Upon what grounds then does the mere illusion of intelligence = higher or superior?

Once you swallow the common ancestor line - at least to the degree of humans/chimps sharing one - you cannot escape the hook and sinker either.


14

dacook

03/12/2008

9:01 pm

Just curious…How does interspecific hybridization occur between a Pan & Homo ?

Well, first you put on some soft music. Then you dim the lights. Pour some wine, set out some chocolate, maybe a banana…


15

Frost122585

03/12/2008

9:01 pm

Well, Pannenberg, they aren’t really saying that we are hybrids- they are saying that there is a similarity between chimps and humans in the X chomosome. The “theory” is that people mated with a ape like ansester of both chimps and humans. But.. we know that evolution requires mutation as a rule anyway. So, why then could the x chromosome not simply be the result of a common ansester that had the mutation happen prior to any interbreeding?

The point is that they don’t know. They are just comming up with somthingnew or controversial to get attention and more grant money. Same ol’, same ol’.


16

Allen_MacNeill

03/12/2008

9:04 pm

PannenbergOmega wrote:

“This is nuts. People are not chimps.
Or chimp/human hybrids.”

As I have already pointed out, the authors of the article we are discussing suggested nothing of the kind. Rather, they suggested (on the basis of multiple lines of genetic evidence) that the of chimps and the of humans apparently hybridized several times. This is not an uncommon event during the early stages of cladogenic divergence. Among animals in particular, the early stages of cladogenic divergence are usually mediated primarily by changes in behavior, rather than large-scale changes in the genome. Only after two diverging lines have remained separate for a considerable length of time do sufficient genetic differences accumulate to render hybridization impossible.

The situation is very different in plants, which hybridize easily (mostly because they are relatively tolerant of changes in chromosome number). Since Darwin published the Origin of Species botanists have observed the origin of dozens of new species of plants, mostly through two genetic processes: autopolyploidy and allopolyploidy, both of which are facilitated by the tolerance I mentioned earlier.

Fungi hybridize even easier than plants in many cases, and for probably very similar reasons: neither plants nor fungi can move around very easily, and so must retain the ability to mate with whomever is nearby.

Bacteria don’t even have what would qualify as “species” among eukaryotes. Not only do they “interbreed” readily by exchanging genetic material, they can also exchange genetic material with viruses, and even scarf up free DNA from their environment.

So, the whole question of the “origin of species” is mostly a question restricted to animals (i.e. members of the kingdom Animalia), and in many, many cases there is strong genetic evidence that the process of cladogenesis (i.e the splitting of one panmictic population into two or more) has happened and is happening among animals as well.

Once again, read about the hybridization between mallard ducks and wood ducks, blue warblers and golden-winged warblers, and between coyotés and red wolves, and ask yourself if there is any empirically verifiable (i.e. not metaphysical or religious) reason why the same processes can’t have occurred between the ancestors of chimps and humans?


17

Allen_MacNeill

03/12/2008

9:05 pm

Allen MacNeill wrote:

“…that the of chimps and the of humans apparently hybridized several times.”

Somehow a crucial word was dropped from this sentence. It should have read:

“…that the ancestors of chimps and the of humans apparently hybridized several times.”


18

Allen_MacNeill

03/12/2008

9:11 pm

Borne asked:

“We supposedly share 50% DNA with bananas. Does that mean we also share common ancestry with them? Or toads? Or mice? Or any organism you care to mention?”

The answer is YES. All eukaryotes share a surprising amount of genetic and phenotypic characteristics, all of which point to a common ancestor that lived somewhere around a billion years ago. Please note that the phrase “common ancestor” is not intended to refer to a single individual, but rather to a population of individuals that exchange genetic material with each other.

The exchange of genetic material is the crucial point, here. Bacteria do it so often and so easily that there aren’t really “species” of bacteria the way we think of them among eukaryotes (especially animals). This is directly relevant to your question, because a billion years ago, virtually all living organisms were “bacteria” (or, to be more precise, prokaryotes). This means that they were just as likely to have exchanged genetic material as bacteria are today, and so yes, there is very strong genetic evidence that all living eukaryotes share a common ancestor with a group of unicellular symbiotic bacteria that lived about a billion years ago.


19

Allen_MacNeill

03/12/2008

9:17 pm

Borne wrote:

“How about canning Darwins’ man descending from primates and rather saying that primates descend from us?”

This comment demonstrates a basic misunderstanding about biological classification. “Man” didn’t “descend from primates”; rather, humans ARE primates, a fact that even Linnaeus recognized (despite being a young Earth creationist). This means that the converse is equally mistaken; primates can’t “descend from man” anymore than Fords can “descend” from automobiles. Fords automobiles, just as chimps and humans are both classified as primates (i.e. members of the order Primates, within the class Mammalia, phylum Chordata, kingdom Animalia, domain Eukarya).


20

Allen_MacNeill

03/12/2008

9:18 pm

Again, a crucial word was dropped:

“Fords are automobiles…”


21

PannenbergOmega

03/12/2008

9:32 pm

Thank you Frost and Borne for clearing that up for me.

http://www.randomhouse.com/cat.....0307396266


22

RRE

03/12/2008

9:36 pm

It may quite be possible that an intelligent agent used the chimpanzee DNA as a base for his program upgrade to make us, the result of which a mind can now add concept onto matter in the form of a code or machine.

