Uncommon Descent


12 March 2008

Complex speciation of humans and chimpanzees

Mario A. Lopez

John Wakeley1

Abstract

Arising from: N. Patterson, D. J. Richter, S. Gnerre, E. Lander & D. Reich Nature 441, 1103–1108 (2006); Patterson et al.

Genetic data from two or more species provide information about the process of speciation. In their analysis of DNA from humans, chimpanzees, gorillas, orangutans and macaques (HCGOM), Patterson et al.1 suggest that the apparently short divergence time between humans and chimpanzees on the X chromosome is explained by a massive interspecific hybridization event in the ancestry of these two species. However, Patterson et al.1 do not statistically test their own null model of simple speciation before concluding that speciation was complex, and—even if the null model could be rejected—they do not consider other explanations of a short divergence time on the X chromosome. These include natural selection on the X chromosome in the common ancestor of humans and chimpanzees, changes in the ratio of male-to-female mutation rates over time, and less extreme versions of divergence with gene flow (see ref. 2, for example). I therefore believe that their claim of hybridization is unwarranted.

[Bold added]

Just curious…How does interspecific hybridization occur between a Pan & Homo ?

 

SociBook del.icio.us Digg Facebook Google Yahoo Buzz StumbleUpon
571 Responses

1

PannenbergOmega

03/12/2008

5:08 pm

So this says that chimps and humans were interbreeding?

A. I thought ID believed that there was a great differnce between chimps and humans. That you can’t determine kinship by genetic similarity. It could be common design.

B. Dr. Dembski has said that the evidence doesn’t support Universal Common Descent. Maybe he is wrong?

What is going on here? Is ID full full of malarkey? Someone isn’t telling the truth here.


2

bFast

03/12/2008

5:22 pm

Just curious…How does interspecific hybridization occur between a Pan & Homo ?

We know that hybridization occurs between Bison (genus Bison) and cow, (genus bos). This is an equivelant hybridization.

Dr. Dembski has said that the evidence doesn’t support Universal Common Descent. Maybe he is wrong?

Other IDers, such as Behe, support common descent. I, for one, have concluded from the evidence that there is a common ancestor between chimps and humans. If there is any question of universal common descent, then the breaks in common descent happen far up the ladder. There is some validity in the argument that the cambrian explosion, for instance was not an event of common descent.

The nearer the split between chimp and human, the more potent becomes ReMine’s “Haldane’s dilemma” challenge. (ReMine, by the way, suggests that there is too much genetic diversity between human and chimp for there not to have been a De Nuveau creation. I beg to differ.)

Further, consider the HAR1F gene. It is different in 18 point mutations with the chimp. Big deal? It is ultra-conserved in chickens and mice! The bottom line is that this thing had to have all 18 mutations happen at the same time. Such an event is, in itself, beyond the UPB.

PannenbergOmega, there is a significant contingent of IDers who find no reason to question common descent. I think that we are more ready to question common descent than the darwinists, but common descent actually has strong supporive evidence.


3

Frost122585

03/12/2008

5:32 pm

The kind of science this article is talking about is mere speculative science. DNA is often similar and often not among species that are and are not related. My point is that the evidence the authors use is questionable as almost all of evolution science is. This is to be taken with a grain of salt. There are currently all kinds of opposing theories about how evolution and diversification happened. This is one of many and they cant all be right.


4

PannenbergOmega

03/12/2008

5:56 pm

Interesting. Thank you bFast.
It’s too bad (in my opinion) that there is so much evidence for common ancestry. I don’t see how you can reconcile it with the Biblical account of creation.

What I’m saying is, I wish the data undeniably supported the Biblical account of creation.


5

Paul Giem

03/12/2008

6:42 pm

I’d just like to second Frost’s (3) point. If I understand correctly, the article is claiming that the X chromosome is not as divergent between chimps and humans as other chromosomes are. If so, those are the facts. The proposed explanation of those facts appears to leave something to be desired. If there was hybridization, why was the X chromosome the only chromosome that got shared? Shouldn’t there be other chromosomes that were also shared? If the gene transfer went in only one direction, shouldn’t there be two widely divergent versions of the X chromosome in either humans or chimps, or if it went in both directions, in both? (Other questions come up. Was the sharing before or after the divergence between chimpanzees and bonobos? WHere do gorillas fit in?)

I’m not saying that there is no theoretical possibility that this could have happened. But it does seem that the model being proposed doesn’t explain the facts well.

On the other hand, If someone (or Someone) designed the two species, one could easily conceive of a re-use of some sections of code with minimal modification, like the X chromosome, and highly modified code in other areas, such as the HAR1F gene, and perhaps even areas of totally new code.

So, PannenbergOmega, I actually don’t see this as evidence of hybridization, let alone common ancestry.


6

Mario A. Lopez

03/12/2008

7:26 pm

bFast,

I disagree. First, the chromosomes are off by a couple, which will likely produce a sterile hybrid (an evolutionary dead end). Of course, this is just speculation, since the article says that “the X chromosome is explained by a massive interspecific hybridization event in the ancestry of these two species.” So, the hybrid event is only conjecture. BTW—I am not surprised that evolutionists would take this line of reasoning. You know, they will eventually have to point to the actual ancestors. Second, there are stark reproductive differences between chimps and humans. What is the likelihood that their ancestors were not? Third, the genetic differences are much greater than originally thought:

http://www.sciencemag.org/cgi/...../5833/1836

http://www.newscientist.com/article.ns?id=dn5044

Sorry, I don’t think that the evidence for common ancestry is as solid as you hope.


7

Frost122585

03/12/2008

7:30 pm

In regards to what Paul is saying,

Id like to aso add that if in fact man bread with apes and we are the result of such an evolutionary mechinism- then we apparenty aren’t man.

Apparently man lived along time ago and disappeared. So I guess we should address each another not as fellow man but fellow hybrid.

I. Don’t. Buy it.

However, looking at the three apes we have running for president: Hillary, Obama and Mccain; I dont think we can totaly rule out the above hypothesis.


8

Allen_MacNeill

03/12/2008

8:04 pm

Paul Glem asked:

“If there was hybridization, why was the X chromosome the only chromosome that got shared?”

It wasn’t; it was the only one “studied” in this investigation. There are many other pieces of genetic evidence pointing to the same conclusion. Perhaps one of the best is the discovery that human chromosome 2 is actually two chromosomes glued together: two chromosomes that are separate in chimpanzees (and all other primates). That is, in the divergence between the line of primates that evolved into chimps (genus Pan) and humans (genus Australopithecus and genus Homo) one of the significant genetic changes that occurred is that two of the chromosomes of the ancestral ape-like primate became fused to form the human chromosome 2.

In other words, there are multiple lines of evidence all supporting the assertion that chimps and humans diverged from a common primate ancestor somewhere around 6 million years ago.


9

Allen_MacNeill

03/12/2008

8:17 pm

Furthermore, I think there is some confusion here. The authors of the report didn’t assert that chimps and humans hybridized. What they concluded (based on multiple lines of genetic evidence) is that the early diverging lines of primates that would eventually become chimps and primates that would eventually become humans interbred for quite a while.

This is a well-known phenomenon among diverging lines of eukaryotes, especially animals. For example, mallard ducks (Anas platyrhynchos) and wood ducks (Anas rubripes) readily hybridize in zones of overlap (such as within walking distance of my house here in Ithaca), as do blue warblers (Vermivora pinus) and golden-winged warblers (Vermivora chrysoptera) in the Adirondacks where my family goes camping. In the latter case, there are multiple hybridization events, similar to what has been inferred for the divergence between the line that became chimps and the line that became humans.

That is, in the early stages of the divergence between two incompletely isolated populations, hybridization is common. It is only after considerable divergence has occurred that complete reproductive isolation eventually takes place.

And sometimes it doesn’t (or it breaks down) and what were two separate populations go back to being one species again. This has apparently happened between the coyoté (Canis latrans) and the red wolf (Canis rufus) in the southeastern United States.

Also, this should answer the question of how it is that chimps and humans hybridized. The simple answer is: they didn’t, their ancestors (which were almost phenotypically indistinguishable) did.


10

Allen_MacNeill

03/12/2008

8:20 pm

Mario Lopez wrote:

“First, the chromosomes are off by a couple, which will likely produce a sterile hybrid (an evolutionary dead end).”

This subject has been addressed before, in this blog and at mine. For more on the subject, I refer you to:
http://evolutionlist.blogspot......eding.html


11

jerry

03/12/2008

8:45 pm

If anyone wants a fun read on something related to this topic, get Michael Crichton’s “Next.” I read all 423 pages in two nights reading. Lost a lot of sleep because I couldn’t put it down. It is a novel that has a bibliography.

It is all about genetics issues and the two most enjoyable characters in the book are a transgenic chimp/human named Dave and a transgenic parrot named Gerrard who can do math and repeat everything he ever heard. I got to believe Gerrard will win an academy award if they make a movie of the book.

The main theme of the book is about who owns genes and how they can be used in research and medicine and the ethics of cloning and creating transgenic species.


12

PannenbergOmega

03/12/2008

8:47 pm

This is nuts. People are not chimps.
Or chimp/human hybrids.


13

Borne

03/12/2008

9:00 pm

bFast: “I, for one, have concluded from the evidence that there is a common ancestor between chimps and humans.”
Have you indeed? I say, baloney on that conclusion! :-o

All the evidence you may wish to point to must be speculated upon, extrapolated and conjectured into Darwinian theory before any such conclusion can be made.

The same data can be interpreted quite differently into the ID paradigm of a common designer.

We supposedly share 50% DNA with bananas. Does that mean we also share common ancestry with them? Or toads? Or mice? Or any organism you care to mention?

Under this common ancestry line of reasoning we ought to consider the following:
How about canning Darwins’ man descending from primates and rather saying that primates descend from us?

Really! By what rule must it be the contrary? Absolutely not the laws of thermodynamics at any rate.
So what is it?

Why are we so convinced of our own “superiority” or being “higher”? How does descended from = higher?

Under real Darwinism (ie Darwinism taken to it’s logical conclusions) there is no such thing as superiority, only different levels of complexity and intelligence etc. It’s all just an illusion of superiority since nature knows nothing of superior, inferior etc.

Materialism has no grounds whatsoever for declaring intelligence or anything at all a basis for so-called “higher” and “lower” terms applied to life forms.

If materialism is true then intelligence itself is meaningless - just like the whole universe.
Upon what grounds then does the mere illusion of intelligence = higher or superior?

Once you swallow the common ancestor line - at least to the degree of humans/chimps sharing one - you cannot escape the hook and sinker either.


14

dacook

03/12/2008

9:01 pm

Just curious…How does interspecific hybridization occur between a Pan & Homo ?

Well, first you put on some soft music. Then you dim the lights. Pour some wine, set out some chocolate, maybe a banana…


15

Frost122585

03/12/2008

9:01 pm

Well, Pannenberg, they aren’t really saying that we are hybrids- they are saying that there is a similarity between chimps and humans in the X chomosome. The “theory” is that people mated with a ape like ansester of both chimps and humans. But.. we know that evolution requires mutation as a rule anyway. So, why then could the x chromosome not simply be the result of a common ansester that had the mutation happen prior to any interbreeding?

The point is that they don’t know. They are just comming up with somthingnew or controversial to get attention and more grant money. Same ol’, same ol’.


16

Allen_MacNeill

03/12/2008

9:04 pm

PannenbergOmega wrote:

“This is nuts. People are not chimps.
Or chimp/human hybrids.”

As I have already pointed out, the authors of the article we are discussing suggested nothing of the kind. Rather, they suggested (on the basis of multiple lines of genetic evidence) that the of chimps and the of humans apparently hybridized several times. This is not an uncommon event during the early stages of cladogenic divergence. Among animals in particular, the early stages of cladogenic divergence are usually mediated primarily by changes in behavior, rather than large-scale changes in the genome. Only after two diverging lines have remained separate for a considerable length of time do sufficient genetic differences accumulate to render hybridization impossible.

The situation is very different in plants, which hybridize easily (mostly because they are relatively tolerant of changes in chromosome number). Since Darwin published the Origin of Species botanists have observed the origin of dozens of new species of plants, mostly through two genetic processes: autopolyploidy and allopolyploidy, both of which are facilitated by the tolerance I mentioned earlier.

Fungi hybridize even easier than plants in many cases, and for probably very similar reasons: neither plants nor fungi can move around very easily, and so must retain the ability to mate with whomever is nearby.

Bacteria don’t even have what would qualify as “species” among eukaryotes. Not only do they “interbreed” readily by exchanging genetic material, they can also exchange genetic material with viruses, and even scarf up free DNA from their environment.

So, the whole question of the “origin of species” is mostly a question restricted to animals (i.e. members of the kingdom Animalia), and in many, many cases there is strong genetic evidence that the process of cladogenesis (i.e the splitting of one panmictic population into two or more) has happened and is happening among animals as well.

Once again, read about the hybridization between mallard ducks and wood ducks, blue warblers and golden-winged warblers, and between coyotés and red wolves, and ask yourself if there is any empirically verifiable (i.e. not metaphysical or religious) reason why the same processes can’t have occurred between the ancestors of chimps and humans?


17

Allen_MacNeill

03/12/2008

9:05 pm

Allen MacNeill wrote:

“…that the of chimps and the of humans apparently hybridized several times.”

Somehow a crucial word was dropped from this sentence. It should have read:

“…that the ancestors of chimps and the of humans apparently hybridized several times.”


18

Allen_MacNeill

03/12/2008

9:11 pm

Borne asked:

“We supposedly share 50% DNA with bananas. Does that mean we also share common ancestry with them? Or toads? Or mice? Or any organism you care to mention?”

The answer is YES. All eukaryotes share a surprising amount of genetic and phenotypic characteristics, all of which point to a common ancestor that lived somewhere around a billion years ago. Please note that the phrase “common ancestor” is not intended to refer to a single individual, but rather to a population of individuals that exchange genetic material with each other.

The exchange of genetic material is the crucial point, here. Bacteria do it so often and so easily that there aren’t really “species” of bacteria the way we think of them among eukaryotes (especially animals). This is directly relevant to your question, because a billion years ago, virtually all living organisms were “bacteria” (or, to be more precise, prokaryotes). This means that they were just as likely to have exchanged genetic material as bacteria are today, and so yes, there is very strong genetic evidence that all living eukaryotes share a common ancestor with a group of unicellular symbiotic bacteria that lived about a billion years ago.


19

Allen_MacNeill

03/12/2008

9:17 pm

Borne wrote:

“How about canning Darwins’ man descending from primates and rather saying that primates descend from us?”

This comment demonstrates a basic misunderstanding about biological classification. “Man” didn’t “descend from primates”; rather, humans ARE primates, a fact that even Linnaeus recognized (despite being a young Earth creationist). This means that the converse is equally mistaken; primates can’t “descend from man” anymore than Fords can “descend” from automobiles. Fords automobiles, just as chimps and humans are both classified as primates (i.e. members of the order Primates, within the class Mammalia, phylum Chordata, kingdom Animalia, domain Eukarya).


20

Allen_MacNeill

03/12/2008

9:18 pm

Again, a crucial word was dropped:

“Fords are automobiles…”


21

PannenbergOmega

03/12/2008

9:32 pm

Thank you Frost and Borne for clearing that up for me.

http://www.randomhouse.com/cat.....0307396266


22

RRE

03/12/2008

9:36 pm

It may quite be possible that an intelligent agent used the chimpanzee DNA as a base for his program upgrade to make us, the result of which a mind can now add concept onto matter in the form of a code or machine.

What better way to show God’s connectedness to us, and proof of His presence in the past, then to say that all the machines and codes in all of the known universe were created by man with the exception of His created biological organisms and their genetic code and machinery. We possess His image, why not proclaim it as our established cultural TRUTH?

Let the Darwinist tell us how a machine and a code could come into existence without a mind. If science is what we can observe, test and demonstrate, let them show us a code or machine that comes from stochastic chemical processes. Let them show us how a code or machine can come into existence without using intelligent causes. They cannot, it should be Law.

Why does the Darwinist confuse the populace by telling us chimps can use tools?
I think we should concentrate on the central difference rather than the cosmetic commonalities, which is that only WE can add concept onto matter in the form of a machine or code. I want to see a chimp or other simian add concept onto matter that is a code or machine. Make a bow and arrow or similar. They cannot. This is human exceptionalism, the word ‘tools’ used to describe what chimps are doing is misleading, and ABSOLUTE propaganda. The monkey will not understand grammar either (nor design for us a code) as pointed out by Denise O’Leary. Monkey don’t know John killed Betty from Betty killed John.

I think it will be shown that humans and chimps (along with the other primates) did not in fact diverge through a hybridization event. I have to be open to the possibility that an intelligent agent interrupted/manipulated the chimp DNA code and possibly the original EGG cell as well. I think the fused chromosomes could lead to more details as to which theory is true. Are fused chromosomes unique to humans? Is this consistent with our human exceptionalism?

If you do not believe in human exceptionalism, then please tell me why I can see machines in nature, and chemical codes represented in, and changing into other, complex shapes and know that they are such? The genetic code is holistic just like any other code that man can create, such as these very words you are reading, or the machine code that is the base of our computers. How do you not see the connection to intelligent design? How are you more likely to believe that the Earth is analogous to the greenhouse, but are not willing to make the direct inference that intelligent causes play a role in determining the origin of machines and codes every single time with no exception?

DARWINIST*** Show me a code or machine that was not intelligently designed and I will believe in methodological naturalism as to the origin of the complexity seen in the cellular machinery and code found in nature.


23

bFast

03/12/2008

10:30 pm

Borne:

All the evidence you may wish to point to must be speculated upon, extrapolated and conjectured into Darwinian theory before any such conclusion can be made.

The best single case I have seen to accept the common descent of chimps and humans is the phenomenon of specific point mutations which cause disease that both chimps and humans share. The most natural explanation I can find is that the point mutations happened in the common ancestor. The other options are:
> They happened more than twice, however there are hundreds.
> The designer intentionally inserted the disease-causing mutations. A yucky thought.

The same data can be interpreted quite differently into the ID paradigm of a common designer.

Please do interpret.

Mario A. Lopez:

First, the chromosomes are off by a couple, which will likely produce a sterile hybrid (an evolutionary dead end).

My understanding is that the common mouse has between 20 and 40 chromosomes, depending on which one you catch, and they all pretty much interbreed. It would appear that the chromosomal barrier is not by any means infinite.


24

PannenbergOmega

03/12/2008

11:01 pm

bFast, didn’t you write once that you thought there was evidence of recent engineering in the creation of man?

What do you think of Behe’s The Edge of Evolution?


25

ungtss

03/13/2008

12:18 am

The best single case I have seen to accept the common descent of chimps and humans is the phenomenon of specific point mutations which cause disease that both chimps and humans share. The most natural explanation I can find is that the point mutations happened in the common ancestor. The other options are:
> They happened more than twice, however there are hundreds.
> The designer intentionally inserted the disease-causing mutations. A yucky thought.

Which diseases are you talking about? Many single point mutation diseases occur spontaneously in individuals. If a particular mutation can occur independently in two humans (rather than being inherited from a common ancestor) then why should it surprise us that apes are subject to the same mutation? Or do you have in mind a particular disease which is only inherited and never arises spontaneously?


26

Paul Giem

03/13/2008

12:42 am

Allen_MacNeill (8,9),

I am currently operating off of the abstract, and will correct that by reading the article, tomorrow if things work out. However, in the abstract, after the authors argue that the chimpanzee-human split happened some 6.3 million years ago, they state that “chromosome X shows an extremely young genetic divergence time, close to the genome minimum along nearly its entire length.” Their implication seems to be that the X chromosomes, in contrast to the others, are markedly similar. If hybridization happened 3.15 million years ago, the X chromosomes would, by standard theory, have approximately 50% of the changes that other chromosomes do. Since the authors cite figures from 84% to 147%, I doubt that 50% would be that impressive. Let’s say that the correct figure for the X chromosome was 5% of the difference of the rest of the chromosomes. That suggests that any hybridization that could account for the X chromosome near-identity would have had to occur at 315,000 years ago. We are now talking 95% human and 5% common ancestor mating with 95% chimpanzee and 5% common ancestor.

So your statement
The authors of the report didn’t assert that chimps and humans hybridized. What they concluded (based on multiple lines of genetic evidence) is that the early diverging lines of primates that would eventually become chimps and primates that would eventually become humans interbred for quite a while.
is incorrect. it is not the early but the late lines that interbred according to this scenario. That is, almost humans and almost chimpanzees would have to interbreed.

That means that your statement
Also, this should answer the question of how it is that chimps and humans hybridized. The simple answer is: they didn’t, their ancestors (which were almost phenotypically indistinguishable) did.
is also in all probability incorrect. Unless one wants to say that 95% of the genetic change had to happen before humans and chimpanzees were easily distingushable, in order to explain the X chromosome similarities by interbreeding, one has to postulate fairly distinct phenotypes.

I am aware of the possibilities of crossbreeding also, although I do not mind the lecture on ducks and coyotes, as others may not have heard it. I wasn’t even challenging whether humans and chimpanzees could be fertile together (I understand that Stalin tried it with gorillas and humans and it didn’t work, so I am doubtful, but it isn’t against my religion to believe that it might work, although it is against my religion to try it :) ), but I was simply commenting that using it as the explanation for the “extremely young genetic divergence time” of the X chromosome had serious scientific difficulties.

When I said
If there was hybridization, why was the X chromosome the only chromosome that got shared?
and you answered,
It wasn’t; it was the only one “studied” in this investigation.
that answer was also incorrect. Note that multiple chromosomes were studied. Otherwise, the near-identicality of the X chromosomes would have been simply assumed to be the norm. One cannot note how much less divergent the X chromosomes of the two lines are until one has a standard by which to judge them. Maybe you can back up and try another explanation of why the X chromosome alone was shared during the last hybridization event, and why every individual switched over to the new X chromosome.

It looks like you may have mistaken my criticism of the explanation given in the paper for the X chromosomes being nearly identical, with a criticism of the common descent of chimps and humans. I do have such criticisms, but for purposes of discussion was not making them. I was merely noting that the proposed mechanism did not seem to fit the facts.


27

DaveScot

03/13/2008

6:03 am

Allen

I’m curious about the difference in chromosome number between humans and other primates. How is it determined that two primate chromosomes fused in the human lineage rather than one primate chromosome split to form the other primates?

I’m not sure I buy your story about plants hybridizing so easily. Pollen travels quite a ways both airborne and via insects and I don’t know of much in the way of hybrids from different species emerging from it. Flowering plants might simply be more promiscuous as they passively get exposed to pollen from many other different species (which doesn’t result in hybrids) while at the same time they get exposed to many close variants of their own species which does result in hybrids. Animals aren’t typically so unselective about where the male germ cells come from. Polyploidy doesn’t seem like a very good example of Darwinian speciation either as it’s a saltation not a gradual divergence and there’s no new genetic material but rather just a wholesale duplication of chromosomes wherein the difference in chromosome number lowers (but doesn’t eliminate) fertility between polyploid variants.


28

allanius

03/13/2008

10:49 am

So one group of august Darwinists thinks there was hybridization and another thinks not. What a dustup! But the good news here is there can be two widely divergent interpretations of the same data—and both can be taken seriously by the science establishment! All that’s needed, apparently, is a Framework (not to be confused with an explanatory filter), a knack for the Unblushing Inference, and a Titillating Premise. Two “non-overlapping magisteria”? Not at all. These days the scientist can be just as liberated from the limitations of solid reality as any preacher or poet.


29

Borne

03/13/2008

12:17 pm

Allen_MacNeill:
1. “The answer is YES. All eukaryotes share a surprising amount of genetic and phenotypic characteristics…”
Well that is the Darwinian version. Sorry I’m not buying your conclusions. Sharing genetic characteristics does not = Darwinism unless you already have a pre-commitment to that hypothesis.

Calling in your mentioned evidence for bacteria to man evo requires a huge amount of faith in the Darwinian scenario. Something that has not been and cannot be demonstrated empirically.

It all sounds so plausible when one listens to the 1000’s of just-so stories. Stories ubiquitously interspersed with complex sounding talk of genes, mutations and the almighty power of selection.

Darwinists however, never seem to noticed that the Darwinian scenarios end up looking more and more like supernatural creation but with no god.

“And as Darwinists and neo-Darwinists have become ever more adept at finding possible selective advantages for any trait one cares to mention, explanation in terms of the all-powerful force of natural selection has come more and more to resemble explanation in terms of the conscious design of the omnipotent Creator.”

(Ho M-W. & Saunders P.T., eds., “Beyond Neo-Darwinism: An Introduction to the New Evolutionary Paradigm,” Academic Press: London, 1984, p.x)

“The ‘modern evolutionary synthesis’ convinced most biologists that natural selection was the only directive influence on adaptive evolution. Today,
however, dissatisfaction with the synthesis is widespread, and creationists
and antidarwinians are multiplying. The central problem with the synthesis is its failure to show (or to provide distinct signs) that natural selection of random mutations could account for observed levels of adaptation.”

(Leigh E.G., Jr, “The modern synthesis, Ronald Fisher and creationism,” Trends in
Ecology and Evolution, vol. 14, no. 12, p..495-498, December 1999, p.495)

IOW, When you look at the details involved in transforming bacteria into man and near simultaneously into the millions of other species - without any guidance, target, purpose or adequate mechanism, Darwinism looks totally ludicrous.

2. “rather, humans ARE primates,”
Thanks for your correction. You’re right, and I should have written “apes” rather than primates. I’m not a biologist. I’m an informatics specialist.


30

Borne

03/13/2008

12:37 pm

bFast: ” They happened more than twice, however there are hundreds.

Please do interpret.”
There are a couple of problems I see in this for your interpretation.
1. If you are ready to accept to macro-evo of ape to man you may as well buy into the whole of Darwinism because we’re talking major differences and novel creations.
2. If you must base such a conclusion on shared diseases caused by the apparently exact same mutations you will have to look at all species sharing the same. I suggest you look first at mice/human disease. There’s tons of data on those two.
So we descend from mice too?
Sooner or later it’ll catch up with ya. ;-) You’ll either turn full Darwinian or make a better decision such as looking for better explanations. Such as what causes such mutations in the first place? And, whether the same cause could have been responsible for the many cases you might mention in various species in the same time period - use your imagination ;-).

3. Suppose you were to examine the same data before Darwin ever existed. What kind of reasoning would you use then, w/o the macro-evo paradigm in mind? And what possible alternative conclusions could you make?


31

Allen_MacNeill

03/13/2008

2:04 pm

DaveScot asked:

“How is it determined that two primate chromosomes fused in the human lineage rather than one primate chromosome split to form the other primates?”

All animal chromosomes have special sequences called telomeres at each end. These telomeres are part of the process that regulates how often cells can divide. Basically, each time a cell divides by mitosis, it loses a telomere at the end of each chromosome. When they’re all gone, the cell can’t divide any more. This prevents cells from becoming cancerous (although some cancers produce an enzyme called telomerase that puts back the telomeres).

Bottom line is: you can tell the end of a chromosome because it has telomeres.

Now, the situation with human chromosome #2 is that it has a set of telomeres in the middle, as well as at the ends. Also, the set in the middle consists of two sets of telomeres arranged in reverse order.

Upon closer examination, it has also been found that the genes in the two segments of human chromosome #2 (separated by the embedded telomeres) have approximatey the same genes in approximately the same order as the two unfused chromosomes found in chimps and other primates.

There is more evidence having to do with the placement of centromeres in the chromosomes. Rather than go through a long explanation, I refer you to:

http://www.evolutionpages.com/chromosome_2.htm

Ergo, there are two logical interpretations of these multiple lines of empirical evidence:

1) human chromosome #2 consists of two chromosomes found in other primates, fused together at the location of the back-to-back embedded telomeres

2) an “intelligent designer” inserted the back-to-back embedded telomeres in the middle of human chromosome #2, arranged all the genes to look just like they should if they had come from the two unfused non-human primate chromosomes, and then inactivated the back-to-back embedded telomeres (i.e. they have no detectable function)

Not only do I prefer the first interpretation on purely scientific grounds (i.e. it comports with all of the other evidence pointing to a common human-chimp ancestor, plus being the “simplest” explanation a la Occam’s razor), it also does not require the intervention of an “intelligent designer” who is also a deliberate prevaricator.


32

Allen_MacNeill

03/13/2008

2:12 pm

RRE wrote:

“…only WE can add concept onto matter in the form of a machine or code.”

And so, before people could do this (i.e. before the middle of the 19th century or thereabouts), they were not human, nor were they different from chimps and other animals in any other way, right?

For that matter, I only know a very few people who can perform this operation — that is, convert a concept into a line of code. Does that mean that they, too, aren’t human?

Were you human before you learned how to code? Will you remain so when old age reduces or eliminates your ability to do so?

Tool use is clearly not the sole criterion by which humanity is defined. My little son (now just one year old) was fully human when all he could do was lie in the crib and look cute.

IOW, what differentiates humans from other animals is no single qualitative difference, but rather a relatively large number of quantitative differences, which when added together define what we mean by “human.”


33

Allen_MacNeill

03/13/2008

2:18 pm

RRE asked:

“Are fused chromosomes unique to humans? Is this consistent with our human exceptionalism?”

Not at all. Both fused and fissioned chromosomes are common throughout the four kingdoms of eukaryotes. Indeed, the question as to why certain species have many chromosomes (such as frogs and ferns) while others have many fewer (such as humans) is a very interesting one from the standpoint of evolutionary biology. Answering it requires that one look long and hard at the patterns of chromosome number, and try to correlate those with environmental stresses, evolutionary pressures, and historical contingency.

But one could also just say “that’s the way the Intelligent Designer wanted it” and then go do something else that also wasn’t science…


34

Allen_MacNeill

03/13/2008

2:26 pm

RRE wrote:

“DARWINIST*** Show me a code or machine that was not intelligently designed and I will believe in methodological naturalism as to the origin of the complexity seen in the cellular machinery and code found in nature.”

To which I reply (shouting in response to the shouting):

ID SUPPORTER***: Show me a way to empirically and unambiguously determine whether a code or physiological mechanism in a living organism was designed by an Intelligent Designer and I will believe in intelligent design as the origin of the complexity seen in the cellular machinery and code found in nature.

And please make certain that the empirical evidence you provide unambiguously differentiates between the two processes in a way that can be verified using standard statistical analysis. Then publish your results and wait for the Nobel committee to give you a call (it’s virtually guaranteed).


35

Allen_MacNeill

03/13/2008

2:31 pm

DaveScot asked about the details of speciation events and their relationship to chromosomal changes and other genetic events, especially in plants. Rather than respond to each point, I refer you to:

http://evolutionlist.blogspot......cious.html


36

PannenbergOmega

03/13/2008

2:40 pm

If Darwinists want sympathy, you’ve come to the wrong place.

Also, your holiet than thou attitude is getting a bit old. After all it was your Darwinian philosophy that helped produce Hitler.


37

Allen_MacNeill

03/13/2008

2:42 pm

Borne asked:

“So we descend from mice too?”

No; once again, the answer (based on multiple lines of empirical evidence) is that mice and humans descend from a common ancestor (similar to a tree shrew) that lived in the Paleocene (or perhaps somewhat earlier in the Cretaceous.

The phylogeny of mammals has been worked out in detail, based on mutiple lines of anatomical, genetic, and ecological evidence. I recommend checking out the following as an introduction to this fascinating topic:

http://en.wikipedia.org/wiki/Evolution_of_mammals

In my opinion (as a biologist who specializes in mammals, especially primates), this is one of the best articles on evolution in Wikipedia. Although there are a few inaccuracies, overall it’s amazingly concise and comprehensive.


38

Charlie

03/13/2008

2:48 pm

Hey moderators,
I think it’s really time to clean out the sock drawer.


39

Charlie

03/13/2008

2:50 pm

Hi Allen,
Coming on the heels of your comment my suggestion might look like it refers to you. It doesn’t, not at all.


40

Allen_MacNeill

03/13/2008

2:53 pm

Borne wrote:

“Calling in your mentioned evidence for bacteria to man evo requires a huge amount of faith in the Darwinian scenario.”

On the contrary, the phylogenies you describe have only come about through the opposite of faith. Dogged hard work mostly, combined with a fierce skepticism about proposed phylogenies, especially in the absence of overwhelming empirical data. Phylogeneticists nearly get into fist fights at conferences over proposed phylogenies. The reason? Not enough evidence, or evidence that is ambiguous. And so we fight it out, subjecting each other’s proposals to the most withering storms of criticism, both publicly and (especially) privately.

As T. H. Huxley famously said:

“[Nature] warns me to be careful how I adopt a view which jumps with my preconceptions, and to require stronger evidence for such belief than for one to which I was previously hostile.

My business is to teach my aspirations to conform themselves to fact, not to try and make facts harmonise with my aspirations.”

Now that’s science!


41

Allen_MacNeill

03/13/2008

2:56 pm

Thank you, Charlie, I appreciate your disclaimer. I’ve occasionally been accused of being a meat puppet, but never a sock puppet ;-) That’s why I always and only use my real name, both here and elsewhere, online and in print. I take responsibility for everything I write, and hide behind nothing except my reputation as a scholar and a scientist.


42

DaveScot

03/13/2008

3:00 pm

Allen

All you had to say was there are two telomeres in the middle of the chromosome. Theoretically the telomeres could have been inserted by random mutation into an unfused chromosome which later split in two at the convenient join. But that doesn’t seem as likely as a fusion so I’ll call myself satisfied with a fusion as the best explanation.


43

Allen_MacNeill

03/13/2008

3:01 pm

Hmm, looks like I’m not up on the more recent definitions of “meat puppet.” I used the term to mean “an animal whose behavior can be inferred to be directed by conscious thought, rather than pure instinct”. That is, our bodies can be thought of as “meat puppets” of our minds.

Ah, well, looks like I need to spend even more time at Wikipedia…


44

Allen_MacNeill

03/13/2008

3:11 pm

DaveScot wrote:

“Theoretically the telomeres could have been inserted by random mutation into an unfused chromosome which later split in two at the convenient join.”

That would only explain the anomalous presence of two back-to-back telomeres in the middle of human chromosome #2. It would not explain why the genes in the two fused segments line up “in register” with very similar genes in the unfused chromosomes of other primates, nor why the centromere of human chromosome #2 lines up with the centromere in non-human primate chromosome 2p, nor why the remnants of the other (now non-functional centromere is located in the other segment of human chromosome #2. All of these lines of evidence point to the same conclusion: that human chromosome #2 was formed by the fusion of two chromosomes found separately in all other primates.

An interesting question is, did this fusion event have anything directly to do with the genetic and phenotypic divergence between the two lines of primates that eventually became chimps and humans? the answer is not immediately obvious, as simply fusing together two chromosomes doesn’t change the genetic information they carry nor how it is expressed, it only changes how it’s segregated during meiosis.

It does, however, strongly suggest that the two evolving lines of primates were sufficiently isolated from each other for long enough for such genetic differences to accumulate. So, what caused this separation, how long did it last, and what happened during it? All good questions, and all potentially answerable by evolutionary biologists, especially paleontologists. I’m looking forward to reading about what they discover as a result of their field and laboratory investigations.


45

EricV

03/13/2008

3:12 pm

Is this the Mario Lopez from Saved by the Bell?


46

DLH

03/13/2008

4:03 pm

Allen_MacNeill at 34 You asked:

ID SUPPORTER***: Show me a way to empirically and unambiguously determine whether a code or physiological mechanism in a living organism was designed by an Intelligent Designer and I will believe in intelligent design as the origin of the complexity seen in the cellular machinery and code found in nature.

See Craig Venter’s customized bacteria including a synthetic DNA watermark.


“JCVI Scientists Publish First Bacterial Genome Transplantation Changing One Species to Another”

ROCKVILLE, MD — June 28, 2007 — Researchers at the J. Craig Venter Institute (JCVI) today announced the results of work on genome transplantation methods allowing them to transform one type of bacteria into another type dictated by the transplanted chromosome. The work, published online in the journal Science, by JCVI’s Carole Lartigue, Ph.D. and colleagues, outlines the methods and techniques used to change one bacterial species, Mycoplasma capricolum into another, Mycoplasma mycoides Large Colony (LC), by replacing one organism’s genome with the other one’s genome.

This appears to be a functioning bacterium or “a living organism” per your request.

Then see: j at #40 of Ian Musgrave’s “Intelligent Design Challenge.”
“By the way, it seems that the sequences for the watermarks that you just gave include extra leading and trailing characters. Here are the codings for the actual watermarks themselves, with quantity of characters in brackets:

TGTCGTGCAATTGGAGTAGAGAACACAGAACGA [33]

(CRAIGVENTER)

GTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAG [45]

(VENTERINSTITVTE)” . . .”
“So there are only 33 + 45 + 24 + 39 + 39 = 180 characters = 360 bits.”

This clearly shows a “watermark” in the genome of that organism that was caused by an intelligent designer, namely Craig Venter et al.

QED
Will you now take the step of: “I will believe in intelligent design “?


47

Frost122585

03/13/2008

5:21 pm

The most important thing that we as ID advocates should take from theories like the one above is that this is the current state of Darwinism.

Darwinian evolution has failed so many times to predict various mutations, structures in the fossil record, diversity of life, duration of diversity and time between change- etc…

that now we have new “just so stories” that cant be proven, that are merely evolution of the gaps theories- that in them of themselves are improbable regardless of whether they are true or not.

Can’t explain it well with mutation… well make something else up. This is the character of modern origins science.

as Behe writes in Edge of Evolution pp. 233 - 234, in regards to the claim that Intelligent Design does not make predictions…

“An eminent leader of the neo-Darwinian synthesis declared forthrightly a half century ago that “the search for homologous genes is quite futile.” Later work showed that “the view was entirely incorrect.”

Homology is not something that you would expect from diversity and complexity that originated from random mutations. Apparently there is a very specific and common design plane among species and life in general yet no one is willing to attribute this to the narrow line of reasoning and design that we only see in intelligent minds.

This is not to say that the theory proposed above is impossible or surely incorrect but the point to be made here is that science is again trying to use the old paradigm of Darwinian unintelligent design which has constantly had to change its game at ever turn. Moreover, Behe thinks that Darwinism is only responsible for about 2% of evolution.

If a trained biologist of Behe’s caliber is willing to make such a claim and back it up with math and explanation, then you can be sure that where there’s smoke there’s fire.

As Darwinian science continues to be the only kind of origins science taught, the “just so stories” or “theories” that mainstream science advances will very likely be just as unprosperous as the old paradigm that lead science down the blind alley to begin with.