What better way to show God’s connectedness to us, and proof of His presence in the past, then to say that all the machines and codes in all of the known universe were created by man with the exception of His created biological organisms and their genetic code and machinery. We possess His image, why not proclaim it as our established cultural TRUTH?

Let the Darwinist tell us how a machine and a code could come into existence without a mind. If science is what we can observe, test and demonstrate, let them show us a code or machine that comes from stochastic chemical processes. Let them show us how a code or machine can come into existence without using intelligent causes. They cannot, it should be Law.

Why does the Darwinist confuse the populace by telling us chimps can use tools?
I think we should concentrate on the central difference rather than the cosmetic commonalities, which is that only WE can add concept onto matter in the form of a machine or code. I want to see a chimp or other simian add concept onto matter that is a code or machine. Make a bow and arrow or similar. They cannot. This is human exceptionalism, the word ‘tools’ used to describe what chimps are doing is misleading, and ABSOLUTE propaganda. The monkey will not understand grammar either (nor design for us a code) as pointed out by Denise O’Leary. Monkey don’t know John killed Betty from Betty killed John.

I think it will be shown that humans and chimps (along with the other primates) did not in fact diverge through a hybridization event. I have to be open to the possibility that an intelligent agent interrupted/manipulated the chimp DNA code and possibly the original EGG cell as well. I think the fused chromosomes could lead to more details as to which theory is true. Are fused chromosomes unique to humans? Is this consistent with our human exceptionalism?

If you do not believe in human exceptionalism, then please tell me why I can see machines in nature, and chemical codes represented in, and changing into other, complex shapes and know that they are such? The genetic code is holistic just like any other code that man can create, such as these very words you are reading, or the machine code that is the base of our computers. How do you not see the connection to intelligent design? How are you more likely to believe that the Earth is analogous to the greenhouse, but are not willing to make the direct inference that intelligent causes play a role in determining the origin of machines and codes every single time with no exception?

DARWINIST*** Show me a code or machine that was not intelligently designed and I will believe in methodological naturalism as to the origin of the complexity seen in the cellular machinery and code found in nature.


23

bFast

03/12/2008

10:30 pm

Borne:

All the evidence you may wish to point to must be speculated upon, extrapolated and conjectured into Darwinian theory before any such conclusion can be made.

The best single case I have seen to accept the common descent of chimps and humans is the phenomenon of specific point mutations which cause disease that both chimps and humans share. The most natural explanation I can find is that the point mutations happened in the common ancestor. The other options are:
> They happened more than twice, however there are hundreds.
> The designer intentionally inserted the disease-causing mutations. A yucky thought.

The same data can be interpreted quite differently into the ID paradigm of a common designer.

Please do interpret.

Mario A. Lopez:

First, the chromosomes are off by a couple, which will likely produce a sterile hybrid (an evolutionary dead end).

My understanding is that the common mouse has between 20 and 40 chromosomes, depending on which one you catch, and they all pretty much interbreed. It would appear that the chromosomal barrier is not by any means infinite.


24

PannenbergOmega

03/12/2008

11:01 pm

bFast, didn’t you write once that you thought there was evidence of recent engineering in the creation of man?

What do you think of Behe’s The Edge of Evolution?


25

ungtss

03/13/2008

12:18 am

The best single case I have seen to accept the common descent of chimps and humans is the phenomenon of specific point mutations which cause disease that both chimps and humans share. The most natural explanation I can find is that the point mutations happened in the common ancestor. The other options are:
> They happened more than twice, however there are hundreds.
> The designer intentionally inserted the disease-causing mutations. A yucky thought.

Which diseases are you talking about? Many single point mutation diseases occur spontaneously in individuals. If a particular mutation can occur independently in two humans (rather than being inherited from a common ancestor) then why should it surprise us that apes are subject to the same mutation? Or do you have in mind a particular disease which is only inherited and never arises spontaneously?


26

Paul Giem

03/13/2008

12:42 am

Allen_MacNeill (8,9),

I am currently operating off of the abstract, and will correct that by reading the article, tomorrow if things work out. However, in the abstract, after the authors argue that the chimpanzee-human split happened some 6.3 million years ago, they state that “chromosome X shows an extremely young genetic divergence time, close to the genome minimum along nearly its entire length.” Their implication seems to be that the X chromosomes, in contrast to the others, are markedly similar. If hybridization happened 3.15 million years ago, the X chromosomes would, by standard theory, have approximately 50% of the changes that other chromosomes do. Since the authors cite figures from 84% to 147%, I doubt that 50% would be that impressive. Let’s say that the correct figure for the X chromosome was 5% of the difference of the rest of the chromosomes. That suggests that any hybridization that could account for the X chromosome near-identity would have had to occur at 315,000 years ago. We are now talking 95% human and 5% common ancestor mating with 95% chimpanzee and 5% common ancestor.

So your statement
The authors of the report didn’t assert that chimps and humans hybridized. What they concluded (based on multiple lines of genetic evidence) is that the early diverging lines of primates that would eventually become chimps and primates that would eventually become humans interbred for quite a while.
is incorrect. it is not the early but the late lines that interbred according to this scenario. That is, almost humans and almost chimpanzees would have to interbreed.