From interbreeding, to co-option, to lateral gene transfer- all are very much speculative in how specified complex life came into being and diversified into what the fossil record shows and what we see today.

Meanwhile, no matter how hard scientists try, the end result is a bunch of improbable, incomplete, speculative explanations that rule out intelligence apriori. There is however another path (and only one) that science could venture down-
“That life and the cosmos is organized via “intelligence” through the “purpose of design.” Where this line of reasoning takes origins science is at this stage hard to fathom but it certainly wont be anymore speculative than the current approach. Thus, history has shown again that there is probably a lot more to origins then unintelligent natural processes. Maybe it’s time that science should take into consideration and go to work with that familiar solitary yet forbidden mechanism that some call “purpose” and give the darwinian stuff its well deserved break.


48

DLH

03/13/2008

5:27 pm

DaveScott @ 27 & Allen_MacNeill

And the Miller Told His Tale: Ken Miller’s Cold (Chromosomal) Fusion

Here is Ken Miller video asserting 2 fewer chromosomes as evidence for evolution not ID.

“Chromosome #2 was formed by the head to head fusion of two chimp chromosomes 13.”

Some key questions I have is
1) HOW did this fusion event happen?

2) At what stage in reproduction?

3) Do you have One fusion event in one person?

4) If so HOW is that reproduced into the population?

5) Can this “human” with the fused chromosome reproduce with the primate with two separate chromosomes?

6) If not, then does this require two chromosome fusion events?

PS Miller tries to give a strawman saying an intelligent agent causing this fusion event would be deceptive.

If an intelligent designer can intervene at the beginning, there can equally be an intervention to split primate to human.

I believe that Miller is raising a strawman argument of his own making appealing to a theological narrow misinterpretation of Creation Science which he attributes to ID.

My challenge to Miller is how he can claim to believe in “theistic evolution” and then systematically and vigorously fight against any hint of an intervention of an intelligent agent in the process of formation of life and subsequent evolution. That sounds morally deceptive to me.


49

PannenbergOmega

03/13/2008

5:34 pm

Ya know, I wish his holiness Pope Benedict XVI would disavow Miller’s work. I doubt that he would find Miller’s views on God and creation Christian.

PS: I can’t wait for EXPELLED!!


50

PannenbergOmega

03/13/2008

5:43 pm

Don’t want to speak for the Pope though. From what I read though, his thought seems light years away from Miller.


51

ericB

03/13/2008

6:00 pm

Allen_MacNeill:

As T. H. Huxley famously said:

“[Nature] warns me to be careful how I adopt a view which jumps with my preconceptions, and to require stronger evidence for such belief than for one to which I was previously hostile.

My business is to teach my aspirations to conform themselves to fact, not to try and make facts harmonise with my aspirations.”

Now that’s science!

If you have a moment, I would be interested to know how you apply this principle in regard to the question I put to you here.

Your insistent denial that there could be relevant empirical evidence (despite contrary statements from some who have studied it) has the appearance of giving artificial protection to “a view which jumps with my preconceptions” rather than “requir[ing] stronger evidence for such belief than for one to which I was previously hostile”.

How should that empirical evidence against relate to the business of teaching “aspirations to conform themselves to fact”?

[p.s. On a distinct note, since you did not contribute further in that thread, I hope you did not miss my sincere regard (in a post above that one) for your contributions and your example.]


52

vjtorley

03/13/2008

6:18 pm

Allen_MacNeill:

I have two questions regarding the evolution of the human brain. First, can you provide a rough, back-of-the-envelope calculation of how many mutations occurring in the human line since the human-chimp split would have had an effect on the development and/or functioning of the brain?

Second, is there any prospect of scientists in the future being able to situate these changes in their correct chronological sequence?

Best wishes,

Vincent Torley


53

RRE

03/13/2008

8:02 pm

“…only WE can add concept onto matter in the form of a machine or code.” Show me wrong please. Only humans.
Humanity has always been the only organism that can add concept onto matter in the form of a code or machine. That is our uniqueness. That is the image of God. All machines are made by man, with the exception of biological organisms. Biological organisms are the only machines found in the natural world (known universe) that we did not make from scratch. The genetic code, which is a holistic sequence of information read in codons (bits of 3) is the only code we did not intelligently designed. Writing your thoughts onto this website is you using a code which you have added onto matter using English. You are using a machine, the computer, to add the matter in time to produce your thoughts. Any writing is adding concept onto matter in the form of a code. Codes are tied to languages.
The bow is a simple machine which is a system that performs a function using at least one moveable part and one non-movable part which could be used to perform its function independent of the original agent. Only we can make one of those systems as well. Where is your monkey making machines or codes? Even a bird can intelligently design a complex round cup made of twigs, but no other species can design a machine or code.
Allen_MacNeill said: “And so, before people could do this (i.e. before the middle of the 19th century or thereabouts), they were not human, nor were they different from chimps and other animals in any other way, right?”
Writing is adding concept onto matter in the form of a machine or code. A monkey cannot even make an arrowhead. The bow was older than 19th century. The monkey won’t even place a rock as a pivot point against a stick to lift a big rock. Do you realize that? They can’t even make a WEDGE!
Wiki says: “A wedge is a portable inclined plane, used either to separate two objects, or portions of objects, lift an object, or hold an object in place, by the application of force to the wide end, which the wedge converts to force perpendicular to the inclined surfaces. The mechanical advantage of a wedge depends on the ratio of its length to its thickness. Where a short wedge with a wide angle does the job faster, it requires more force than a long wedge with a smaller angle.”
Wiki says: “The origin of the wedge is unknown, because it has been in use as early as the Stone Age. Circa 3000 BC, in Ancient Egypt quarrys, bronze wedges were used to break away blocks of rock used for construction. Wood wedges, that swelled after being wet, were also used. Some Native American tribes used antler wedges as a means of splitting and working wood to make canoes, houses, and other wood objects!”
http://en.wikipedia.org/wiki/W....._device%29
The origin of the wedge is unknown…perhaps because humans have always been able to make a wedge because humans were intelligently designed to develop machines, primates were not.
Allen_MacNeill said: “For that matter, I only know a very few people who can perform this operation — that is, convert a concept into a line of code. Does that mean that they, too, aren’t human? “
No, they are human too. Writing is a code that all other primates and animals cannot do. It’s based on the English language convention. Humans are the only species that can add concept onto matter in the form of a code or machine.
Allen_MacNeill said: “Were you human before you learned how to code? Will you remain so when old age reduces or eliminates your ability to do so?”
Humans as a species, is the only species that can add concept onto matter in the form of a machine or code. No — a man with his mouth shut, vocal cords ripped out, arms and legs chopped off cannot add concept onto matter in the form of a code or machine, but he’s still human don’t worry.
Allen_MacNeill said: “Tool use is clearly not the sole criterion by which humanity is defined. My little son (now just one year old) was fully human when all he could do was lie in the crib and look cute.“
Okay, once the human species obtains adulthood developmental stage, they become the only species on the entire planet and whole known universe to be able to add concept onto matter in the form of a machine or code. “Tools” are a useless comparative; the bird can make a tool such as a nest. Please name another species that can produce codes or machines and I’ll convert to atheism and give God the finger.

“IOW, what differentiates humans from other animals is no single qualitative difference, but rather a relatively large number of quantitative differences, which when added together define what we mean by “human.””
Being able to develop machines and codes IS a single qualitative difference. It’s the single biggest!—we are the only species that can do it. No other species. Your monkey can’t make a bow. Think about, all he can do is grab a stick and use it to get food, but so what, he’s not adding concept onto any matter at all, to produce a machine or code. You try to deflect and say that it’s not an important enough difference, but it is the most unique qualitative difference that can be compared when comparing any species in the ENTIRE ANIMAL KINGDOM.


54

PannenbergOmega

03/13/2008

8:08 pm

Is it possible that the Creator programmed everything into the early universe? Everything that would occur in cosmic/terriestrial history, the development of life and speciation. Could it all have been imputed in the begenining?


55

ericB

03/13/2008

8:40 pm

In response to PannenbergOmega 54, the biggest problem is the existence of symbolic codes and symbolic information that are fundamental to living organisms.

The association between symbol sequences and their meanings is determined by a consistent convention.

Because it is a convention, it is not required by any laws of physics or chemistry. You could not derive it from laws.

On the other hand, to function the association must be implemented, applied and interpreted consistently. It cannot be the product of chance.

The only known source for symbolic conventions is choice and directed effort by intelligent agents.

For a designer to build that into the beginning, there would have to be some storage for symbolic data and instructions from the beginning. Law and chance cannot create it later on.


56

RRE

03/13/2008

8:43 pm

Allen_MacNeill said: “But one could also just say “that’s the way the Intelligent Designer wanted it” and then go do something else that also wasn’t science…”
That’s a false condition. “That’s the way the Intelligent Designer wanted it” is trying to understand the intent of the designer, you may not be able to so scientifically, so what you said really means nothing—and no one says that in the Intelligent Design community. You are trying to confuse people — finding out how something originated and how something works are two totally separate concepts that you must explore so as to relate to the difference.

Allen_MacNeill said: “ID SUPPORTER***: Show me a way to empirically and unambiguously determine whether a code or physiological mechanism in a living organism was designed by an Intelligent Designer and I will believe in intelligent design as the origin of the complexity seen in the cellular machinery and code found in nature.”

Saying that people were intelligently designed at humans’ origin is an inference to the best possibility based on our observed experiences, recognizing UNIQUE qualitative differences when it comes to the origin of machines and codes versus all other structures in nature. That’s a scientific statement that can be tested against reality and falsified. All machines and codes had intelligent agency as a cause when exploring their origin. Furthermore, the genetic code is the only code that we can find that Man did not intelligently design, which also happens to build up to produce and maintain the only machines that man did not intelligently design. So we can conclude that this ‘only code’ had to have been designed as well — Simply because we find no exceptions to the rule. So empiricism and experience prevail over metaphysical naturalistic mechanisms.


57

PannenbergOmega

03/13/2008

8:52 pm

Hmmm. Interesting.
Maybe we don’t fully understand what the universe is right now. Maybe it is a cosmic information processing system and we are apart of the designers computer program.


58

RRE

03/13/2008

8:56 pm

And studying the causes involved in the origin of something has nothing to do with studying how something works. So there is no magic science stopper when it comes to ID because ID proponents are Intelligent Designers themselves, and studying how the genetic code or how the human body (or another other body plan) works is well within their abilities and has nothing to do with origins. Intelligent causes are ALWAYS required when we look at the origin of any machine or code. If you exclude intelligent causes as to the origin of a machine or code, you are deceitful and not practicing science, but metaphysics, simply on the basis that you have not shown anyone how a code or machine could come about without intelligent causation. Please don’t be intellectually dishonest, and instead demonstrate in reality a machine or code that came into existence without intelligent causes.

It is up to you to to show us your code or machine without intelligence. We can show you that intelligent causes CAN produce machines and codes. You must show a purely naturalistic way. I am waiting.


59

RRE

03/13/2008

9:04 pm

PannenbergOmega said: “Hmmm. Interesting.
Maybe we don’t fully understand what the universe is right now. Maybe it is a cosmic information processing system and we are apart of the designers computer program.”

Maybe everything is controlled by an electro-static force and gravity is an infinitesimal factor in the universe. Maybe there is a lot of electrified gas floating around the universe, who knows right? Maybe things all ride on the electro-magnetic spectrum.


60

Paul Giem

03/13/2008

9:33 pm

I have had the chance to read the entire article now, and need to make a correction.

My statement (26) about the investigators checking on all the chromosomes was correct, and Allan’s statement in that regard is still in error.

However, the X chromosome was not nearly as similar in humans and chimps as I inferred from the abstract. They expected 0.918 to 0.943 of the mutations they got on the other chromosomes, and in point of fact got only 0.835 (+/- 0.016), which means that if one believes the model of hybridization, it would have happened when the two populations were about 10% along to their eventual destinations.

Thus when I criticized Allan (9) and said that it was the late ancestors rather than the early ancestors that interbred, I was wrong and Allan was correct about what the article said. Sorry, Allan.

Given that areas on individual chromosomes could vary from 84% to 147% of expected, this value of 10% is easily within the noise range, although it is unusual for a whole chromosome to be consistently that low.

However, the easiest explanation for this data is simply that the “molecular clock” is not all that accurate. From an evolutionary perspective, the article gives further evidence of that. Even assuming a branching of orangutangs from the eventual hominid line at 20 Ma (million years), which is considered high, humans and chimps would have diverged at some 6.3 Ma which is considered low given the date of Sahelanthropus at some 7 Ma. If one takes the, according to them, more reasonable date for the orangutan-human split of 17 Ma, the human-chimp divergence would happen at 5.4 Ma. WHy not just say that the molecular clocks aren’t trustworthy and leave it at that?

In fact, it is interesting that the authors stated (and got past peer review without having to back it up experimentally!) that perhaps Sahelanthropus was incorrectly dated. Apparently as long as it isn’t a creationist making those suggestions, it’s okay.

The data presented are interesting. But the speculation is fascinating, more for what it tells about the authors and editors than for what it says about what actually happened.


61

Paul Giem

03/13/2008

9:36 pm

And sorry I misspelled your name this last time, Allen.


62

Jack Krebs

03/13/2008

10:21 pm

Pannenberg writes,

Is it possible that the Creator programmed everything into the early universe? Everything that would occur in cosmic/terriestrial history, the development of life and speciation. Could it all have been imputed in the begenining?

That’s called deism, and it’s not very popular theologically anymore: God created the universe with all the proper initial conditions and then the universe has mechanically unfolded since then.

One problem is that the issues of quantum indeterminacy and chaos theory mean, at least to the best of our human understanding, that the initial conditions don’t deterministically lead to a fixed end. Theologically you then have a number of possibilities:

1. Quantum indeterminacy is real, even to God, and thus the universe has a degree of freedom to become what it will in ways that God cannot foresee and does not control, or

2. Quantum indeterminacy, while real to us, is not real to God - He somehow knows the rules behind it. Therefore true deism is possible: the initial conditions, including those beyond our comprehension, are sufficient for the world to play out exactly as God intends, or

3. Quantum indeterminacy is real, even to God, but God can intervene at the quantum level to tweak the course of events - not with an exact ability to know where the present will lead, but at least to send it off in the desired direction, or the last possibility (for this list),

4. God continually is active at the quantum level, tweaking every moment in ways that do not contravene any natural laws above the quantum level, and thus continuously manifesting his Will and design for the world.

Hope this gives you something to think about, Pannenberg.


63

PannenbergOmega

03/13/2008

10:43 pm

Hi Jack Krebs, thank you for taking the time to answer my question. It is appreciated.

Personally, I find number 4 the most appealing possibility. Perhaps God controls the hidden variables of quantum mechanics.

Yet would this make design detection impossible?


64

bFast

03/13/2008

11:16 pm

Re: Jack Krebs list of possibilities. I would add a fifth, and with some experimental support.

5. God continually (or regularly) is active at the quantum level, tweaking in ways that sometimes contravene natural laws as we understand them.

Let me present a case in point. Now, I wish I had a sitation for every good quote that I hear on television, especially documentary shows. However, it is my understanding, as gathered from one of them shows, that in the gambling halls “winning streaks” and “loosing streaks” are a real statistical phenomenon. In other words, as I understand it, they happen often enough and strongly enough to challenge the expectations of the statisticians.

I consider the HAR1F gene — my favorite. It has 18 specific point mutations in humans that are not in chimps. It is apparently necessesary that all 18 happened at once. This one event is a chance event that probably exceeds the UPB. As such, it reallistically “contravines natural law”. As such, it is detectable. It goes down as a nice little strong case in favor of ID.


65

Apollos

03/13/2008

11:33 pm

PannenbergOmega,

Design detection is axiomatic. You couldn’t get any sane person to deny the obvious design of a book, or electronic circuitry.

The typical debate is whether this applies to biological systems. However even there it would seem obvious to most:

Biologists must constantly keep in mind that what they see was not designed, but rather evolved. -Francis Crick

Design is so apparent in biological systems, that according to Crick, biologists need to “constantly” remind themselves that what they see isn’t designed.

So the issue is debatably, not whether design is apparent, but whether it is merely illusory when considering biological systems.


66

Frost122585

03/14/2008

12:48 am

Pannenberg asked,

“Is it possible that the Creator programmed everything into the early universe? Everything that would occur in cosmic/terriestrial history, the development of life and speciation. Could it all have been imputed in the begenining?

This is not necessarily Deism as Jack Krebs said. Deism says that God kicked the thing off but that he no longer intervenes in his creation leaving it to the laws of nature to work everything out. There is a distinction and problem with this view. As you all have probably read/heard Heisenberg’s uncertainty principal says that on the small scale of matter, events become increasingly difficult to predict until events become virtually impossible to predict 100% accurately. If this is related to man’s supposed free will then you have a Deist problem of consciousness right off the bat. That is since there is no law controlling what man can or cant do in essence God is having a physical law like intervention all of the time in terms of uncertainty.

To clear up the ambiguity here, if the laws of nature just ran us through like a movie or machine then there would be no uncertainty. When we watch a movie we expect to see what is expected to happen based upon the plot and the director/scriptwriter’s vision. In a universe like our with uncertainty there is no movie like Deism. So Deism is already limited to begin with based upon the fact that if there is a god he gave us a continuous free will like ability in consciousness.

The second problem with Deism is that it is based on a kind of problematic view of God in general. That is, God kicked off the universe with its “laws” and that is it. But what is meant by “laws.” What if on of the laws is that every 500 years he commits a miracle? What is cancer is to be naturally cured by pure chance once in a while simply due to the way he designed quantum physics. And what if a person prayed to God and it just happened that he was the guy that caught the lucky preplanned cancer remission? Only God could be a Deist in cases such as these because man just could not know the difference between a subtle Theism and a luck based Deism.

Deism makes no sense in a universe that has a quantum physical component or interpretation inherent in its nature.


67

Jack Krebs

03/14/2008

7:06 am

to bFast:

Contravening natural law and contravening statistical expectations are two different things. If God could manipulate quantum probabilities, he could make things happen with a different probability than they might otherwise, but that would not contravene any natural law. My first thought is that your option 5 is not a separate category.

(However, now that I think about it, this may be a matter of interpretation: some natural laws are in fact the resulting of probability averaging out. If I understand correctly, at the level of quantum electrodynamics, even the fact that light travels in a straight line is a statistical result that is the path-integral (a type of probablistic average) of all the possible paths between those two points.

Pannenberg asks: “Yet would this make design detection impossible?”

This is a key question. If God is continually active at the quantum level, manifesting his will in event that will forever look like true probablistic randomness to us, then he could influence the world in ways that were never immediately detectable: there would never be an event happen which would be so unlikely that it would appear to us as an observable intervention. To an omnipotent God existing in countless quantum events in every second all over the universe, extremely minute tweaks to the probabilities would be all that was ever needed.

Such a God would be ever-present, existing comfortably in the natural world and in harmony with the natural laws, things and forces he had created. This position (with or without the quantum mechanical explanation) is what the very badly named position of “theistic evolution” believes.

And last to bfast: You write,

Let me present a case in point. Now, I wish I had a sitation for every good quote that I hear on television, especially documentary shows. However, it is my understanding, as gathered from one of them shows, that in the gambling halls “winning streaks” and “loosing streaks” are a real statistical phenomenon. In other words, as I understand it, they happen often enough and strongly enough to challenge the expectations of the statisticians.