That means that your statement
Also, this should answer the question of how it is that chimps and humans hybridized. The simple answer is: they didn’t, their ancestors (which were almost phenotypically indistinguishable) did.
is also in all probability incorrect. Unless one wants to say that 95% of the genetic change had to happen before humans and chimpanzees were easily distingushable, in order to explain the X chromosome similarities by interbreeding, one has to postulate fairly distinct phenotypes.

I am aware of the possibilities of crossbreeding also, although I do not mind the lecture on ducks and coyotes, as others may not have heard it. I wasn’t even challenging whether humans and chimpanzees could be fertile together (I understand that Stalin tried it with gorillas and humans and it didn’t work, so I am doubtful, but it isn’t against my religion to believe that it might work, although it is against my religion to try it :) ), but I was simply commenting that using it as the explanation for the “extremely young genetic divergence time” of the X chromosome had serious scientific difficulties.

When I said
If there was hybridization, why was the X chromosome the only chromosome that got shared?
and you answered,
It wasn’t; it was the only one “studied” in this investigation.
that answer was also incorrect. Note that multiple chromosomes were studied. Otherwise, the near-identicality of the X chromosomes would have been simply assumed to be the norm. One cannot note how much less divergent the X chromosomes of the two lines are until one has a standard by which to judge them. Maybe you can back up and try another explanation of why the X chromosome alone was shared during the last hybridization event, and why every individual switched over to the new X chromosome.

It looks like you may have mistaken my criticism of the explanation given in the paper for the X chromosomes being nearly identical, with a criticism of the common descent of chimps and humans. I do have such criticisms, but for purposes of discussion was not making them. I was merely noting that the proposed mechanism did not seem to fit the facts.


27

DaveScot

03/13/2008

6:03 am

Allen

I’m curious about the difference in chromosome number between humans and other primates. How is it determined that two primate chromosomes fused in the human lineage rather than one primate chromosome split to form the other primates?

I’m not sure I buy your story about plants hybridizing so easily. Pollen travels quite a ways both airborne and via insects and I don’t know of much in the way of hybrids from different species emerging from it. Flowering plants might simply be more promiscuous as they passively get exposed to pollen from many other different species (which doesn’t result in hybrids) while at the same time they get exposed to many close variants of their own species which does result in hybrids. Animals aren’t typically so unselective about where the male germ cells come from. Polyploidy doesn’t seem like a very good example of Darwinian speciation either as it’s a saltation not a gradual divergence and there’s no new genetic material but rather just a wholesale duplication of chromosomes wherein the difference in chromosome number lowers (but doesn’t eliminate) fertility between polyploid variants.


28

allanius

03/13/2008

10:49 am

So one group of august Darwinists thinks there was hybridization and another thinks not. What a dustup! But the good news here is there can be two widely divergent interpretations of the same data—and both can be taken seriously by the science establishment! All that’s needed, apparently, is a Framework (not to be confused with an explanatory filter), a knack for the Unblushing Inference, and a Titillating Premise. Two “non-overlapping magisteria”? Not at all. These days the scientist can be just as liberated from the limitations of solid reality as any preacher or poet.


29

Borne

03/13/2008

12:17 pm

Allen_MacNeill:
1. “The answer is YES. All eukaryotes share a surprising amount of genetic and phenotypic characteristics…”
Well that is the Darwinian version. Sorry I’m not buying your conclusions. Sharing genetic characteristics does not = Darwinism unless you already have a pre-commitment to that hypothesis.

Calling in your mentioned evidence for bacteria to man evo requires a huge amount of faith in the Darwinian scenario. Something that has not been and cannot be demonstrated empirically.

It all sounds so plausible when one listens to the 1000’s of just-so stories. Stories ubiquitously interspersed with complex sounding talk of genes, mutations and the almighty power of selection.

Darwinists however, never seem to noticed that the Darwinian scenarios end up looking more and more like supernatural creation but with no god.

“And as Darwinists and neo-Darwinists have become ever more adept at finding possible selective advantages for any trait one cares to mention, explanation in terms of the all-powerful force of natural selection has come more and more to resemble explanation in terms of the conscious design of the omnipotent Creator.”

(Ho M-W. & Saunders P.T., eds., “Beyond Neo-Darwinism: An Introduction to the New Evolutionary Paradigm,” Academic Press: London, 1984, p.x)

“The ‘modern evolutionary synthesis’ convinced most biologists that natural selection was the only directive influence on adaptive evolution. Today,
however, dissatisfaction with the synthesis is widespread, and creationists
and antidarwinians are multiplying. The central problem with the synthesis is its failure to show (or to provide distinct signs) that natural selection of random mutations could account for observed levels of adaptation.”

(Leigh E.G., Jr, “The modern synthesis, Ronald Fisher and creationism,” Trends in
Ecology and Evolution, vol. 14, no. 12, p..495-498, December 1999, p.495)

IOW, When you look at the details involved in transforming bacteria into man and near simultaneously into the millions of other species - without any guidance, target, purpose or adequate mechanism, Darwinism looks totally ludicrous.

2. “rather, humans ARE primates,”
Thanks for your correction. You’re right, and I should have written “apes” rather than primates. I’m not a biologist. I’m an informatics specialist.