I don’t believe this is true. I think research into hot and cold streaks show that they do conform to statistical theory. Most people’s intuition about such issues is pretty poor, and so we often ascribe cause when in fact all we have is the statistical variation.


68

PannenbergOmega

03/14/2008

8:28 am

Thanks Mr. Krebs, bFast, Apollos and Frost.

Hi bFast, at #64. I think I see what you are saying. There is a paper by Granville Sewell where he describes the idea that sometime about a million years ago an okapi mother gave birth to a giraffe. The result of a carefully designed mutation. You are suggesting that the HAR1F gene suggests something similiar?

Hi Apollos, at # 65. I know design is obvious. For some reason I thought that if the designer worked solely through natural processes, then traces of the designer might not be evident. I probably just don’t understand design detection.

Hi Frost, at #66. I didn’t think I was describing Deism either.


69

PannenbergOmega

03/14/2008

8:29 am

More something along the lines of providential predestination of creation.


70

PannenbergOmega

03/14/2008

8:44 am

“Such a God would be ever-present, existing comfortably in the natural world and in harmony with the natural laws, things and forces he had created. This position (with or without the quantum mechanical explanation) is what the very badly named position of “theistic evolution” believes.”

Are you saying that God is guiding cosmic development from moment to moment? I find this quite palatable.

This may be theistic evolution but it is a far cry from the blind, purposeless, Darwinian evolutionary process.


71

Jack Krebs

03/14/2008

9:08 am

Pannenberg writes,

There is a paper by Granville Sewell where he describes the idea that sometime about a million years ago an okapi mother gave birth to a giraffe. The result of a carefully designed mutation.

This is an unnecessary hypothesis, and is either unrealistic biologically, or shows a major confusion about the difference between the names of things and the things themselves.

There is no reason why God would have to, or did, produce some major mutational change: He could just have easily made a number of slight modifications over many generations. There is also no reason why his presence in the world has to entail specific events that look improbable. If one believes in a God capable of making changes in the world via events that appear extremely improbable for us, he is surely capable of making changes in the world through acts that don’t appear improbable at all. The slow divergence of species that is described by evolutionary science, whether it be okapi and giraffe or pre-homind and human, could just as easily be guided by God as some hypothetical major saltational event such as an okapi giving birth to a giraffe.

Pannenberg writes,

I know design is obvious. For some reason I thought that if the designer worked solely through natural processes, then traces of the designer might not be evident. I probably just don’t understand design detection.

There is an important distinction that Pannenberg is making here. To the Christian, through faith design is obvious at all levels: from the very structure and existence of the universe down to the individual events that make up one’s daily life. However, to the empirical observer, working through the methods of science, design is undetectable.

Think about your daily life: As a Christian you undoubtedly believe that God is guiding your daily life. However, if you watch what happens to you every day you don’t see moments when all of a sudden natural processes cease to work - you can’t detect the moments when God manifests his guidance of your life, but you have faith that it is happening. Same with evolution. There is nothing antithetical to Christian faith in believing that small changes, entirely within the realm of statistical probability, are the means by which evolution happens.

Added after Pannenberg’s last comment:

He writes,

Are you saying that God is guiding cosmic development from moment to moment? I find this quite palatable.

Exactly.

This may be theistic evolution but it is a far cry from the blind, purposeless, Darwinian evolutionary process.

The distinction here is between philosophy and science. To the non-Christian, including the materialist, the above explanation about God is not relevant. Materialists believe in some sort of “blind, purposeless” universe (although they are major problems with this statement, but that’s far beyond the scope of this post.) The Christian and the materialist can look at the same physical world and see the same world of probability and chance, and agree on the science and yet disagree on the metaphysics.


72

PannenbergOmega

03/14/2008

9:32 am

Hmm.

I don’t think the evidence supports
God working through “a number of slight modifications over many generations.”

If I were to take an evolutionary view of life. I would either go with Mike Behe or Harold Morowitz and the Emergentist school. It appears that cosmic history and life is more of a series of big bangs. Rather than evolutionary gradualism.

I think most visitors to this site would agree with me.

I will concede however, that I the evidence points to man being descended from the apes in some sense.


73

PannenbergOmega

03/14/2008

9:38 am


74

Jack Krebs

03/14/2008

9:40 am

I think Behe accepts “a number of slight modifications over many generations.” The difference between him and the theistic evolutionists is, I think, that he thinks some of those changes are scientifically capable of being declared so improbable as to point to specific intelligent intervention. That doesn’t mean that thinks that evolution doesn’t proceed by slight modifications over many generations.


75

vjtorley

03/14/2008

10:09 am

RRE:

You maintained (53) that humans are “the only species on the entire planet and whole known universe to be able to add concept onto matter in the form of a machine or code.” You then added that “‘[t]ools’ are a useless comparative; the bird can make a tool such as a nest.” Finally, you wrote: “name another species that can produce codes or machines and I’ll convert to atheism.”

I see no reason why the discovery of another species of animal that could impose its own concepts upon matter would necessitate a conversion to atheism. Nor do I think that this ability is what makes us human. Before I explain why, and offer my own definition of what makes humans special, I’d like to make two comments.

First, I think it would be helpful if you defined the term “machine.” I take it you believe that some tools are not machines. Why not? What qualities does a tool need to possess in order to qualify as a true machine?

Second, are you aware of the remarkable feats of Betty the Crow, a remarkable bird who designed a tool from a piece of wire so she could solve a problem - pull a bucket of food out of a tube-shaped container? Betty did this by taking a straight wire, jamming it into a crack at the base of the container, and then pulling it to the side several times until it made a hook. You can see a Quicktime movie of Betty in action at http://users.ox.ac.uk/~kgroup/trial7_web.mov and judge for yourself.

My point here is that this kind of behavior appears to qualify as imposing a concept [of a hook] upon matter [a straight wire], which was your criterion for intelligence. I don’t know whether you’d be prepared to call such a hook a machine, but it certainly seems to qualify as a manifestation of some sort of intelligence: the crow was solving a new problem, and her actions can also be described as novel, as she had no other crows to serve as models, no training with pliant objects, and very limited prior experience with wire.

More recently, follow-up work with Betty has lent further support to the view that Betty is genuinely able to understand how hooks work. I shall quote from the abstract of a paper by Alex Weir and Alex Kacelnik (draft version available online at http://users.ox.ac.uk/~kgroup/.....unbend.pdf ), entitled “A New Caledonian crow (Corvus moneduloides) creatively re-designs tools by bending or unbending aluminium strips”, published in “Animal Cognition”, October 2007; 9(4):317-34, 17024509 (P,S,E,B,D):

“Previous observations of a New Caledonian crow (Corvus moneduloides) spontaneously bending wire and using it as a hook [Weir et al. (2002) Science 297:981] have prompted questions about the extent to which these animals ‘understand’ the physical causality involved in how hooks work and how to make them. To approach this issue we examine how the same subject (’Betty’) performed in three experiments with novel material, which needed to be either bent or unbent in order to function to retrieve food. These tasks exclude the possibility of success by repetition of patterns of movement similar to those employed before. Betty quickly developed novel techniques to bend the material, and appropriately modified it on four of five trials when unbending was required. She did not mechanically apply a previously learned set of movements to the new situations, and instead sought new solutions to each problem. However, the details of her behaviour preclude concluding definitely that she understood and planned her actions: in some cases she probed with the unmodified tools before modifying them, or attempted to use the unmodified (unsuitable) end of the tool after modification. Gauging New Caledonian crows’ level of understanding is not yet possible, but the observed behaviour is consistent with a partial understanding of physical tasks at a level that exceeds that previously attained by any other non-human subject, including apes.”

Even if some animals possess a kind of means-end rationality, as Professor Alex Kacelnik suggests in a thought-provoking paper which can be viewed online at http://www.cogs.indiana.edu/sp.....nality.pdf , the fact remains that as far as we know, human beings are the only animals capable of critical thinking, which is defined (at http://www.criticalthinking.or.....inking.cfm )as “that mode of thinking - about any subject, content, or problem - in which the thinker improves the quality of his or her thinking by skillfully taking charge of the structures inherent in thinking and imposing intellectual standards upon them… Critical thinking is, in short, self-directed, self-disciplined, self-monitored, and self-corrective thinking. It presupposes assent to rigorous standards of excellence and mindful command of their use.”

Without this meta-cognitive capacity, ethical reflection on the meaning of “right” and “wrong” would be impossible, and we would be incapable of acting morally. Reflecting on the course of one’s life and the mistakes one has made, and resolving to avoid those mistakes, also requires an autobiographical memory. Although recent studies suggest that some birds, such as scrub jays (see http://www.pubmedcentral.nih.g.....id=1088530 ) and Canadian rufous hummingbirds (see http://www.ncbi.nlm.nih.gov/pubmed/16527747 ), can remember specific episodes in their past - in particular, when and where they stored away items of food for retrieval at a later date - there is no evidence that these birds are capable of the kind of “mental time-travel” required for what theologians call an “examination of conscience” - e.g. recalling in chronological sequence the things they did between time A and time B, and asking themselves, “Where did I go wrong, and what did I do that was wrong?”

What I am suggesting here is that rationality is not the defining attribute of human beings, but a self-critical ability for critical reflection, coupled with an ability to recall events over the course of one’s life.


76

jerry

03/14/2008

11:19 am

Jack Krebs,

No one would be on this blog if there were any evidence that gradualism ever produced anything of consequence. It does not matter if the changes were caused by variation events to the genomes of gametes caused by naturalistic means or if God or some other intelligence caused the changes.

Anyone who defends gradualism has to deal with the forensic evidence of which there is none. There are slight changes all the time but these are nothing more than reshuffling of the genome or restrictions of the gene pools rather than meaningful expansions of the gene pool.

So you can speculate about what caused the small changes but there is no evidence that any ever took place.

Jack, deal with reality. You have been asked many times to provide examples and have always avoided the question. Repeat. There has never been any meaningful changes to a gene pool that we know of. All of it has been trivial. So questions of how it was done do not make sense.

Now if you disagree, then provide the examples and we can have a meaningful discussion. Everyone would be the better off with such a discussion.


77

PannenbergOmega

03/14/2008

11:24 am

While I will concede that as of right now the evidence points to humans probably descending from apes in some respect. I think Behe and Sewell have it right. I’m no expert though.

I still don’t believe that “hybridization can occur between a Pan & Homo”.


78

Jack Krebs

03/14/2008

11:25 am

Jerry, I think DaveScot and Behe are two people who accept “gradualism” - I’m not the only one.


79

bFast

03/14/2008

11:30 am

PannenbergOmega:

This may be theistic evolution but it is a far cry from the blind, purposeless, Darwinian evolutionary process.

Yet this is exactly what Ken Miller describes in his book. I still say that he, like the other postive theistic evolutionists, need to discover that they actually are IDers. (I call a theistic evolutionist “positive” if their view of God is one who actually participates at some point, even if only to tune the big bang, rather than being a silent observer.)

I differ with Miller only in that I think there are itentifiable occasions that fall outside of realistic probability.

The HAR1F gene is an interesting thing. It consists only of point mutations, the smallest unit of mutational modification, yet it is fully irreduceably complex. The problem I see with the flagellum is that cooption and modification can still be claimed because genes contain an average of 300 nucleotides, so are not fully reduced. I think that the HAR1F is absolute proof that NFV+NS is an inadequate explanation.

However PannenbergOmega, these positions still seriously do not fit with a literal interpretation of the pre-Abrahamic portions of the Bible. They leave us with a very powerful God, and good evidence of his practices. They leave us with that comfortable feeling that God is in control. But they don’t leave us with a literal interpretation of the entire Bible.


80

jerry

03/14/2008

11:31 am

vjtorley,

The other day we faced the problem that there is no good definition of life. Is there also no good definition of intelligence? There a multitude of examples of clever things animals do to overcome their environment. It is the second time in a couple days that I have read about the New Caledonian crow.

What is it about humans that makes their intelligence different? One interesting thing is that I recently read that hominids used tools for over a million years and the tools used did not show much difference in this time frame. So hominids had the capability to make tools but did not seem to have the ability to reflect on how to improve the tools only repeat what they have been shown. So how intelligent were they?

We certainly think there is a quality difference between us and the rest of the animal kingdom on intelligence (kind not degree). I am not proposing a full blown discussion of intelligence because that could go on for ever and get nowhere. But it is an issue that should have an easy answer but apparently doesn’t.


81

jerry

03/14/2008

11:36 am

Jack Krebs,

Great evasive answer. Spoken like a true veteran of the never giving a straight answer community.

I do not think Behe is a gradualist. Let Dave Scott speak for himself.


82

PannenbergOmega

03/14/2008

11:39 am

bFast. Despite my sympathy for Salvador Cordova and my desire to see a young cosmos.. I believe one must try to be open minded and go where the evidence leads.

” these positions still seriously do not fit with a literal interpretation of the pre-Abrahamic portions of the Bible”

True. I should mention that neither Behe nor Sewell accept t a literal Genesis account.


83

PannenbergOmega

03/14/2008

11:40 am

vjtorley,

as Dr. Dembski and others (Noam Chomsky) have patiently tried to explain time and time before. Animals are simply not on par with human beings.


84

PannenbergOmega

03/14/2008

11:44 am

This is what Noam Chomsky has to say on attempts to teach sign language to apes..

“My feeling is the same as it was 50 years ago: the questions are
meaningless. It’s like asking whether submarines swim or humans fly — not as well as eagles, but almost as well as chickens. Or to take a closer analogy, whether humans can learn the waggle dance of the bees.

Doubtless it would be possible to train graduate students to simulate the foraging of bees, and probably do a pretty fair job of it. If you tried to get an NSF grant for this, the reviewers wouldn’t even laugh. They might recommend psychiatric treatment. But it’s much more sane than trying to train poor
apes to duplicate some of the superficial features of language use.

None of this has any place in rational inquiry.”

– Noam Chomsky


85

Borne

03/14/2008

12:17 pm

Allen : ““So we descend from mice too?”

No; once again, the answer (based on multiple lines of empirical evidence) is that mice and humans descend from a common ancestor (similar to a tree shrew) that lived in the Paleocene (or perhaps somewhat earlier in the Cretaceous.”
It turns out to mean the same in the end analysis - ‘we all descend from some cell’ - a cell that no one knows how it came to be.
I looked over the wikipedia article you referred to and was amazed to see the number of take-it-for-granted speculations, conjecture and bare assertions.
I can’t understand why you fail to see the enormous amount of speculation and conjecture involved here. I mean it’s so blatant that it practically jumps off of the page.

I find your credence to the macro-evo view to be entirely faith-based. “Like this, therefore from this” style reasoning may be great for biologists (I certainly hope not) but it goes no where in real science and constitutes a logical fallacy of the type “undistributed middle” - a fallacy that very nicely describes the very base assumptions of Darwinian theory!

Before this therefore because of this; similar to this therefore related to this, … all these types of reasonings are almost universally logical fallacies. Logic is something that, as an information systems analyst, I know a lot about.
And it is the fundamental reason why I can’t swallow Darwinism.

The sharing of genetic and morphological traits has to be pushed into Darwinian theory. It is not a given, and not necessarily logical. Shared traits of whatever type you wish can be interpreted as the result of both common design rules and common environmental influences.

“On the contrary, the phylogenies you describe have only come about through the opposite of faith.”

??? Surely you jest! If that were true we would see unity. We don’t. We see various trees of life built on various sub theories, some based on morphology, some on genetic similarities, some entirely at the whim of the systematist and their quaint diagrams of phylogenesis! There are are fundamental contradictions in the world of clades and systematics. This you’re surely aware of. So why paint a pretty picture when there is none?

“Today, however, the picture is entirely different. More and more workers are showing signs of dissatisfaction with the synthetic theory. Some are attacking its philosophical foundations, arguing that the reason that it has been so amply confirmed is simply that it is unfalsifiable: with a little ingenuity any observation can be made to appear consistent with it. Others have been deliberately setting out to work in just those areas in which neo-Darwinism is least comfortable, like the problem of the gaps in the fossil record or the mechanisms of non-Mendelian inheritance. Still others, notably some systematists, have decided to ignore the theory altogether, and to carry on their research without any a priori assumption about how evolution has occurred. Perhaps most significantly of all, there is now appearing a stream of articles and books defending the synthetic theory. It is not so long ago that hardly anyone thought this was necessary.”

(Ho M-W. & Saunders P.T., eds., “Beyond Neo-Darwinism: An Introduction to the New Evolutionary Paradigm,” Academic Press: London, 1984, p.ix)

The “stream of articles” has grown quite a bit since hasn’t it. No wonder.

Data, by itself, is immune to theories. It must be interpreted. Darwinists persistently force the data to fit the theory. So do a lot of other scientists in other domains. That is not science.

Fortunately that won’t work in domains like mathematics, informatics etc. where it has to work in the real world.

“Biologists must constantly keep in mind that what they see was not designed, but rather evolved.”

Francis Crick
Dawkins invented designoids for the same reason.
I ask you this, why would these atheists make so much ado about such a necessity if the impression of design was so obviously in fact an “illusion”?

Indeed, if the sense of wonder and awe we feel before the unspeakable depths of functional, organized complexity alive in all nature were not so fundamentally intuitive we would never have suspected and inferred design in the first place, as all wise men in all historical cultures since the beginning have done.
Modern genetic discoveries are only making this intuition more prominent and inspiring for both designists and atheists alike! And that is the reason why the materialists must follow Crick’s precept every day or be consumed with the genius beyond genius we witness at each new discovery. Each one ever more and more complex to the point that, sooner or later, you have to give in and admit the astronomical improbability of the methodological naturalist hypothesis and seek to know the beauty and mind of the Designer.


86

pandora

03/14/2008

12:39 pm

bFast:

I still say that he, like the other postive theistic evolutionists, need to discover that they actually are IDers. (I call a theistic evolutionist “positive” if their view of God is one who actually participates at some point, even if only to tune the big bang, rather than being a silent observer.) ”

Science cannot prove (Nor can it Disprove) God.

I think that Miller’s objection to ID, is that it has not brought any testable science to the plate.

Therefore, he believes that it is not science.

This is a big problem for ID


87

congregate

03/14/2008

12:41 pm

jerry at 76:

Anyone who defends gradualism has to deal with the forensic evidence of which there is none. There are slight changes all the time but these are nothing more than reshuffling of the genome or restrictions of the gene pools rather than meaningful expansions of the gene pool.

How can you be so sure of the contents of the gene pools for all populations of all organisms?

What is the forensic evidence for something other than gradualism? Can you provide an example of a population which suddenly changed in the laboratory in a way that indicates that a designer intervened to change the gene pool in a nongradual way? Other than a contemporary human scientist, I mean. Venter’s work may prove that intelligent design of biological materials is possible, but doesn’t constitute evidence of any earlier designer activity.

If not in the lab, do you have a hypothesis as to where and when was the most recent time when a designer expanded the gene pool? That would be an ID hypothesis that could be scientifically investigated.


88

Joseph

03/14/2008

1:16 pm

Ergo, there are two logical interpretations of these multiple lines of empirical evidence:

1) human chromosome #2 consists of two chromosomes found in other primates, fused together at the location of the back-to-back embedded telomeres

2) an “intelligent designer” inserted the back-to-back embedded telomeres in the middle of human chromosome #2, arranged all the genes to look just like they should if they had come from the two unfused non-human primate chromosomes, and then inactivated the back-to-back embedded telomeres (i.e. they have no detectable function)-Allen MacNeill

How about this:

The design called for the fusion to create reproductive isolation between two other-wise genetically similar populations.