30

Borne

03/13/2008

12:37 pm

bFast: ” They happened more than twice, however there are hundreds.

Please do interpret.”
There are a couple of problems I see in this for your interpretation.
1. If you are ready to accept to macro-evo of ape to man you may as well buy into the whole of Darwinism because we’re talking major differences and novel creations.
2. If you must base such a conclusion on shared diseases caused by the apparently exact same mutations you will have to look at all species sharing the same. I suggest you look first at mice/human disease. There’s tons of data on those two.
So we descend from mice too?
Sooner or later it’ll catch up with ya. ;-) You’ll either turn full Darwinian or make a better decision such as looking for better explanations. Such as what causes such mutations in the first place? And, whether the same cause could have been responsible for the many cases you might mention in various species in the same time period - use your imagination ;-).

3. Suppose you were to examine the same data before Darwin ever existed. What kind of reasoning would you use then, w/o the macro-evo paradigm in mind? And what possible alternative conclusions could you make?


31

Allen_MacNeill

03/13/2008

2:04 pm

DaveScot asked:

“How is it determined that two primate chromosomes fused in the human lineage rather than one primate chromosome split to form the other primates?”

All animal chromosomes have special sequences called telomeres at each end. These telomeres are part of the process that regulates how often cells can divide. Basically, each time a cell divides by mitosis, it loses a telomere at the end of each chromosome. When they’re all gone, the cell can’t divide any more. This prevents cells from becoming cancerous (although some cancers produce an enzyme called telomerase that puts back the telomeres).

Bottom line is: you can tell the end of a chromosome because it has telomeres.

Now, the situation with human chromosome #2 is that it has a set of telomeres in the middle, as well as at the ends. Also, the set in the middle consists of two sets of telomeres arranged in reverse order.

Upon closer examination, it has also been found that the genes in the two segments of human chromosome #2 (separated by the embedded telomeres) have approximatey the same genes in approximately the same order as the two unfused chromosomes found in chimps and other primates.

There is more evidence having to do with the placement of centromeres in the chromosomes. Rather than go through a long explanation, I refer you to:

http://www.evolutionpages.com/chromosome_2.htm

Ergo, there are two logical interpretations of these multiple lines of empirical evidence:

1) human chromosome #2 consists of two chromosomes found in other primates, fused together at the location of the back-to-back embedded telomeres

2) an “intelligent designer” inserted the back-to-back embedded telomeres in the middle of human chromosome #2, arranged all the genes to look just like they should if they had come from the two unfused non-human primate chromosomes, and then inactivated the back-to-back embedded telomeres (i.e. they have no detectable function)

Not only do I prefer the first interpretation on purely scientific grounds (i.e. it comports with all of the other evidence pointing to a common human-chimp ancestor, plus being the “simplest” explanation a la Occam’s razor), it also does not require the intervention of an “intelligent designer” who is also a deliberate prevaricator.


32

Allen_MacNeill

03/13/2008

2:12 pm

RRE wrote:

“…only WE can add concept onto matter in the form of a machine or code.”

And so, before people could do this (i.e. before the middle of the 19th century or thereabouts), they were not human, nor were they different from chimps and other animals in any other way, right?

For that matter, I only know a very few people who can perform this operation — that is, convert a concept into a line of code. Does that mean that they, too, aren’t human?

Were you human before you learned how to code? Will you remain so when old age reduces or eliminates your ability to do so?

Tool use is clearly not the sole criterion by which humanity is defined. My little son (now just one year old) was fully human when all he could do was lie in the crib and look cute.

IOW, what differentiates humans from other animals is no single qualitative difference, but rather a relatively large number of quantitative differences, which when added together define what we mean by “human.”


33

Allen_MacNeill

03/13/2008

2:18 pm

RRE asked:

“Are fused chromosomes unique to humans? Is this consistent with our human exceptionalism?”

Not at all. Both fused and fissioned chromosomes are common throughout the four kingdoms of eukaryotes. Indeed, the question as to why certain species have many chromosomes (such as frogs and ferns) while others have many fewer (such as humans) is a very interesting one from the standpoint of evolutionary biology. Answering it requires that one look long and hard at the patterns of chromosome number, and try to correlate those with environmental stresses, evolutionary pressures, and historical contingency.

But one could also just say “that’s the way the Intelligent Designer wanted it” and then go do something else that also wasn’t science…


34

Allen_MacNeill

03/13/2008

2:26 pm

RRE wrote:

“DARWINIST*** Show me a code or machine that was not intelligently designed and I will believe in methodological naturalism as to the origin of the complexity seen in the cellular machinery and code found in nature.”

To which I reply (shouting in response to the shouting):

ID SUPPORTER***: Show me a way to empirically and unambiguously determine whether a code or physiological mechanism in a living organism was designed by an Intelligent Designer and I will believe in intelligent design as the origin of the complexity seen in the cellular machinery and code found in nature.

And please make certain that the empirical evidence you provide unambiguously differentiates between the two processes in a way that can be verified using standard statistical analysis. Then publish your results and wait for the Nobel committee to give you a call (it’s virtually guaranteed).