89

jerry

03/14/2008

1:20 pm

congregate,

you said

“If not in the lab, do you have a hypothesis as to where and when was the most recent time when a designer expanded the gene pool? That would be an ID hypothesis that could be scientifically investigated”

You are an example of those who do not understand what the debate is about. Do you expect a video of the event several million years ago? Come on, don’t be silly. Are you of the school that you must see and feel the designer before you will believe? It is not necessary to know anything about who, when and how a design event took place to conduct research.

There is a dominant paradigm out there with no evidence to back it up. I tease Jack Krebs because he is a leader in the movement to maintain this paradigm for the children but cannot present any evidence to support it. Can you? If you cannot, then you should join us and getting rid of this paradigm.

And please do not give us the cliché remark that before you can replace a paradigm, you should have a replacement paradigm. There is no need to have a paradigm to do science especially one that is bogus. All you need are hypotheses. There can be several competing paradigms and if they predict and have good results, should be accepted in the house of science. If a paradigm doesn’t have a good track record like gradualism, then they should be sh** canned. Pardon my Navy talk.


90

Joseph

03/14/2008

1:24 pm

I think Behe accepts “a number of slight modifications over many generations.” The difference between him and the theistic evolutionists is, I think, that he thinks some of those changes are scientifically capable of being declared so improbable as to point to specific intelligent intervention.–Jack Krebs

Designed to evolve Jack.

Irreducible complexity can be overcome, not just via intervention, but also via planning.

Targets, resources, algorithms, genetic information- let ‘em run.


91

Jack Krebs

03/14/2008

1:31 pm

Jerry writes, “Anyone who defends gradualism has to deal with the forensic evidence of which there is none.”

Here’s some.

The Hawaiin Islands formed between 5 million and a million years ago. There are many example of great diversity among species and families of species, and all sorts of evidence shows that this diversity arose from a smaller number of founding species. Is this not evidence of gradualism?

from http://www.nap.edu/openbook.ph.....mp;page=20

Many Other Species Have Undergone Adaptive Radiations in Hawaii

While the adaptive radiation of the drosophilids in Hawaii has resulted in a remarkable number of species, other radiations have produced descendants with an even greater range of physical characteristics. The 30 species of plants belonging to what is called the silversword alliance are a superb example.

For decades, botanists had known that all of these species are related because their leaves and flowers share certain characteristics, which is why the species are termed an “alliance.” But in other ways the plants are so different that the nature of this relationship remained obscure. The 30 members of the alliance include trees, shrubs, mats, vines, and the rare and magnificent flowering silverswords that live on the high slopes of Haleakala in Maui and Mauna Kea in the Big Island (see Figure 13). They occupy habitats ranging from near sea level to the upper limits of vegetation on mountains and from semiarid desert areas to thick rainforests.

In the 1980s, biologists studying the genetics of these species realized that they are far more closely related than they appear. In fact, all appear to be descended from a single ancestral species that arrived on the Hawaiian islands millions of years ago (Panel 3). Today the closest non-Hawaiian relative of the silversword alliance is a small, daisy-like plant called a tarweed that grows on the west coast of North America. The fruit of this plant has sticky appendages that could easily have allowed the seeds of an ancestral plant to hitch a ride on a migratory bird.

As with the drosophilids, the descendents of the original colonizing species diversified dramatically as they underwent multiple founder events and spread into new environments. On Maui and the Big Island, for example, several species within the silversword alliance have adapted to the drier environments of higher elevations. All of these species are able to maintain water pressure within their leaves and stems even as the water content of the plant drops, which helps them survive in drier habitats.

Many other species of plants and animals in Hawaii also derive from adaptive radiations.

*
About 50 living and extinct species of the birds known as honeycreepers have been identified in Hawaii. All evolved from a single finch-like colonist species with a relatively small bill. Today, the members of this radiation have a wide variety of bill shapes that are each specialized for a particular kind of food (see Figure 14).
*
About 240 species of crickets have evolved from the separate arrival in Hawaii of a tree cricket, a sword-tail cricket, and a ground cricket. Among these species are several species that have adapted to subterranean life within underground lava tubes in Maui and the Big Island (see Figure 15). These species have reduced coloration, small eyes, and a clear exoskeleton.
*
Two genera of violets—Viola with seven species, and Isodendrion with four—derive from two separate introductions, each of which was followed by a moderate degree of adaptive radiation.

Altogether, the approximately 1,700 species of native Hawaiian plants are descended from about 300 separate species that colonized the islands. The 10,000 species of native Hawaiian insects may be descended from only 350 to 400 separate founders. Biologists are now studying the different patterns of adaptive radiations seen in Hawaii to better understand the factors that influence evolutionary diversification.


92

congregate

03/14/2008

1:40 pm

jerry at 88-

It is not necessary to know anything about who, when and how a design event took place to conduct research.

I’m not sure what research you have in mind. As I understand it the journal established to publish ID research has not released an issue in several years.

In any event, it seems to me that documenting an actual design event would be convincing evidence for the ID theory. The claim that non-design is too unlikely to be true doesn’t seem to be making much headway in mainstream science. But every investigator can choose what they want to investigate.


93

DaveScot

03/14/2008

1:52 pm

Jack

The Hawaiian Island species should be a great test of Behe’s edge of evolution. He’d predict that all those species, if indeed they are biological species incapable of producing fertile hybrids, need little if anything in the way of new genetic material but rather all can be obtained from recombination of existing genetic material in the single ancestral genome. Does the evolutionary theory of chance & neccessity make any predictions at all in what, if any, mutations would be required for the observed phenotype variation? Here again we have a case where an ID theoretic view makes a testable prediction where chance & neccessity theorists make none. All chance & neccessity does is explain everything observed AFTER the observation is made - it has no predictive power at all and unlimited ad hoc explanatory power. It’s useless.

And by the way, the Hawaiin island chain at least is some 65 million years old and extends for at least 5000 kilometers from the youngest island. The vast majority of the islands have weathered away below sea level and comprise what’s known as the Emperor seamounts. Life on the island chain could have arrived anytime on any of the seamounts and then hopped from island to island as new ones rose above sea level and old ones sunk below sea level. Hopping 50 kilometers from one island to another is a lot more likely than travelling many thousands of kilometers over open ocean. So what you see in the way of variation happened over as much as 70 million years if not even much longer than that. Now the salient question becomes how much in the way of novel cell types, tissue types, organs, and body plans was chance & neccessity able to cobble up in all that time or did it do none of those at all? Anyone? Bueller?


94

jerry

03/14/2008

1:59 pm

Jack Krebs,

you said

“The Hawaiian Islands formed between 5 million and a million years ago. There are many example of great diversity among species and families of species, and all sorts of evidence shows that this diversity arose from a smaller number of founding species. Is this not evidence of gradualism?”

Jack you are demonstrating that you do not understand the debate. ID does not have any quarrel with the evidence you have presented. Is there any evidence that any of these species contain anything truly novel. NO!!

What you are showing is just a reshuffling of the gene pools to meet new environments. That is micro evolution via natural selection and actual great design. Now if you showed that any of those new species developed novel complex characteristics, you would have something. But what you have shown is how one aspect of good design works. You see ID does not deny that natural selection works in nature and affects how many species change over time.

This is just the micro evolution that Darwin saw on the Beagle and represents downward evolution. He extrapolated the wrong way in his book on origins. Darwin was witnessing great design. But no one has been able to explain where the gene pools come from that natural selection can then work on.

Keep plugging and you may come with something.


95

jerry

03/14/2008

2:12 pm

congregate,

There are thousands of ID studies done every year. They are in the mainstream biology and evolution journals. They are just not identified as such.

Read DaveScot’s comment just above. Any research study that compares genomes of animals qualifies as an ID study despite the intentions of the researchers. ID predicts that genomes of species in the same family or genera will not have any meaningful differences that can be attributed to gradualism. This proposition is confirmed over and over again.

So here is ID research that is on going and supporting ID. The authors just don’t know it. I find that deliciously ironic.

I have written a lot about this in the past couple months. One brief explanation of this is at

http://www.uncommondescent.com.....w-species/


96

godslanguage

03/14/2008

4:03 pm

To me, the Darwinian model/s (*which there seems to be many of) fails flat with chance and necessity. In any design specifications (from computer, cars, buildings, houses etc…) you have to define input variables, functions that work with those variables and the associated output/s in one way or another. One thing is for sure, there is a goal-directed or goal-oriented specific process (*a design method) needed to create not only complex structures but complex structures that serve a particular purpose. Humans design all sorts of complexities, most of which are defined to do a particular task, some designs are discarded, some designs are improved upon. One thing is for sure, there is some sort of intelligence making those exact choices otherwise if unintelligent decisions were made amazing inventions would not have existed today. Darwinian model especially looks stupid when you start putting it to the test, trying to understand how a non-design method with absolutely no design specifications puts together the illusion of design specific functions. I think that is why I agree that it is the most failed hypothesis in history (*as JAD always say). A good idea I think would be to define a design method for both products of “intelligent designs” and “Darwinian designs” and then compare both.

Intelligent designs:

Design Concept (IDea) -> main design specification -> design specifications (functions/blocks/partitions) -> defined interconnections between functions/blocks (ie: design flows) -> testing or simulation of main design (output) -> implementation of design else redefine design specification (ie: error correction or complete re-design)

Darwinian designs:

No design concept(no idea) -> no main design specification -> design specifications (functions/blocks) -> defined interconnections between functions/blocks (ie: design flows) -> output which is part of design implementation off the bat (*logically and physically integrated) -> design simply lives or dies as part of “natural selection” acting as a filter for “bad designs” (ie: error correction or complete new designs)

It is obvious Darwinian designs are missing `crucial` parts of the process. Any sane person could see/realize that Darwinian evolution simply doesn’t cut it. Darwinian design is not design at all, its a fairy tale is composed of magical speculations from atheists with agendas. ID to me is on track scientifically, I don’t see why any ID proponent should be intimidated by any Darwinian argument, I also don’t see why the onus is on the ID proponent to present evidence to the contrary when the contrary is completing wrong from the get-go.


97

RRE

03/14/2008

4:18 pm

Vjtorley said: “I see no reason why the discovery of another species of animal that could impose its own concepts upon matter would necessitate a conversion to atheism.”

Only humans can add concepts onto matter and produce machines and codes. Since humans are using intelligent causes to produce these codes and machines, it is only logical deduction that the genetic code and the biological machines that make up the animal kingdom were also produced via intelligent causes, simply because intelligent agency is required for ALL machines and codes based on reality and on the empirical study of the natural world. If you are to be intellectually honest and scientific, then you would have to point out a machine or code that was produced without intelligent causes in order to claim that atheism can work. I need an undirected, unguiding mechanism that can make a code or machine in order to believe that matter plus energy gives you life (without designer). This is because we ourselves fit into the definition of a machine, and we also are defined by our genetic code.

Vjtorley said: “Nor do I think that this ability is what makes us human. Before I explain why, and offer my own definition of what makes humans special, I’d like to make two comments. ”

Designing codes and machines is not what makes us human, but is still non-the-less, a unique characteristic of humanity.

Vjtorley said: “First, I think it would be helpful if you defined the term “machine.” I take it you believe that some tools are not machines. Why not? What qualities does a tool need to possess in order to qualify as a true machine?”

Since Darwinists love Wikipedia and they seem to possess some kind of slant unfavorable to ID, I will use their definition of machine.

Wiki says: “The scientific definition of a “machine” (derived from the Latin machina) is any device that transmits or modifies energy. In common usage, the meaning is restricted to devices having rigid moving parts that perform or assist in performing some work. Machines normally require some energy source (”input”) and always accomplish some sort of work (”output”). Devices with no rigid moving parts are commonly considered tools, or simply devices, not machines.”

Notice the last sentence, “…no rigid moving parts…considered tools…not machines.” So a quality a tool would have to possess to call it a machine is moving parts. A hook is not an example of a machine, just like an arrowhead is not, or a birds nest–they contain no moving parts. Nor is a hook a code either, so your example of the bird making a hook fails.

Vjtorley said: “Second, are you aware of the remarkable feats of Betty the Crow, a remarkable bird who designed a tool from a piece of wire so she could solve a problem - pull a bucket of food out of a tube-shaped container? Betty did this by taking a straight wire, jamming it into a crack at the base of the container, and then pulling it to the side several times until it made a hook. You can see a Quicktime movie of Betty in action at and judge for yourself. ”

Who cares about a bird making a hook, that is a non-issue. It’s not very remarkable either. Animals make tools all the time, and as I’ve stated previously, a birds nest is a more complex tool than a hook. None of them possess a moving part to be considered a machine.

Vjtorley said: “My point here is that this kind of behavior appears to qualify as imposing a concept [of a hook] upon matter [a straight wire], which was your criterion for intelligence.”

I never said anything about developing a criterion for intelligence. A hook is not a machine or code. My point was that humans possess the unique intelligence to produce codes and machines and add them onto matter while passing through time.

Vjtorley said: “I don’t know whether you’d be prepared to call such a hook a machine, but it certainly seems to qualify as a manifestation of some sort of intelligence: the crow was solving a new problem, and her actions can also be described as novel, as she had no other crows to serve as models, no training with pliant objects, and very limited prior experience with wire”.

No one in the whole world would classify a hook as a machine. Where’s the moving part or parts? Yes, the Intelligent Design of a hook is a manifestation of intelligence, so what? I am only interested in whether other animals can produce codes or machines. So far, you give no example that any other animal can produce them.

Vjtorley said: “More recently, follow-up work with Betty has lent further support to the view that Betty is genuinely able to understand how hooks work. I shall quote from the abstract of a paper by Alex Weir and Alex Kacelnik (draft version available online at http://users.ox.ac.uk/~kgroup/…..unbend.pdf ), entitled “A New Caledonian crow (Corvus moneduloides) creatively re-designs tools by bending or unbending aluminium strips”, published in “Animal Cognition”, October 2007; 9(4):317-34, 17024509 (P,S,E,B,D):”

This is exactly how materialists confuse you. Other animals can make tools (because they possess a mind, and a mind can intelligently design tools) and use them. But no other animal other than humans can make codes or machines. Please give me an example of Betty the crow making a machine or code. All animals that have a mind, have cognition. So what? I want to see another primate or animal make a WEDGE, or other simple machine.

Vjtorley said: ““Previous observations of a New Caledonian crow (Corvus moneduloides) spontaneously bending wire and using it as a hook [Weir et al. (2002) Science 297:981] have prompted questions about the extent to which these animals ‘understand’ the physical causality involved in how hooks work and how to make them. To approach this issue we examine how the same subject (’Betty’) performed in three experiments with novel material, which needed to be either bent or unbent in order to function to retrieve food. These tasks exclude the possibility of success by repetition of patterns of movement similar to those employed before. Betty quickly developed novel techniques to bend the material, and appropriately modified it on four of five trials when unbending was required. She did not mechanically apply a previously learned set of movements to the new situations, and instead sought new solutions to each problem. However, the details of her behaviour preclude concluding definitely that she understood and planned her actions: in some cases she probed with the unmodified tools before modifying them, or attempted to use the unmodified (unsuitable) end of the tool after modification. Gauging New Caledonian crows’ level of understanding is not yet possible, but the observed behaviour is consistent with a partial understanding of physical tasks at a level that exceeds that previously attained by any other non-human subject, including apes.””

Again, tools are a useless criterion, already, the bird can build a nest that is more complex and specified than the hook, so who cares about a hook. I am aware that animals can Intelligently Design tools, so what? The point I was making was that they cannot Intelligently Design machines or codes. That’s a unique ability of humans.

“Even if some animals possess a kind of means-end rationality, as Professor Alex Kacelnik suggests in a thought-provoking paper which can be viewed online at http://www.cogs.indiana.edu/sp…..nality.pdf , the fact remains that as far as we know, human beings are the only animals capable of critical thinking, which is defined (at http://www.criticalthinking.or…..inking.cfm )as “that mode of thinking - about any subject, content, or problem - in which the thinker improves the quality of his or her thinking by skillfully taking charge of the structures inherent in thinking and imposing intellectual standards upon them… Critical thinking is, in short, self-directed, self-disciplined, self-monitored, and self-corrective thinking. It presupposes assent to rigorous standards of excellence and mindful command of their use.””

This professor Alex Kacelnik says nothing about machines and codes, so it this plays nothing into what I said in any of my posts on this blog article.

Vjtorley said: “Without this meta-cognitive capacity, ethical reflection on the meaning of “right” and “wrong” would be impossible, and we would be incapable of acting morally. Reflecting on the course of one’s life and the mistakes one has made, and resolving to avoid those mistakes, also requires an autobiographical memory. Although recent studies suggest that some birds, such as scrub jays (see http://www.pubmedcentral.nih.g…..id=1088530 ) and Canadian rufous hummingbirds (see ), can remember specific episodes in their past - in particular, when and where they stored away items of food for retrieval at a later date - there is no evidence that these birds are capable of the kind of “mental time-travel” required for what theologians call an “examination of conscience” - e.g. recalling in chronological sequence the things they did between time A and time B, and asking themselves, “Where did I go wrong, and what did I do that was wrong?””

I don’t care much about morality, only interested if you can name another animal that has produced a code or machine.

Vjtorley said: “What I am suggesting here is that rationality is not the defining attribute of human beings, but a self-critical ability for critical reflection, coupled with an ability to recall events over the course of one’s life.”

I agree, rationality is not unique to humans, but the production of machines and codes is a unique attribute of human beings. I am waiting for you to prove me wrong.


98

Joseph

03/14/2008

4:33 pm

congregate,

Experience tells us it matters a great deal to any investigation whether or not that which is being investigated arose via agency involvement or nature, operating freely.

Also ID is based on two premises:

1) We know what agencies are capable of.

2) We know what nature, operating freely, is capable of.

Our experience tells us that only agencies create constructive machinery and nature, operating freely, tends to wreck things.

Our experience also tells us that living organisms are full of constructive machinery and only life begets life.

Conclusion-

If we want to know how things get wrecked things we turn to Darwin.

If we want to know how things get constructed we turn to ID.


99

Allen_MacNeill

03/14/2008

6:29 pm

DLH asked:

“Will you now take the step of: “I will believe in intelligent design “?”

I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.

Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.


100

Allen_MacNeill

03/14/2008

6:33 pm

vjtorley asked:

“…can you provide a rough, back-of-the-envelope calculation of how many mutations occurring in the human line since the human-chimp split would have had an effect on the development and/or functioning of the brain?”

Nope; not my area of expertise. Sorry.


101

Allen_MacNeill

03/14/2008

6:37 pm

vjtorley also asked:

“…is there any prospect of scientists in the future being able to situate [the changes that produced the human brain] in their correct chronological sequence?”

That’s an interesting question. We are right at the very beginning of the scientific investigation of the development of the nervous system via homeotic gene regulation. There doesn’t seem to be any reason in principle why such an analysis should be impossible, as far as I know. There are many laboratories working on precisely this problem (among others), so I would watch the journals for reports of their progress.


102

Allen_MacNeill

03/14/2008

6:38 pm

Frost122585:

As most of your post(s) consist of assertions without any evidence, I cannot address them. Sorry.


103

Allen_MacNeill

03/14/2008

6:45 pm

ericB:

If I understand your question about Huxley’s criterion correctly, I do indeed require more evidence for the origin of life from non-living materials, precisely because such an origin is closer to my other beliefs about how nature works. This is why I am pretty skeptical, not only of the current state of OOL research, but of the entire enterprise.