35

Allen_MacNeill

03/13/2008

2:31 pm

DaveScot asked about the details of speciation events and their relationship to chromosomal changes and other genetic events, especially in plants. Rather than respond to each point, I refer you to:

http://evolutionlist.blogspot......cious.html


36

PannenbergOmega

03/13/2008

2:40 pm

If Darwinists want sympathy, you’ve come to the wrong place.

Also, your holiet than thou attitude is getting a bit old. After all it was your Darwinian philosophy that helped produce Hitler.


37

Allen_MacNeill

03/13/2008

2:42 pm

Borne asked:

“So we descend from mice too?”

No; once again, the answer (based on multiple lines of empirical evidence) is that mice and humans descend from a common ancestor (similar to a tree shrew) that lived in the Paleocene (or perhaps somewhat earlier in the Cretaceous.

The phylogeny of mammals has been worked out in detail, based on mutiple lines of anatomical, genetic, and ecological evidence. I recommend checking out the following as an introduction to this fascinating topic:

http://en.wikipedia.org/wiki/Evolution_of_mammals

In my opinion (as a biologist who specializes in mammals, especially primates), this is one of the best articles on evolution in Wikipedia. Although there are a few inaccuracies, overall it’s amazingly concise and comprehensive.


38

Charlie

03/13/2008

2:48 pm

Hey moderators,
I think it’s really time to clean out the sock drawer.


39

Charlie

03/13/2008

2:50 pm

Hi Allen,
Coming on the heels of your comment my suggestion might look like it refers to you. It doesn’t, not at all.


40

Allen_MacNeill

03/13/2008

2:53 pm

Borne wrote:

“Calling in your mentioned evidence for bacteria to man evo requires a huge amount of faith in the Darwinian scenario.”

On the contrary, the phylogenies you describe have only come about through the opposite of faith. Dogged hard work mostly, combined with a fierce skepticism about proposed phylogenies, especially in the absence of overwhelming empirical data. Phylogeneticists nearly get into fist fights at conferences over proposed phylogenies. The reason? Not enough evidence, or evidence that is ambiguous. And so we fight it out, subjecting each other’s proposals to the most withering storms of criticism, both publicly and (especially) privately.

As T. H. Huxley famously said:

“[Nature] warns me to be careful how I adopt a view which jumps with my preconceptions, and to require stronger evidence for such belief than for one to which I was previously hostile.

My business is to teach my aspirations to conform themselves to fact, not to try and make facts harmonise with my aspirations.”

Now that’s science!


41

Allen_MacNeill

03/13/2008

2:56 pm

Thank you, Charlie, I appreciate your disclaimer. I’ve occasionally been accused of being a meat puppet, but never a sock puppet ;-) That’s why I always and only use my real name, both here and elsewhere, online and in print. I take responsibility for everything I write, and hide behind nothing except my reputation as a scholar and a scientist.


42

DaveScot

03/13/2008

3:00 pm

Allen

All you had to say was there are two telomeres in the middle of the chromosome. Theoretically the telomeres could have been inserted by random mutation into an unfused chromosome which later split in two at the convenient join. But that doesn’t seem as likely as a fusion so I’ll call myself satisfied with a fusion as the best explanation.


43

Allen_MacNeill

03/13/2008

3:01 pm

Hmm, looks like I’m not up on the more recent definitions of “meat puppet.” I used the term to mean “an animal whose behavior can be inferred to be directed by conscious thought, rather than pure instinct”. That is, our bodies can be thought of as “meat puppets” of our minds.

Ah, well, looks like I need to spend even more time at Wikipedia…


44

Allen_MacNeill

03/13/2008

3:11 pm

DaveScot wrote:

“Theoretically the telomeres could have been inserted by random mutation into an unfused chromosome which later split in two at the convenient join.”

That would only explain the anomalous presence of two back-to-back telomeres in the middle of human chromosome #2. It would not explain why the genes in the two fused segments line up “in register” with very similar genes in the unfused chromosomes of other primates, nor why the centromere of human chromosome #2 lines up with the centromere in non-human primate chromosome 2p, nor why the remnants of the other (now non-functional centromere is located in the other segment of human chromosome #2. All of these lines of evidence point to the same conclusion: that human chromosome #2 was formed by the fusion of two chromosomes found separately in all other primates.

An interesting question is, did this fusion event have anything directly to do with the genetic and phenotypic divergence between the two lines of primates that eventually became chimps and humans? the answer is not immediately obvious, as simply fusing together two chromosomes doesn’t change the genetic information they carry nor how it is expressed, it only changes how it’s segregated during meiosis.

It does, however, strongly suggest that the two evolving lines of primates were sufficiently isolated from each other for long enough for such genetic differences to accumulate. So, what caused this separation, how long did it last, and what happened during it? All good questions, and all potentially answerable by evolutionary biologists, especially paleontologists. I’m looking forward to reading about what they discover as a result of their field and laboratory investigations.


45

EricV

03/13/2008

3:12 pm

Is this the Mario Lopez from Saved by the Bell?


46

DLH

03/13/2008

4:03 pm

Allen_MacNeill at 34 You asked:

ID SUPPORTER***: Show me a way to empirically and unambiguously determine whether a code or physiological mechanism in a living organism was designed by an Intelligent Designer and I will believe in intelligent design as the origin of the complexity seen in the cellular machinery and code found in nature.

See Craig Venter’s customized bacteria including a synthetic DNA watermark.