I hope I have made it clear that this skepticism has no bearing whatsoever on most of the rest of evolutionary biology, which after fifty years of study (by me) has provided enough evidence that I accept the general outlines of the theory in principle. However, as should be the case with any good scientist, I am ready to revise this viewpoint, but only the basis of new, very convincing empirical evidence to the contrary. So far, I haven’t seen (or read about) any.

And yes, I’ve read virtually everyting that Michael Denton, Michael Behe, and William Dembski have published. None of them has done a single empirical test to verify or falsify even the most trivial prediction that would unambiguously distinguish between current evolutionary theory and intelligent design. Theoretical speculation yes, but empirical research no, not one bit.


104

Allen_MacNeill

03/14/2008

6:53 pm

Pannenberg Omega asked (in #54):

“Is it possible that the Creator programmed everything into the early universe? Everything that would occur in cosmic/terriestrial history, the development of life and speciation. Could it all have been imputed in the begenining?”

If this were, indeed, the case, how could one distinguish empirically between this and a universe that operates without such input? Once again, an omnipotent, omnipresent, omniscient Intelligent Designer could certainly have created a universe with a set of universal laws which could produce everything we see around us with no further input. That was, in fact, exactly what Darwin believed, and wrote explicitly into the last paragraph of the Origin of Species:

“There is grandeur in this view of life, with its several powers, having been originally breathed into a few forms or into one; and that, whilst this planet has gone cycling on according to the fixed law of gravity, from so simple a beginning endless forms most beautiful and most wonderful have been, and are being, evolved.”

http://darwin-online.org.uk/co.....ageseq=508


105

Allen_MacNeill

03/14/2008

6:58 pm

RRE wrote (#58):

“We can show you that intelligent causes CAN produce machines and codes. ”

Yes, but have you shown (using empirical tests), that we can show you that intelligent causes DID produce machines and codes? And if you would be so kind to cite journal references in the primary literature, please?


106

Allen_MacNeill

03/14/2008

6:59 pm

That is, the “machines and codes by which living organisms assemble and operate themselves. I can look up when the earliest computers were engineered by humans.


107

Allen_MacNeill

03/14/2008

7:03 pm

Paul Glem:

Re comment #60: apology accepted. Thank you, Paul, for making it, and conducting yourself as a gentleman during our discussion. This is what a “community of scholars” does, IMHO. It’s easy to be generous to people with whom you agree. The test of a true gentleman is his generosity to people with whom he vehemently disagreed. I hope to live up to your example.


108

Allen_MacNeill

03/14/2008

7:10 pm

Paul Glem wrote (#60):

“WHy not just say that the molecular clocks aren’t trustworthy and leave it at that?”

Personally, I don’t necessarily put a lot of stock in “molecular clocks”. They require that the processes that produce mutations tick along at an almost unvarying rate. As a person who was a late, but full convert to Stephen J. Gould and Niles Eldredge’s theory of punctuated equilibrium, I find such assumptions to be unwarranted.

That said, one can often determine the sequence of events such as these, without necessarily knowing anything about when they occurred. This is analogous to the difference between absolute and relative dating in historical geology. The sequence of strata in the geological column were worked out nearly a half century before the publication of the Origin of Species. Darwin’s book didn’t change anything in this sequence at all. He (along with Lyell) simply provided an alternate explanation as to how the strata were deposited (and especially over what period of time), and what they implied about descent with modification.


109

Allen_MacNeill

03/14/2008

7:17 pm

bFast wrote (in #66):

“…in the gambling halls “winning streaks” and “loosing streaks” are a real statistical phenomenon. In other words, as I understand it, they happen often enough and strongly enough to challenge the expectations of the statisticians.”

Actually, just the opposite is the case. My friend, Tom Gilovich at Cornell, has published extensively on precisely this phenomenon. We perceive “streaks” in many such activities, including “hot hands” in basketball and “winning streaks” in gambling. However, if one applies fairly simple statistical analysis to such “streaks”, they disappear. I recommend Tom’s book, How We Know What Isn’t So: The Fallibility of Human Reason in Everyday Life (1993) Free Press, ISBN 0029117062, 224 pages.


110

Allen_MacNeill

03/14/2008

7:35 pm

DaveScot asked (in #93):

“Now the salient question becomes how much in the way of novel cell types, tissue types, organs, and body plans was chance & neccessity able to cobble up in all that time or did it do none of those at all?”

The salient question is not about novel cell types, tissues, organs, or body plans. The salient question is what kinds of processes are necessary to produce the kinds of reproductive isolation we observe among the various clades in the Hawaiian archipelago. And the answer is, most of those processes involve relatively slight behavioral and genetic changes, sometimes so slight as to be undetectable upon superficial examination.

Speciation, in other words, doesn’t take a whole lot of change. All it takes is something that prevents interbreeding for long enough that a population that was originally panmictic has slit into one or more populations between which there is little or no genetic exchange.


111

Allen_MacNeill

03/14/2008

7:39 pm

jerry wrote (in #94):

“Now if you showed that any of those new species developed novel complex characteristics, you would have something.”

This statement demonstrates a fundamental misunderstanding of what constitutes biological species. What separates closely related species is not “novel complex characteristics”; indeed, it may not be a genetic difference at all, as demonstrated by the breakdown of species boundaries between coyotés and red wolves (see my earlier comments in this thread for a more detailed discussion of this point). What separates species is often extremely minor behavioral and/or genetic differences, or even something as obvious as geographical separation, without any behavioral or genetic divergence.


112

RRE

03/14/2008

8:32 pm

Allen_McNeill wrote (#105):

“I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.”

That’s a very good start. Thank you for admitting genomes can be generated by genetic engineers (whether artificial or not does not even matter) — which are intelligent designers who have successfully added concept onto matter to make a machine work, in this case, a cell by manipulating its code. This genetic code coupled with the mitochondrial DNA code is the complete set of instructions for all the cell lines of the species and is especially important when placed inside of the female reproductive cell (I believe it’s the master cell — curiously it’s the biggest in every species) of the same species.

Allen_McNeill wrote (#105):

“Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.”

It’s already been shown to you. How do you not see it? Microtus pennsylvanicus is a MICROSCOPIC MACHINE with an even smaller genetic CODE or INSTRUCTION SET to BUILD proteins from scratch.
The bacterium fits the standard definition of a machine; you can look it up yourself. All machines when studying their origin were intelligently designed. So it takes intelligent causes to produce them.

“a device with moving parts, often powered by electricity, used to perform a task”
“… device used to overcome resistance at one point by applying force at another point…”
“An engine-driven means of transportation” (the flagellum in biology)
Encarta
“an assemblage of parts that transmit forces, motion, and energy one to another in a predetermined manner”
Merriam-Webster
“A device consisting of fixed and moving parts that modifies mechanical energy and transmits it in a more useful form”
American Heritage

What does a code mean? Here you go.
“a system of signals or symbols for communication”
“a systematic statement of a body of law” or the systematic statement of a cell.
Merriam-Webster

Show me any machine or code that can be produced without intelligence. You cannot do it. Only human intelligent designers make machines and codes, with the very real exception being biological organisms, which are more complex machines with a more complex code than we can make today with our own intelligent designing skills. So the finger goes back to you—YOU must empirically demonstrate a code or machine that has been caused into existence without using intelligent causes– purely naturalistic mechanisms as you say. Since you are excluding intelligent causes from your origins hypothesis a priori, as well the scientific realm when it comes to machines and codes, then YOU must provide and demonstrate empirically, a CODE and a MACHINE from some OTHER MECHANISM. If you can’t produce a machine or code by excluding intelligent causes then you are intellectually dishonest when you say that the bacterium, which manages to reproduce itself and contains molecular machines and instructions to communicate, can originate from just natural causes. You are BS-ing and tap-dancing around the issue. Machines and codes require intelligent design; it’s been empirically tested and confirmed in every instance. Show me otherwise or admit that it does require intelligent agency to make a code or machine, so as to keep your intellectual honesty.


113

RRE

03/14/2008

9:15 pm

Allen_MacNeill wrote (#110):
“The salient question is not about novel cell types, tissues, organs, or body plans. The salient question is what kinds of processes are necessary to produce the kinds of reproductive isolation we observe among the various clades in the Hawaiian archipelago.”

Admit that you’ve never empirically observed a species create a new cell type, tissue, organ, or body plan. That is why you are dodging that question from DaveScot.
The salient question for you is what kinds of processes are necessary to produce a cellular machine or a genetic code? Does one of the processes used involve intelligent design just like all of the other machines and codes observed in nature? Or is there some other purely natural mechanism that can produce a code or machine?


114

godslanguage

03/14/2008

9:39 pm

Allan_MacNeill wrote:
Yes, but have you shown (using empirical tests), that we can show you that intelligent causes DID produce machines and codes?

There is a difference between intelligent causes more likely produced machines and codes vs. intelligent causes did produce machines and codes. I don’t think you can empirically test the latter. What I think you can do is begin scratching out non-intelligent causes as a by-product of design x, is that scientific and testable?
If that is testable, then the inverse of that must also be true (ie: intelligent causes)
I distinguish non-intelligent (* ` causes` that are best known for not producing complicated interacting parts built for a specific task) from anything intelligent (* `intelligent causes` as the best known `phenomena` for producing complicated interacting parts built for a specific task).

{DLH deleted typo per following post}


115

godslanguage

03/14/2008

9:45 pm

(Edit: sorry for the typo in the first line, forgot to delete in wordpad from a previous document)


116

jerry

03/14/2008

10:01 pm

Allen MacNeill,

you said

“This statement demonstrates a fundamental misunderstanding of what constitutes biological species”

You have been a terror at the keyboard tonight but you have failed to pick up the irony in what I was saying. I have read, heard and watched discussions of “what is a species.” So I am well aware of the various definitions. What I am saying to Jack Krebs and others here who support Darwin is that what is held up as Darwinian evolution such as what Darwin himself saw is really a trivial reshuffling of the gene pool and not anything of consequence in terms of evolution.

Jack Krebs was a leader in defending Darwin at the Kansas school science standards discussions. And Jack doesn’t really understand the basics of Darwinian evolution but has lead a cause to preserve it in the schools. So I find it quite ironical.

What Jack offered as samples of evolution are just the reshuffling of the genes in the members of a population such that they can adapt to a new environment or ecology. The net result is to probably reduce the gene pool in each new population. The so called variants that are formed are probably not new species but maybe over time will develop slight differences so that they will not inter breed with the original population. And thus, over time be classified as a separate species.

But Darwin’s theory predicts over time that new novel complexity is formed by these slight changes and what I am saying is that examining all these populations will not support that. So what we are seeing is an evolution down to more restricted gene pools (order => family => genera => species=> variant or subspecies) and not up according to Darwinian theory which predicts the following species => genera => family => order. Darwin had it backwards.

So I am quite comfortable with your observations and have you know that you support a basic tenet of ID.

I just started to read Jablonka and Lamb and hope you are around in a few weeks when I have digested some of it.


117

Jack Krebs

03/14/2008

11:01 pm

Jerry writes,

Jack Krebs was a leader in defending Darwin at the Kansas school science standards discussions.

I was not “defending Darwin.” I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted by a Board who ignored the very processes for writing curriculum that they had established.

Darwin has been dead for 150 years, and the ideas he started have been modified and expanded upon tremendously. It is entirely inaccurate on multiple counts to say that in Kansas I was “defending Darwin.”

And Jack doesn’t really understand the basics of Darwinian evolution

Jerry may not think so, but I can assure you that Jerry’s idea that all evolution does is re-shuffle genes is not supported by the evidence nor supported by the vast majority of the world’s scientists knowledgeable about these matters. It is fine with me if Jerry wants to disagree with the mainstream view, but he is wrong to say that I don’t understand the basics of evolution just because I don’t agree with his minority perspective.


118

DLH

03/14/2008

11:46 pm

Allen_MacNeill at 99

I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.

Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.

Thanks for your clarification of your actual beliefs versus your previous statement.

I understood the identification of the human engineered genomes to be “empirical” - they did not ask the authors.

How do you define “empirical” besides looking at the observable evidence without asking the “author” or without “revelation”?


119

Paul Giem

03/15/2008

12:13 am

Allen_MacNeill, (108)

We apparently agree that the term “molecular clock” is an exaggeration if not a misnomer. And you seem quite willing to disregard it as an accurate measurement of absolute time.

You then go on to say, “That said, one can often determine the sequence of events such as these, without necessarily knowing anything about when they occurred. This is analogous to the difference between absolute and relative dating in historical geology.” I think we are on much shakier ground when we use molecular clocks to tell relative time than we are when we use geological strata to do the same. In geology, we can often find stratum A lying partly on top of stratum B, and thus be quite sure that, whatever their absolute ages, A must be younger than B. That, as I understand it, is relative dating.

But when we get to chromosomes, there is no analogous way of being able to determine that chromosome A has a younger divergence in two species than chromosome B. We simply don’t have chromosome A lying on top of chromosome B. We can’t tell relative age in that way. The only way (AFAIK) that we can attempt to say that A’s divergence is younger than B’s divergence is if if A has significantly fewer mutations per unit length than B. And here we run into a problem.

For, if the molecular clock is not accurate, we have to ask why. There are two possibilities. Either some organisms mutate faster than others (more, or perhaps fewer, generations of cells per unit of time, or perhaps less efficient DNA repair mechanisms, or perhaps living in a high radiation environment), or mutations are not actually effectively random. The latter seems highly likely. Exons, for example, mutate more slowly than introns. In fact, this has been documented in the eta-pseudoglobin genes in chimpanzees versus humans, where neither the “exons” nor the “introns” code for anything.

The mutations themselves may or may not be random. Perhaps some sites in DNA are relatively protected, perhaps by being tightly coiled most of the time. Or mutations in certain areas may cause the death of the cell, or of the organism made from that cell, so mutations in certain areas of DNA are less likely to occur in offspring even if they are just as likely to occur in cells. We have no theoretical warrant for believing that all parts of a genome should have the same mutation rate, and some evidence against that belief.

if there is a variable mutation rate within a genome, it is not appropriate for us to assume a constant rate and create stories to explain variations in mutation densities based on this assumption, thus interpreting mutation densities as time, even relative time. If we do create such stories, we must appropriately label them as speculation, and note that they have minimal foundation. IMO the article that was cited at the beginning of this thread failed to be cautious enough.

The problem is analogous to that of the canals on Mars. They just didn’t have the resolution to test the hypothesis in Percival Lowell’s day. Lowell would have been better off if he had said, there might be canals on Mars, but if so, my telescope just isn’t good enough to see. Ironically, there does appear to be a giant erosion feature near the equator of Mars, so Lowell wasn’t completely wrong. But by trying to go to the edge of resolution, he actually went beyond it, and serves as an example to us.


120

Bob O'H

03/15/2008

1:42 am

RRE @ 112 -

Microtus pennsylvanicus is a MICROSCOPIC MACHINE with an even smaller genetic CODE or INSTRUCTION SET to BUILD proteins from scratch.
The bacterium fits the standard definition of a machine; you can look it up yourself.

When you’re accusing someone else of BSing (as you do further down 112), it really doesn’t help your case if you’re unable to distinguish between a bacterium and a cute furry mammal.


121

sparc

03/15/2008

1:57 am

bfast

The HAR1F gene is an interesting thing. It consists only of point mutations, the smallest unit of mutational modification, yet it is fully irreduceably complex. The problem I see with the flagellum is that cooption and modification can still be claimed because genes contain an average of 300 nucleotides, so are not fully reduced.

I am lost: Do admit that flagella are not irreducible complex? Or do you mean that they were not irreducible complex directly after having been designed and are still on their way to irreducible complexity? When will they accomplish this state? Once they are encoded by a single codon?


122

Charlie

03/15/2008

2:21 am

Wow.
Some of these ID proponents don’t seem like proponents at all, now do they?


123

kairosfocus

03/15/2008

6:11 am

Mr Krebs:

I must take you up on a claim you made in 117, above. One that is very relevant to the overall context of this blog and which reveals a lot of what has gone wrong with science, science education, the media and public policy:

[JK, 117:] I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . .

1] What reasonable science definitions look like:

Did you use non question-begging, generally and reasonably acceptable “definitions” of science such as:

science: a branch of knowledge conducted on objective principles involving the systematized observation of and experiment with phenomena, esp. concerned with the material and functions of the physical universe. [Concise Oxford, 1990 -- and yes, they used the "z" Virginia!]

scientific method: principles and procedures for the systematic pursuit of knowledge [”the body of truth, information and principles acquired by mankind”] involving the recognition and formulation of a problem, the collection of data through observation and experiment, and the formulation and testing of hypotheses. [Webster's 7th Collegiate, 1965; I have deliberately chosen definitions from dictionaries that were published before the current controversies.]

2] What happened in Kansas, circa 2005 - 2007:

. . . or, was it that you and others, acting as advocates for in effect evolutionary materialism in the name of science, imposed a “standard” that in effect attempts to redefine “science” as the best materialistic [or, “naturalistic”] explanation of the cosmos from hydrogen to humans?

I therefore contrast the then [circa 2005] standards you evidently object to:

Science is a systematic method of continuing investigation that uses observations, hypothesis testing, measurement, experimentation, logical argument and theory building to lead to more adequate explanations of natural phenomena. Science does so while maintaining strict empirical standards and healthy skepticism. Scientific explanations are built on observations, hypotheses, and theories. A hypothesis is a testable statement about the natural world that can be used to build more complex inferences and explanations. A theory is a well-substantiated explanation of some aspect of the natural world that can incorporate observations, inferences, and tested hypotheses.

Scientific explanations must meet certain criteria. Scientific explanations are consistent with experimental and/or observational data and testable by scientists through additional experimentation and/or observation. Scientific explanation must meet criteria that govern the repeatability of observations and experiments. The effect of these criteria is to insure that scientific explanations about the world are open to criticism and that they will be modified or abandoned in favor of new explanations if empirical evidence so warrants. Because all scientific explanations depend on observational and experimental confirmation, all scientific knowledge is, in principle, subject to change as new evidence becomes available. The core theories of science have been subjected to a wide variety of confirmations and have a high degree of reliability within the limits to which they have been tested. In areas where data or understanding is incomplete, new data may lead to changes in current theories or resolve current conflicts. In situations where information is still fragmentary, it is normal for scientific ideas to be incomplete, but this is also where the opportunity for making advances may be greatest. Science has flourished in different regions during different time periods, and in history, diverse cultures have contributed scientific knowledge and technological inventions. Changes in scientific knowledge usually occur as gradual modifications, but the scientific enterprise also experiences periods of rapid advancement. The daily work of science and technology results in incremental advances in understanding the world.

With the following highly significant and ideologically loaded changes you apparently supported (circa 2007, from the same link):

Science is a human activity of systematically seeking natural explanations for what we observe in the world around us. Throughout history people from many cultures have used the methods of science to contribute to scientific knowledge and technological innovations, making science a worldwide enterprise. Scientists test explanations against the natural world, logically integrating observations and tested hypotheses with accepted explanations to gradually build more reliable and accurate understandings of nature. Scientific explanations must be testable and repeatable, and findings must be confirmed through additional observation and experimentation. As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes.

I object!

3] here are my reasons . . .

a –> Since there is a clear context in which “natural” in effect in context means evolutionary materialist [i.e. “the best materialistic explanation of the cosmos from hydrogen to humans”], the second excerpt clearly and improperly begs a lot of big questions.

b –> It is indoctrination, not education – and I say that as one who has taught in science and technology at high school and college level and has had a hand in curriculum and programme development. [You may wish to examine my discussion of science education here, which includes my own working out of a semi-definition of science (science, like many major activities and key concepts, is very hard to exactly define, i.e. I allude to the vexed debate over demarcation in phil of sci) and scientific methods in the context of briefing teachers on basic science education, a discussion I developed years before I had anything to do with debates over design.]

c –> Further to this, I observe that statistics is a major tool used in observational and experimental studies in science, and that in hypothesis testing, it in fact articulates several tools that are precisely useful for distinguishing [I] chance, [II] law-like natural regularities and [III] design/intent/agent action as possible causal factors, in the context of situationally plausible alternative hypotheses.

d –> Indeed, these tools are commonly used in the design of experiments, e.g. the use of control cases and various treatments, leading to ANOVA to analyse the impact of various factors to appropriate levels of confidence. So it is simply falsehood backed up by slanderous allusion, to say that “science currently has no tools to test explanations using non-natural (such as supernatural) causes.”

e –> For: [a] non-natural has a very relevant meaning, i.e “[intentional, intelligent] agent,” and [b] all of this is in the unacknowledged context of the too often INTENTIONAL misrepresentation of Intelligent Design as being about claimed scientific inference to the supernatural, where [c] in fact ID and a lot of pure and applied science works in a context where agent-cause is a relevant consideration and methods have been developed for addressing agent action – which is in this context a very relevant meaning of “non-natural.”

f –> I say “too often intentional,” as: if you and others of your ilk don’t know the basic context of the design inference across chance law-like regularity tracing to mechanical necessity and design, that is because of willful refusal to do basic homework on the nature and context of design theory. Sorry if that sounds harsh, but it is time to call you and your ilk to basic intellectual duty.

4] On what ID is . . .

I therefore, also, for purpose of basic illustration, cite Dr William A. Dembski, a leading Design Theorist, on this [in a context where he was precisely addressing the false charge that ID is principally about inference to the supernatural]:

intelligent design begins with a seemingly innocuous question: Can objects, even if nothing is known about how they arose, exhibit features that reliably signal the action of an intelligent cause? . . . Proponents of intelligent design, known as design theorists, purport to study such signs formally, rigorously, and scientifically. Intelligent design may therefore be defined as the science that studies signs of intelligence.

FYI, inference to intelligent action based on empirical evidence as traced through an explanatory filter is not at all the same as inference to the supernatural. (If you take time to look at my always linked, Section A, you will see that for instance the inference to intentional message, not lucky noise in communication science, is inherently an inference to design, and one that is strikingly relevant to the case of DNA studied as a code-bearing storage medium, i.e Section B. This in turn sets up the issue of body-plan level biodiversity such as may be seen in the case of the Cambrian life revolution, and thereafter the broader issue of cosmogenesis.)

Furthermore, supernatural entities are logically possible agents that may act into certain situations that may have empirical consequences that science may study.

That is, there are conceivably possible worlds in which such entities exist, and on critical examination of such possible worlds, we do not end in logical contradictions that reduce the world models to absurdity. So, it is improper question-begging to a priori rule out the inference to intelligent action on the grounds that it may possibly implicate supernatural agents or make them seem more plausible. For, we have no good grounds for concluding before we examine evidence and competing explanations on comparative difficulties, that this is not such a world.

__________

I therefore call upon you to help undo the harm you and your ilk have done.

GEM of TKI


124

kairosfocus

03/15/2008

6:40 am

PS: I should add that the proposed 2007 version’s words “[a]s it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause” are an indirect acknowledgement that the proposed materialistic standards are a historically unwarranted redefintion of science. [At least they don't make Judge Jones' blunder that this redefinition is centuries-old.]

Also, given the — sadly — too often encountered evolutionary materialist, closed minded objectionism rhetorical tactic of red herrings leading out to strawman misrepresentations burned to cloud and poison the atmosphere leading to a breakdown of civil discourse and nasty power plays, it may be helpful to put this FAQ on the 2005 standards on the table too.

In particular, given the objection on violation of procedure in 117, I note the balancing FAQs:

Q: What is the scientific basis for the changes?

A: Most of the changes reflect common sense and all have a solid scientific basis. They were crafted by eight members of the Writing Committee (the Authors), three of which hold doctoral degrees in the life sciences (biochemistry, entomology and medicine). They were then scientifically and educationally validated by 23 experts during 3 days of hearings in May, 2005 by 5 PhD biologists/ molecular biologists, 4 PhD biochemists, 3 PhD Chemists (2 with expertise in theories of chemical evolution - origin of life), 1 PhD Geneticist (the inventor of the Gene Gun), 1 PhD Quantum Physicist, 3 Philosophers of Science (two with PhD’s), 1 PhD Professor of Education, 3 biology teachers, a Muslim journalist and an attorney.

Q: Why do we get conflicting reports about the changes to the
standards?

A: Organizations that oppose the changes are unwilling to publicly debate evolution because they falsely claim it is not scientifically controversial. To avoid a discussion of the real controversy they unfairly demean those who seek it. See http://www.KansasScience2005.com for an explanation of the strategy of the media and public relations officer of Kansas Citizens for Science: our “strategy” is to “portray” those who seek an objective discussion of evolution “in the harshest light possible, as political opportunists, evangelical activists, ignoramuses, breakers of rules, un-principled bullies, etc.” The boycott of hearings that discussed key issues of science and education is an example of this strategy - to demean rather than to discuss.


125

jerry

03/15/2008

6:45 am

Jack Krebs,

You said

“Jerry may not think so, but I can assure you that Jerry’s idea that all evolution does is re-shuffle genes is not supported by the evidence nor supported by the vast majority of the world’s scientists knowledgeable about these matters. It is fine with me if Jerry wants to disagree with the mainstream view, but he is wrong to say that I don’t understand the basics of evolution just because I don’t agree with his minority perspective.”

All you or any of the world’s scientists have to do is provide some evidence. Is it too much to ask. All I have seen is micro evolution in any study that has ever been presented. The rest is speculation. All you have to do is prove this claim wrong. But all you do is commit the same fallacy over and over again, the argument to authority.

When pressed you most often defer to some unknown experts. When you finally produced some information, it was of a trivial nature (micro evolution) that ID does not disagree with. What the scientists are doing is presenting micro evolution and then without any evidence extrapolating that to macro evolution. And you fall for it. The embarrassing thing is that you are the one who is defending science standards and who does not understand the basics of the science being debated.

Jack, next time you should excuse yourself from the evolution debate in Kansas or anywhere else because you do not understand what it is about. Prove me or the other ID proponents here wrong. That is all we ask. There is a whole world out there that mocks and disdains those who support ID. Use them as resources. We would welcome the discussion.


126

DaveScot

03/15/2008

6:52 am

Allen

During the course of evolution there ostensibly appeared many novel cell types, tissue types, organs, and body plans. Any theory of evolution must account for the origin of those. If it does not then it’s only a partial theory which avoids the most difficult questions. How is it NOT a salient question to ask if any of these occurred over 70 million years on the Hawaiian islands? I understand why you’d wish to change the subject back to microevolution. But we aren’t really concerned about microevolution. We accept that species change over time due to recombination and natural selection. What we don’t accept is random mutation & natural selection building complex structures from scratch. Not in 5 million years, not in 70 million years, not in 500 million years, and not in 3 billion years.

I offered a testable hypothesis based on an ID theoretic view that the clades in the Hawaiin islands can all be derived from a common ancestor by rearranging genetic information that was already present in the ancestor. That you want to change the subject instead of addressing the hypothesis speaks volumes about this whole debate. We are asking for explanations about macroevolution and you change the subject to microevolution. Answer the question or admit that you can’t.


127

Joseph

03/15/2008

7:14 am

I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.

Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.–Allen MacNeill

Voles contain the genetic information for producing not only the necessary molecules that direct the construction of other molecules but also the differentiation of cell types.

We have NEVER observed non-telic processes doing anything like that. We have observed telic processes directing the construction of useful machinery.

Just the processes of transcription and translation alone SCREAM of intelligent design.


128

DLH

03/15/2008

10:10 am

Allen_MacNeill at 99
See DLH at 46, 118
May we explore further to see if we are communicating and to find further basis for common understanding. You stated at 99:

I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.

1) Explanatory Filter
It appears you may have applied the Explanatory Filter:
1.1) Law. e.g. there is no known physical law that would cause the “(CarlVenter)” copyright;
1.2) These characters do not appear to be caused by “chance”.
1.3) The characters correspond to a copyright “specification”.
1.4) The probability of these 39 characters occurring by chance is remote.
i.e. it appears sufficiently “complex” to satisfy your perception of chance vs being caused by an intelligent agent -

“there are only 33 + 45 + 24 + 39 + 39 = 180 characters = 360 bits.”

Would you in principle accept the more stringent criteria of Dembski’s “Universal Probability Bound” (UPB) of about one in 10^120?
If not, is there a probability boundary criteria that you would generally accept?

2) Type of Intelligent Agent:
We earlier explored assumptions of Neo-Darwinism. e.g.
Allen at 69
DLH at 79
DLH at 81

To find further common ground and communication, let me explore
Intelligent Design Assumptions
i.e. what assumptions I would use for a theory of Intelligent Design that you could recognize a a basis (-whether or not you personally believed them).
Can we clarify how/why you accept intelligent causation in this case of the “artificial” genome containing “(CarlVenter)”.

2.1) You apparently accept that a class of intelligent agents exist and that humans are included in that class.
For an Intelligent Design Theory,
2.2) May we accept that ID would hold:

1) Intelligence: Direct and indirect intelligent causes exist, including human beings and intelligent systems made by them.

2) Design: Intelligent causes design, build, and/or operate systems.

Kairosfocus at 118 #4) states:

I therefore, also, for purpose of basic illustration, cite Dr William A. Dembski, a leading Design Theorist, on this [in a context where he was precisely addressing the false charge that ID is principally about inference to the supernatural]:

intelligent design begins with a seemingly innocuous question: Can objects, even if nothing is known about how they arose, exhibit features that reliably signal the action of an intelligent cause? . . . Proponents of intelligent design, known as design theorists, purport to study such signs formally, rigorously, and scientifically. Intelligent design may therefore be defined as the science that studies signs of intelligence.

Kairosfocus further notes:

FYI, inference to intelligent action based on empirical evidence as traced through an explanatory filter is not at all the same as inference to the supernatural. “

If you wish to reply, could you comment further:
2.3 Can a theory of Intelligent Design focus on detecting evidence of intelligent causation WITHOUT identifying the intelligent agent?
i.e. Does the ORIGIN of the intelligent causation matter to you?
2.3.1 Is it “scientific” to accept evidence of “extraterrestrial” intelligent agents?
e.g.SETI searching for “aliens”,
or the obelisks in 2001? Would you allow ID to examine and model such evidence?

2.2.2) Would “science” or some “scientists” or you accept evidence of intelligent agents where the source was unknown?
e.g., would objective empirical evidence be sufficient without knowing the identity or abilities of the causation source?

2.2.3) Would “science” or you reject clear evidence of intelligent causation by ID as per 2.2.2, IF anyone alleged the source to be non-natural or “super-natural”?
Or does “science”, or some “scientists” or do you have a commitment to “philosophical naturalism” regardless of the evidence?
Can evidence of intelligent causation be recognized if the means of forming it is NOT know? OR if the capabilities of the intelligent agent are unknown or beyond what we understand?
OR would such evidence and inference of such “aliens” or “supernatural” agents be rejected regardless, from a commitment that such do not exist or cannot be accepted?

3) Acceptable evidence

Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.

3.1) Probability
Would “science”, some “scientists” or you accept the concept in principle of the stringent Upper Probability Bound of one in 10^120 sufficient to distinguish between what is likely to have occurred by “chance” vs by intelligent causation?
(e.g., considering that you have recognized the Venter copyright, as caused by human intelligent agents, where this has a much higher probability than this more stringent UPB)

3.2) Specification
Is the issue of an independent “specification” an issue?
i.e., what constitutes acceptable “specification” vs “painting a target around the arrow”?

3.2.1) Does the specification have to be independently specified?
3.2.2) Does it have to be specified BEFORE the experiment? or can it be recognized after as in the Venter case?
3.2.3) Would a precise biotic function suffice?
e.g. defining a matching or docking pair of proteins with the boundaries of allowable variations or SNPs.

PS See also my comments under
Does neo-Darwinian Theory Include the Origin of Life?, particularly

DLH @ 88
on the distinction between OOL and neo-Darwinian evolution.

On evidence, is “science”, or “some scientists” or are you looking for or will accept evidence for
4.1) Irreducible Complexity
4.3) Self reproducing organisms?
4.2) Macroevolution?

5) Small Free living bacteria
One option may be to select a bacteria with a small genome that is well studied. If there are enough studies on it, one example is:
Ocean bug has ’smallest genome’

Small but perfectly formed, Pelagibacter ubique is a lean machine stripped down to the bare essentials for life. Humans have around 30,000 genes that determine everything from our eye colour to our sex but Pelagibacter has just 1,354, US biologists report in the journal Science. . . . There are organisms with smaller genomes - Mycoplasma genitalium has about 400 genes. But these are all obligate parasites or symbionts, relying on other organisms to do the jobs they have abandoned. Pelagibacter is entirely self-sufficient. . . .But Pelagibacter on the other hand, accounting for a quarter of all organisms in the ocean, is a shining example of Darwin’s principle, the survival of the fittest.

Again I provide the caveat that you can take the “scientific 5th” of not answering - if you perceive that overzealous colleagues could take you comments and damage your career.


129

Patrick

03/15/2008

11:11 am

sparc,

bfast: The HAR1F gene is an interesting thing. It consists only of point mutations, the smallest unit of mutational modification, yet it is fully irreduceably complex. The problem I see with the flagellum is that cooption and modification can still be claimed because genes contain an average of 300 nucleotides, so are not fully reduced.

sparc: I am lost: Do admit that flagella are not irreducible complex? Or do you mean that they were not irreducible complex directly after having been designed and are still on their way to irreducible complexity? When will they accomplish this state? Once they are encoded by a single codon?

An IC machine cannot, by definition, be the result of a Direct Darwinian pathway. Direct means that the gradual steps are selected for the improvement of the same function we find in the final machine. IC makes a direct Darwinian pathway impossible. So, only two possibilities are left: either sudden appearance of the complete machine (practically impossible for statistical considerations, unless intelligence is involved), or step by step selection for different functions, and with the target function completely inactive for natural selection. This is called an Indirect Darwinian pathway (co-option). The reason a Direct Darwinian pathway is not an option is due to Irreducible Complexity since a Direct Pathway requires that a component have positive selective pressure for its FINAL function every increment.

Now that the basics are out of the way, sparc, your misunderstanding of bfast’s statement is based upon the mistaken belief that the mere potential for an Indirect pathway somehow makes an object “not IC”.

Also, I believe that bfast prefers HAR1F as an example for IC since the flagellum has components with standalone separate/different functionality. Thus there is the potential for an Indirect Pathway. I don’t know much about the HAR1F gene but I’m assuming that none of the point mutations provide separate/different functionality that could be positively selected in an indirect stepwise/gradual pathway?


130

RRE

03/15/2008

12:06 pm

Bob O’H wrote (#120):
“When you’re accusing someone else of BSing (as you do further down 112), it really doesn’t help your case if you’re unable to distinguish between a bacterium and a cute furry mammal.”

Hilarious and egregious. I apologize. My mistake still does not change my argument. Indeed the Microtus pennsylvanicus is still a machine by definition, which you conveniently ignored discussing. The vole still contains a genetic code. He’s still BS’ing if he or you or anyone else for that matter cannot come up with a purely natural cause or causes for how machines and codes come into existence. So tell me Bob O’H, what naturalistic explanation do you have that can produce a code and machine? I still pointed out that intelligent causes DO produce machines and codes EMPIRICALLY, however, you have yet to explain how a purely naturalistic cause or causes can explain such structures. Biological organisms are a type of a machine Bob O’H, with a code and transcription communication. You cannot ignore that. I showed you the definitions of code and machine.

Come on Bob O’H, real simple for you, show me a code or machine that can come into existence without the aid of intelligent causes.

Explain to me what causes are involved in the origin of machine and codes.


131

vjtorley

03/15/2008

1:22 pm

RRE:

Thank you for providing a definition of “machine”, as opposed to “tool”. On the basis of what we know, it is fair to say that your statement that other animals are incapable of producing machines and codes is empirically correct. I don’t know of any chimp or crow that has come close to making a mcahine.

However, I find it interesting that you are willing to allow that non-human animals possess an intelligence of sorts (especially those capable of making tools). Evidently you recognize the existence of at least two tiers of intelligence in nature: Type 1 or “animal-grade” (capable of tool-making and means-end reasoning) and Type 2 or “human-grade” (capable of making machines and codes). Are there any other grades that you recognize? For you, then, ID is evidence of Type 2 intelligence.

Finally, I have to respectfully disagree with your assertion that making a nest requires more intelligence than making a hook. As Encyclopedia Britannica puts it, “Some types of instinctive behaviour, while showing a rigid core of fixed action pattern, are still modifiable by conditioning and other learning processes… A good example is provided by the nest-building behaviour of many birds…” In other words, the process is largely innate, but requires some learning. No genuine insight, however, is required. Making a hook, as I have argued above, is novel behavior requiring a genuine insight on the bird’s part, to solve a problem that it has never previously encountered.


132

Bob O'H

03/15/2008

1:58 pm

The vole still contains a genetic code. He’s still BS’ing if he or you or anyone else for that matter cannot come up with a purely natural cause or causes for how machines and codes come into existence.

I can tell you how machines come into existence. It’s called reproduction. I’m told there are even videos of it available on the web.

Now, what mechanism do you have that brings machines as complex as like voles into existence? And what evidence do you have for it?


133

StephenB

03/15/2008

2:26 pm

Hi Leo: Welcome Back. Sorry about my misattribution on the other thread.


134

DaveScot

03/15/2008

3:03 pm

Bob

re; reproduction

Like produces like. We knew that already. Anything else?


135

Jack Krebs

03/15/2008

3:57 pm

Dave, I’m confused. You accept common descent, and I think you lean towards front-loading as the ID explanation. And yet you say here that “like produces like.” How do you reconcile these two? If “like produces like” then there is no way we could have life diversify and change over time. Is there something I am missing about your position?


136

bFast

03/15/2008

4:15 pm

Bob O’H:

Now, what mechanism do you have that brings machines as complex as like voles into existence? And what evidence do you have for it?

We have historical evidence that “intelligence” can bring extremely complex machines into existance. We have historical evidence that the machines available today are much more complex than the machines available just 10 years ago. There is good reason to believe that machines much more complex than exist now will be developed via the process of “intelligence” in the near future. So “intelligence” has the recognized ability to produce extremely complex machines.

NFV+NS has been proposed by the scientific community as a mechanism which, given enough time, can also produce extremely complex machines. There has never been a third proposed mechanism. Therefore, any serious challenge to the viability of the NFV+NS hypothesis is, by right of the fact that only two options are on the table, evidence in favor of the “intelligent causation” hypothesis.


137

bFast

03/15/2008

4:32 pm

sparc:

I am lost: Do admit that flagella are not irreducible complex? Or do you mean that they were not irreducible complex directly after having been designed and are still on their way to irreducible complexity?