“JCVI Scientists Publish First Bacterial Genome Transplantation Changing One Species to Another”

ROCKVILLE, MD — June 28, 2007 — Researchers at the J. Craig Venter Institute (JCVI) today announced the results of work on genome transplantation methods allowing them to transform one type of bacteria into another type dictated by the transplanted chromosome. The work, published online in the journal Science, by JCVI’s Carole Lartigue, Ph.D. and colleagues, outlines the methods and techniques used to change one bacterial species, Mycoplasma capricolum into another, Mycoplasma mycoides Large Colony (LC), by replacing one organism’s genome with the other one’s genome.

This appears to be a functioning bacterium or “a living organism” per your request.

Then see: j at #40 of Ian Musgrave’s “Intelligent Design Challenge.”
“By the way, it seems that the sequences for the watermarks that you just gave include extra leading and trailing characters. Here are the codings for the actual watermarks themselves, with quantity of characters in brackets:

TGTCGTGCAATTGGAGTAGAGAACACAGAACGA [33]

(CRAIGVENTER)

GTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAG [45]

(VENTERINSTITVTE)” . . .”
“So there are only 33 + 45 + 24 + 39 + 39 = 180 characters = 360 bits.”

This clearly shows a “watermark” in the genome of that organism that was caused by an intelligent designer, namely Craig Venter et al.

QED
Will you now take the step of: “I will believe in intelligent design “?


47

Frost122585

03/13/2008

5:21 pm

The most important thing that we as ID advocates should take from theories like the one above is that this is the current state of Darwinism.

Darwinian evolution has failed so many times to predict various mutations, structures in the fossil record, diversity of life, duration of diversity and time between change- etc…

that now we have new “just so stories” that cant be proven, that are merely evolution of the gaps theories- that in them of themselves are improbable regardless of whether they are true or not.

Can’t explain it well with mutation… well make something else up. This is the character of modern origins science.

as Behe writes in Edge of Evolution pp. 233 - 234, in regards to the claim that Intelligent Design does not make predictions…

“An eminent leader of the neo-Darwinian synthesis declared forthrightly a half century ago that “the search for homologous genes is quite futile.” Later work showed that “the view was entirely incorrect.”

Homology is not something that you would expect from diversity and complexity that originated from random mutations. Apparently there is a very specific and common design plane among species and life in general yet no one is willing to attribute this to the narrow line of reasoning and design that we only see in intelligent minds.

This is not to say that the theory proposed above is impossible or surely incorrect but the point to be made here is that science is again trying to use the old paradigm of Darwinian unintelligent design which has constantly had to change its game at ever turn. Moreover, Behe thinks that Darwinism is only responsible for about 2% of evolution.

If a trained biologist of Behe’s caliber is willing to make such a claim and back it up with math and explanation, then you can be sure that where there’s smoke there’s fire.

As Darwinian science continues to be the only kind of origins science taught, the “just so stories” or “theories” that mainstream science advances will very likely be just as unprosperous as the old paradigm that lead science down the blind alley to begin with.

From interbreeding, to co-option, to lateral gene transfer- all are very much speculative in how specified complex life came into being and diversified into what the fossil record shows and what we see today.

Meanwhile, no matter how hard scientists try, the end result is a bunch of improbable, incomplete, speculative explanations that rule out intelligence apriori. There is however another path (and only one) that science could venture down-
“That life and the cosmos is organized via “intelligence” through the “purpose of design.” Where this line of reasoning takes origins science is at this stage hard to fathom but it certainly wont be anymore speculative than the current approach. Thus, history has shown again that there is probably a lot more to origins then unintelligent natural processes. Maybe it’s time that science should take into consideration and go to work with that familiar solitary yet forbidden mechanism that some call “purpose” and give the darwinian stuff its well deserved break.


48

DLH

03/13/2008

5:27 pm

DaveScott @ 27 & Allen_MacNeill

And the Miller Told His Tale: Ken Miller’s Cold (Chromosomal) Fusion

Here is Ken Miller video asserting 2 fewer chromosomes as evidence for evolution not ID.

“Chromosome #2 was formed by the head to head fusion of two chimp chromosomes 13.”

Some key questions I have is
1) HOW did this fusion event happen?

2) At what stage in reproduction?

3) Do you have One fusion event in one person?

4) If so HOW is that reproduced into the population?

5) Can this “human” with the fused chromosome reproduce with the primate with two separate chromosomes?

6) If not, then does this require two chromosome fusion events?

PS Miller tries to give a strawman saying an intelligent agent causing this fusion event would be deceptive.

If an intelligent designer can intervene at the beginning, there can equally be an intervention to split primate to human.

I believe that Miller is raising a strawman argument of his own making appealing to a theological narrow misinterpretation of Creation Science which he attributes to ID.

My challenge to Miller is how he can claim to believe in “theistic evolution” and then systematically and vigorously fight against any hint of an intervention of an intelligent agent in the process of formation of life and subsequent evolution. That sounds morally deceptive to me.


49

PannenbergOmega

03/13/2008

5:34 pm

Ya know, I wish his holiness Pope Benedict XVI would disavow Miller’s work. I doubt that he would find Miller’s views on God and creation Christian.

PS: I can’t wait for EXPELLED!!


50

PannenbergOmega

03/13/2008

5:43 pm

Don’t want to speak for the Pope though. From what I read though, his thought seems light years away from Miller.


51

ericB

03/13/2008

6:00 pm

Allen_MacNeill:

As T. H. Huxley famously said:

“[Nature] warns me to be careful how I adopt a view which jumps with my preconceptions, and to require stronger evidence for such belief than for one to which I was previously hostile.

My business is to teach my aspirations to conform themselves to fact, not to try and make facts harmonise with my aspirations.”

Now that’s science!

If you have a moment, I would be interested to know how you apply this principle in regard to the question I put to you here.

Your insistent denial that there could be relevant empirical evidence (despite contrary statements from some who have studied it) has the appearance of giving artificial protection to “a view which jumps with my preconceptions” rather than “requir[ing] stronger evidence for such belief than for one to which I was previously hostile”.

How should that empirical evidence against relate to the business of teaching “aspirations to conform themselves to fact”?

[p.s. On a distinct note, since you did not contribute further in that thread, I hope you did not miss my sincere regard (in a post above that one) for your contributions and your example.]


52

vjtorley

03/13/2008

6:18 pm

Allen_MacNeill:

I have two questions regarding the evolution of the human brain. First, can you provide a rough, back-of-the-envelope calculation of how many mutations occurring in the human line since the human-chimp split would have had an effect on the development and/or functioning of the brain?

Second, is there any prospect of scientists in the future being able to situate these changes in their correct chronological sequence?

Best wishes,

Vincent Torley


53

RRE

03/13/2008

8:02 pm

“…only WE can add concept onto matter in the form of a machine or code.” Show me wrong please. Only humans.
Humanity has always been the only organism that can add concept onto matter in the form of a code or machine. That is our uniqueness. That is the image of God. All machines are made by man, with the exception of biological organisms. Biological organisms are the only machines found in the natural world (known universe) that we did not make from scratch. The genetic code, which is a holistic sequence of information read in codons (bits of 3) is the only code we did not intelligently designed. Writing your thoughts onto this website is you using a code which you have added onto matter using English. You are using a machine, the computer, to add the matter in time to produce your thoughts. Any writing is adding concept onto matter in the form of a code. Codes are tied to languages.
The bow is a simple machine which is a system that performs a function using at least one moveable part and one non-movable part which could be used to perform its function independent of the original agent. Only we can make one of those systems as well. Where is your monkey making machines or codes? Even a bird can intelligently design a complex round cup made of twigs, but no other species can design a machine or code.
Allen_MacNeill said: “And so, before people could do this (i.e. before the middle of the 19th century or thereabouts), they were not human, nor were they different from chimps and other animals in any other way, right?”
Writing is adding concept onto matter in the form of a machine or code. A monkey cannot even make an arrowhead. The bow was older than 19th century. The monkey won’t even place a rock as a pivot point against a stick to lift a big rock. Do you realize that? They can’t even make a WEDGE!
Wiki says: “A wedge is a portable inclined plane, used either to separate two objects, or portions of objects, lift an object, or hold an object in place, by the application of force to the wide end, which the wedge converts to force perpendicular to the inclined surfaces. The mechanical advantage of a wedge depends on the ratio of its length to its thickness. Where a short wedge with a wide angle does the job faster, it requires more force than a long wedge with a smaller angle.”
Wiki says: “The origin of the wedge is unknown, because it has been in use as early as the Stone Age. Circa 3000 BC, in Ancient Egypt quarrys, bronze wedges were used to break away blocks of rock used for construction. Wood wedges, that swelled after being wet, were also used. Some Native American tribes used antler wedges as a means of splitting and working wood to make canoes, houses, and other wood objects!”
http://en.wikipedia.org/wiki/W....._device%29
The origin of the wedge is unknown…perhaps because humans have always been able to make a wedge because humans were intelligently designed to develop machines, primates were not.
Allen_MacNeill said: “For that matter, I only know a very few people who can perform this operation — that is, convert a concept into a line of code. Does that mean that they, too, aren’t human? “
No, they are human too. Writing is a code that all other primates and animals cannot do. It’s based on the English language convention. Humans are the only species that can add concept onto matter in the form of a code or machine.
Allen_MacNeill said: “Were you human before you learned how to code? Will you remain so when old age reduces or eliminates your ability to do so?”
Humans as a species, is the only species that can add concept onto matter in the form of a machine or code. No — a man with his mouth shut, vocal cords ripped out, arms and legs chopped off cannot add concept onto matter in the form of a code or machine, but he’s still human don’t worry.
Allen_MacNeill said: “Tool use is clearly not the sole criterion by which humanity is defined. My little son (now just one year old) was fully human when all he could do was lie in the crib and look cute.“
Okay, once the human species obtains adulthood developmental stage, they become the only species on the entire planet and whole known universe to be able to add concept onto matter in the form of a machine or code. “Tools” are a useless comparative; the bird can make a tool such as a nest. Please name another species that can produce codes or machines and I’ll convert to atheism and give God the finger.

“IOW, what differentiates humans from other animals is no single qualitative difference, but rather a relatively large number of quantitative differences, which when added together define what we mean by “human.””
Being able to develop machines and codes IS a single qualitative difference. It’s the single biggest!—we are the only species that can do it. No other species. Your monkey can’t make a bow. Think about, all he can do is grab a stick and use it to get food, but so what, he’s not adding concept onto any matter at all, to produce a machine or code. You try to deflect and say that it’s not an important enough difference, but it is the most unique qualitative difference that can be compared when comparing any species in the ENTIRE ANIMAL KINGDOM.


54

PannenbergOmega

03/13/2008

8:08 pm

Is it possible that the Creator programmed everything into the early universe? Everything that would occur in cosmic/terriestrial history, the development of life and speciation. Could it all have been imputed in the begenining?


55

ericB

03/13/2008

8:40 pm

In response to PannenbergOmega 54, the biggest problem is the existence of symbolic codes and symbolic information that are fundamental to living organisms.

The association between symbol sequences and their meanings is determined by a consistent convention.

Because it is a convention, it is not required by any laws of physics or chemistry. You could not derive it from laws.

On the other hand, to function the association must be implemented, applied and interpreted consistently. It cannot be the product of chance.

The only known source for symbolic conventions is choice and directed effort by intelligent agents.

For a designer to build that into the beginning, there would have to be some storage for symbolic data and instructions from the beginning. Law and chance cannot create it later on.


56

RRE

03/13/2008

8:43 pm

Allen_MacNeill said: “But one could also just say “that’s the way the Intelligent Designer wanted it” and then go do something else that also wasn’t science…”
That’s a false condition. “That’s the way the Intelligent Designer wanted it” is trying to understand the intent of the designer, you may not be able to so scientifically, so what you said really means nothing—and no one says that in the Intelligent Design community. You are trying to confuse people — finding out how something originated and how something works are two totally separate concepts that you must explore so as to relate to the difference.

Allen_MacNeill said: “ID SUPPORTER***: Show me a way to empirically and unambiguously determine whether a code or physiological mechanism in a living organism was designed by an Intelligent Designer and I will believe in intelligent design as the origin of the complexity seen in the cellular machinery and code found in nature.”

Saying that people were intelligently designed at humans’ origin is an inference to the best possibility based on our observed experiences, recognizing UNIQUE qualitative differences when it comes to the origin of machines and codes versus all other structures in nature. That’s a scientific statement that can be tested against reality and falsified. All machines and codes had intelligent agency as a cause when exploring their origin. Furthermore, the genetic code is the only code that we can find that Man did not intelligently design, which also happens to build up to produce and maintain the only machines that man did not intelligently design. So we can conclude that this ‘only code’ had to have been designed as well — Simply because we find no exceptions to the rule. So empiricism and experience prevail over metaphysical naturalistic mechanisms.


57

PannenbergOmega

03/13/2008

8:52 pm

Hmmm. Interesting.
Maybe we don’t fully understand what the universe is right now. Maybe it is a cosmic information processing system and we are apart of the designers computer program.


58

RRE

03/13/2008

8:56 pm

And studying the causes involved in the origin of something has nothing to do with studying how something works. So there is no magic science stopper when it comes to ID because ID proponents are Intelligent Designers themselves, and studying how the genetic code or how the human body (or another other body plan) works is well within their abilities and has nothing to do with origins. Intelligent causes are ALWAYS required when we look at the origin of any machine or code. If you exclude intelligent causes as to the origin of a machine or code, you are deceitful and not practicing science, but metaphysics, simply on the basis that you have not shown anyone how a code or machine could come about without intelligent causation. Please don’t be intellectually dishonest, and instead demonstrate in reality a machine or code that came into existence without intelligent causes.

It is up to you to to show us your code or machine without intelligence. We can show you that intelligent causes CAN produce machines and codes. You must show a purely naturalistic way. I am waiting.


59

RRE

03/13/2008

9:04 pm

PannenbergOmega said: “Hmmm. Interesting.
Maybe we don’t fully understand what the universe is right now. Maybe it is a cosmic information processing system and we are apart of the designers computer program.”

Maybe everything is controlled by an electro-static force and gravity is an infinitesimal factor in the universe. Maybe there is a lot of electrified gas floating around the universe, who knows right? Maybe things all ride on the electro-magnetic spectrum.


60

Paul Giem

03/13/2008

9:33 pm

I have had the chance to read the entire article now, and need to make a correction.

My statement (26) about the investigators checking on all the chromosomes was correct, and Allan’s statement in that regard is still in error.

However, the X chromosome was not nearly as similar in humans and chimps as I inferred from the abstract. They expected 0.918 to 0.943 of the mutations they got on the other chromosomes, and in point of fact got only 0.835 (+/- 0.016), which means that if one believes the model of hybridization, it would have happened when the two populations were about 10% along to their eventual destinations.

Thus when I criticized Allan (9) and said that it was the late ancestors rather than the early ancestors that interbred, I was wrong and Allan was correct about what the article said. Sorry, Allan.

Given that areas on individual chromosomes could vary from 84% to 147% of expected, this value of 10% is easily within the noise range, although it is unusual for a whole chromosome to be consistently that low.

However, the easiest explanation for this data is simply that the “molecular clock” is not all that accurate. From an evolutionary perspective, the article gives further evidence of that. Even assuming a branching of orangutangs from the eventual hominid line at 20 Ma (million years), which is considered high, humans and chimps would have diverged at some 6.3 Ma which is considered low