The bacterial flagellum is absolutely irreduceably complex — by definition. There are many parts to the flagellum which, if removed, render the flagellum totally incapable of flagelling, of propelling a bacterium. The definition of irreduceably complex is a series of parts which, if any one is removed, cease to perform its original task.

However, Behe notes that it is not “totally inconceivable” that Irreduceable Complexity can evolve. It remains subject to “just so” stories, as illustrated by Matzke’s tale. I am quite convinced, however, that the flagellum, and anything else ingenious within nature, did not evolve via NFV+NS.

The HAR1F, on the other hand, produces a ring. There is a straight segment, a loop, and another straight segment. The two straight segments are stuck together because the nucleotide* on the first is attracted to the nucleotide on the second. It does so because the pairs of nucleotides that are lined up attract each other. Its like a lock and key. We have about 50,000 species worth of proof that this is an unevolvable mechanism. The HAR1F exists in all birds and mammals, I am not sure about reptiles. In every species but man, the portion of the gene that produces this lock-key system IS EXACTLY THE SAME. Yet in man, a sequence of 18 point mutations invites the two bonding segments to allign differently, creating a larger loop **. Because of the lock-key effect, all 18 had to happen at once. REMEMBER WE HAVE 50,000 SPECIES WORTH OF PROOF THAT THE THING IS UNEVOLVABLE!

* This is an RNA gene, rather than a protein generating gene, so it works w/ nucleotides rather than aminos.

** Though the specific effect of this change has not yet been determined, the gene is involved in brain development. It is believed that the larger loop makes a positive difference to the human brain.


138

ericB

03/15/2008

5:05 pm

bFast, Thanks for sharing HAR1F example. Quite impressive. I wonder what an evolutionist would counter-propose.

Two other factors that become significant in this case are the population size and rate of reproduction for large bodied organisms. As Dr. Behe examined at length in The Edge of Evolution, both of these limit how many attempts are available to an undirected process for an organism.

For humans (or hypothetical pre-humans), both of these are far more restricting than for bacteria.


139

bFast

03/15/2008

6:26 pm

ericB, “Two other factors that become significant in this case are the population size and rate of reproduction for large bodied organisms….For humans (or hypothetical pre-humans), both of these are far more restricting than for bacteria.”

This is the core of ReMine’s claim that there has been far too much mutational change between humans and chimps to be accounted for by the theory. He has the support of the famous evolutionist Haldane. To make matters worse, he works on a calculation of 1% difference between human and chimp. The latest estimate is more like 5%. I think he has a convincing argument.


140

Allen_MacNeill

03/15/2008

6:56 pm

Paul Glem wrote (in #119):

“But when we get to chromosomes, there is no analogous way of being able to determine that chromosome A has a younger divergence in two species than chromosome B.”

Actually, there is a surprisingly analogous way to do exactly that. If we find a certain sequence of nucleotides that is very similar across several individuals or groups, we can use it to construct a “consensus sequence” which can then be compared with other sequences (i.e. we can perform “inter-genomic” comparisons). If in a new individual (or species, or whatever) has a new sequence inserted into the known consensus sequence, then the simplest explanation is that this insertion took place after the consensus sequence became established. This method is quite similar to the one used by Biblical scholars to determine the order of writing of the four Gospels, BTW). By using a series of side-by-side comparisons, it is relatively easy to determine the sequence of insertions (and also of later deletions), and thereby construct an empirically verified and logically plausible chronological sequence for the construction of any well-known genome.

The kicker is, of course, the phrase “well known”. We are only in the very beginning stages of this enterprise (equivalent to the interpretation of the sequence of strata in the geological column in, say, 1830), and only a relatively few genomes are mapped well enough to apply this method rigorously and widely. However, with increasing amounts of data derived from genome mapping experiments (such as the human genome project), it should be possible to build up a chronological sequence of the construction of genomes over many species in many different taxa.

As to correlating this with absolute dates, that’s much harder to do. Comparing the sequences generated by such inter-genomic analyses with the data provided by molecular “clocks” has been one of the sources of skepticism about the latter, as the timing of insertions and deletions using molecular “clock” data shows an number of anomalously fast (and slow) insertions and deletions when compared with “background” mutation rates.

Note also that the best comparisons are between non-coding (i.e. “junk”) sequences, as they are neither conserved nor altered by selection, but rather “drift” in ways that are relatively well-understood (and can be verified by standard mathematical and statistical analyses).


141

Allen_MacNeill

03/15/2008

7:04 pm

Paul Glem wrote (in #119):

“…or mutations are not actually effectively random.”

As Jablonka and Lamb (among many others) have repeatedly pointed out, most mutations are clearly not random, at least not if by “random” one means “likely to happen anywhere in the genome.” As just one example, mutations are much more likely to happen in sequences of nucleotides (i.e. genes, etc.) that are actively being transcribed. This, in turn, means that environmental inputs (especially those that cause physiological stress) are likely to induce more mutations in precisely those gene sequences that are responding to that stress. Therefore, rather than being “random”, mutations tend to happen in those parts of the genome that code for structures and functions that are currently undergoing selection.

This process is the basis for what C. H. Waddington called “genetic assimilation”, an area of extremely hot research in evo-devo at the present time.


142

Allen_MacNeill

03/15/2008

7:08 pm

Bob O’H (in #120):

I wondered if someone would stick their finger into that particular “mousetrap ;-) “.

As I learned long, long ago as a teacher, never try to bluff your way through something you don’t understand. Some of your students will see right through it (and a few will deliberately set traps to destroy your credibility — these usually graduate to law school).


143

Allen_MacNeill

03/15/2008

7:27 pm

Patrick (in #129):

The “indirect” process you briefly describe is precisely the mechanism by which most, if not all, evolutionary adaptations are produced. As Elizabeth Vrba and Stephen J. Gould explained in “Exaptation—a missing term in the science of form” (Paleobiology 8: 4-15 (1986), many if not all “adaptations” are the product of cooptation of other structures adapted for other functions. That many evolutionary biologists and virtually all ID supporters are “pan-adaptationists” explains why this viewpoint is still misunderstood by a very large number of people.

For more on this question, see my blog at:

http://evolutionlist.blogspot......-real.html


144

ericB

03/15/2008

7:30 pm

Allen_MacNeill (103):

“If I understand your question about Huxley’s criterion correctly, I do indeed require more evidence for the origin of life from non-living materials, precisely because such an origin is closer to my other beliefs about how nature works. This is why I am pretty skeptical, not only of the current state of OOL research, but of the entire enterprise.”

Thanks for responding. Sorry, I don’t think my question on Huxley was clear enough.

Applying Huxley’s principle to the proposal of abiogenesis, it would seem to me difficult to get farther away from the spirit of Huxley’s principle than to deny the very existence of any empirical evidence against that “view which jumps with my preconceptions”.

One doesn’t need to look to ID advocates to know there is relevant empirical evidence being produced in that field. Ask any of the OOL advocates in that field how the empirical evidence applies to (i.e. against) someone else’s theory and they will be glad to tell you. Metabolism-first will tell you the strong empirical evidence against RNA-first, and RNA-first gladly returns the favor. Ditto for every earlier proposal.

Yet, in the thread “Does neo-Darwinian Theory Include the Origin of Life?”, you repeatedly denied that there was any relevant empirical evidence.

To go a step further removed from the spirit of Huxley’s injunction, one could claim that evidence against abiogenesis not only does not exist but will not exist, perhaps even cannot exist. One way to render abiogenesis immune from scientific criticism would be to maintain that (unless positive evidence appears) it is a question that, as you put it, “must remain in the realm of metaphysics, rather than science“.

So, as long as there is only evidence against abiogenesis, it is just a metaphysical question. If positive evidence appears, then it becomes truly scientific. But until then, abiogenesis is not falsifiable. It can never be disqualified as a normal scientific proposal could. It might eventually win, but until then it is effectively immune to actually losing. It can keep trying without fear of disqualification, since no amount of evidence against it is considered evidence at all. But even while trying and failing, scientists are free to confidently proclaim in public that life did arise spontaneously from non-life, we just don’t know how yet (and may never know how).

I cannot right now think of a position on abiogenesis more distantly removed from the spirit of Huxley’s injunction than that.

As far as I can tell, you have not allowed for any real skepticism about the “view which jumps with my preconceptions”, i.e. whether it is true that undirected processes created the life we see.

Please correct me if I am mistaken, but it seems the skepticism only extends to whether the OOL enterprise will be able to show that that view is true, not to whether people should believe it is true. Else why insist “that there is no empirical evidence either way, nor is it likely that such evidence will eventually be forthcoming“?

[Additional new post on the recent OOL thread.]


145

Allen_MacNeill

03/15/2008

7:53 pm

On HARF1:

I’ve reviewed as much of the published information on this RNA gene as I could find online (it’s spring break here at Cornell and the libraries close early). As far as I can tell, the 18 differences that have been mentioned evolved over a period of several million years. Furthermore, according to a recent report in Nature, most of those changes probably do not significantly alter the function of the gene. Rather, they fine tune the three-dimensional structure of the RNA for which it codes in such a way as to allow it to continue to form stable base-pairs within its own structure.*

This is a very long way from the assertions made by several commentators here that “all 18 changes had to happen simultaneously” and that it would therefore be impossible for such changes to have come about in a way that conforms to the “standard evolutionary model.” On the contrary, as long as selection continued to operate on the HARF1 genetic locus, all it would take to evolve its current structure and function is a maximum of three to four minor changes in nucleotide sequence per million years. Even that estimate is probably too high, as it assumes that all of the changes that have occurred significantly alter the function of the RNA for which the gene codes, an assumption which is not supported most of the available information on the gene’s function.

Furthermore, as we learn more about how this gene operates (right now we don’t really understand exactly what it does, only that it is correlated with changes in the structure of the cerebral cortex), it is quite possible that a sequence of evolutionary changes consistent with empirically verified functions for the gene can be worked out. It seems to me to be the height of presumption to pass judgment on these issues at the present time…unless, of course, one wants to forestall the very kind of investigations that might reveal the details of its evolutionary origins.

*By the way, the so-called “ring” structure that some have mentioned doesn’t actually exist in the three-dimensional structure of this RNA (or any RNAs, including the rRNAs found in ribosomes). Rather, its a common convention in the schematic depiction of such RNAs in a two-dimensional diagram, intended simply to show that the “ring” sections do not base-pair with other parts of the molecule. It would be much more accurate to refer to such unpaired regions as “flattened hairpin loops”, as that’s the shape they actually have in three-dimensions.


146

Allen_MacNeill

03/15/2008

7:57 pm

DLH posed a series of questions in post #128. However, before I can begin to answer any of them, I believe that we need to agree on exactly what we mean by “intelligent.” How can one identify whether something is “intelligent” in a way that is not simply a form of argument by analogy? That is, would someone please propose an operational definition of “intelligence” in such a way that its presence or absence can be empirically and statistically verified?

Otherwise, arguing about “intelligent design” simply reduces to arguments from hidden premises.


147

Allen_MacNeill

03/15/2008

8:10 pm

ericB wrote (in #145):

“Yet, in the thread “Does neo-Darwinian Theory Include the Origin of Life?”, you repeatedly denied that there was any relevant empirical evidence.”

Perhaps I did not make myself clear. What I asserted was not that there was no empirical evidence, but rather that all of the empirical evidence to date has been quite indirect. That is, there is no direct evidence for the OOL because no rocks from that period remain at the Earth’s surface, and even if they did, molecules (and even cells with no “hard parts”) do not fossilize.

Ergo, all of the empirical evidence to date has been obtained via experimental and observational tests performed today. Although the results of such research are quite fascinating, there is no guarantee that the actual origin of life occurred in the way suggested by such tests.

To use a legal term, all such evidence cannot rise above the level of “circumstantial” evidence, and although such evidence has sometimes led juries to convict suspected criminals, I honestly don’t see how it could, in scientific terms, amount to being “beyond a reasonable doubt.”

So what? I grow tired of saying this, so this will be the last time: verification (or lack thereof) of any of the current hypotheses about the origin of life have literally no bearing on the overwhelming majority of the topics subsumed under the term “evolutionary biology”, including the “origin of species” and the evolution of humans. Darwin didn’t write about the OOL of life at all (for good reasons); who am I to gainsay him?


148

Allen_MacNeill

03/15/2008

8:22 pm

ericB also asked:

“Please correct me if I am mistaken, but it seems the skepticism only extends to whether the OOL enterprise will be able to show that that view is true, not to whether people should believe it is true.”

Precisely: I’m not interested in “belief” at all. Science isn’t about “belief”, it’s about evidence obtained via empirical investigation. So far, there is an accumulating body of indirect evidence that does not contradict the abiogenetic hypothesis. I am not aware of any empirical evidence (indirect or otherwise) to the contrary. Hence, indirect evidence will almost certainly be all we will ever have. As that evidence indirectly supports the abiogenetic hypothesis, it is the only one I would currently support, lukewarm as that support is (and probably always will be).

As to the relevance of any of this to that huge and growing body of knowledge known as evolutionary biology, I have already posted my last words on that subject. And, as it is late and this is spring break, I will probably not be returning to this venue for a while. Thank you all for a stimulating exchange of views; the only thing missing was a pint of Dublin’s best, a lack that I intend to rectify at my first opportunity. Slán agaibh!


149

Jack Krebs

03/15/2008

9:23 pm

Thanks to Allen for all his thoughtful and informed posts.


150

bFast

03/15/2008

10:36 pm

Allan_MacNeill (144):
I followed into your interesting link.

not all of the characteristics of living organisms are adaptations (i.e. some of them are the result of pure “chance,” not necessity), and

If I understand correctly, one such contingent feature that Gould specifically mentions in 8 Little Piggies is pentadactile phenomenon. Thought the first quadrupeds had more than 5 digits per limb, since 5 was settled on, it has not been exceeded by any known species. This phenomenon rightly baffled Gould. He felt that it should be seriously studied because there was no reason for this restriction within his field of expertise. To some extent it has been studied. We know that polydactilism occurs naturally on occasion in at least 4 species: humans, dogs, cats and mice. In all cases it is caused by a single point mutation. I suggest that this is an example where nature has actively avoided an available solution without natural explanation. I suggest that it is evidence that the laws of randomness and contingency are not in control of nature.

the surprising outcome has been that even some gene sequences that were thought to have been very important in selection (due to having been “conserved” over deep evolutionary time) are apparently insiginificant or even useless. We know this because knocking them out of the genome has no discernible effect on the survival or reproduction of the “knock-out” progeny. If one is the kind of “pan-adaptationist” that Lewontin and Gould criticized, this outcome should come as a severe shock, as it should to every IDer.

Oh contrair. This is absolutely predicted by the front-loading hypothesis. It is certainly within the scope of what we would expect witin the ID framework. As far as fitting with the NFV+NS definition of evolution, well, it doesn’t! Within materialistic evolution there is only one DNA pereservative, natural selection. If a modification to DNA can occur without producing an inferior organism, the theory says that it will be tried.

This position was made very clear when I debated this issue at telic thoughts. I debated with a biologist who suggested that the current studies did not go far enought to prove that the sequences in question offered no selectable advantage. However, he agreed, rightly, that if it were so established, the universality of the theory would have to be abandoned — that there must be something more than NFV+NS to explain these results.

You said:

But, if one is a true “Darwinian” (i.e. a devotee to that tradition which questions absolutely all assumptions, including the very existence of “adaptations” and “species”), it should come as no surprise at all.

I would say that you are absolutely correct in this statement, if what you mean is:

A true Darwinian is one who accepts the Darwinian religion unquestioningly. Evidence to the contrary be damned!


151

DLH

03/15/2008

11:14 pm

Allan_MacNeill at 147 per DLH at 128
Re: Definition of Intelligence You asked:

we need to agree on exactly what we mean by “intelligent.” How can one identify whether something is “intelligent” in a way that is not simply a form of argument by analogy? That is, would someone please propose an operational definition of “intelligence” in such a way that its presence or absence can be empirically and statistically verified? Otherwise, arguing about “intelligent design” simply reduces to arguments from hidden premises.

Good question on exploring for hidden presuppositions.

Please start by reviewing:
ID Assumptions
These begin with:

Intelligence
Direct and indirect intelligent causes include intelligent beings, and systems formed by intelligent beings. Humans exercise and describe actions they ascribe to intelligence. E.g., communicating, interacting with issues and problem solving, and use objects designed and built by intelligent beings.

Are these “ID Assumptions” necessary - and sufficient?

I would pragmatically state that “intelligence” is a common characteristic of the class of “intelligent beings” as demonstrated by activities of the subclass of human beings. In particular, intelligence is demonstrated by: communicating, interacting with issues, and problem solving, and using objects and systems designed and built by intelligent beings.

Does this definition satisfy you?

(If it would help, I would add that: “Intelligence is distinct from the operation of natural law and chance.” (following the Explanatory Filter).
However, some complain that doing so results in a tautology or circular argument.)

Following are some further links on Intelligence & ID:
Defining Intelligence at ResearchID
This further discusses: awareness, self awareness, foresight, imagination, knowledge, thought experiments, understanding, volition, and wisdom.

Intelligent Design ISCID Encyclopedia

Intelligent Design New World Encyclopedia

Mathematician and philosopher William A. Dembski rejects Sober’s criticism and defends the analogy. “We infer design regularly and reliably,” Dembski wrote, “without necessarily knowing the characteristics of the designer or being able to assess what the designer is likely to do… We do not get into the mind of designers and thereby attribute design. Rather, we look at the effects in the physical world that exhibit clear marks of intelligence and from those marks infer a designing intelligence. This is true even for those most uncontroversial of embodied designers, namely, our fellow human beings. We recognize their intelligence not by merging with their minds but by examining their actions and determining whether those actions display marks of intelligence” (Dembski 2004, pp. 192-193).

As Dembski put it in The Design Revolution (2004): “The fundamental claim of intelligent design is straightforward and easily intelligible: namely, there are natural systems that cannot be adequately explained in terms of undirected natural forces and that exhibit features which in any other circumstance we would attribute to intelligence.”[17]

#17 Dembski, W. A., The Design Revolution: Asking the Toughest Questions About Intelligent Design (Downers Grove, IL: InterVarsity Press, 2004), 27.

PS As an example, since you asked about it, I consider you to be an instance of the subclass of human beings and to demonstrate intelligence by your communications here. Similarly, the computer, software, communications system and internet that you are using are further evidences of humans applying intelligence.
PPS Thanks for your marathon fortitude in posting and interacting.


152

Bob O'H

03/16/2008

1:58 am

bFast @ 137:

We have historical evidence that “intelligence” can bring extremely complex machines into existance. We have historical evidence that the machines available today are much more complex than the machines available just 10 years ago. There is good reason to believe that machines much more complex than exist now will be developed via the process of “intelligence” in the near future. So “intelligence” has the recognized ability to produce extremely complex machines.

So, a vole will be designed in the future. Will this be before or after the invention of the time machine? :-)

More seriously, I think you’ve made my point - we don’t know of any intelligence that is capable of designing something as complex as a vole. Unless one wants to claim knowledge of one of the many revealed religions.


153

DaveScot

03/16/2008

3:16 am

Bob

we don’t know of any intelligence that is capable of designing something as complex as a vole

Yeah but intelligence is the only thing we know of that remotely approaches designing things as complex as a vole. A space shuttle along with all the associated manufacturing and support facilities may not be as complex as a vole but it approaches it.

The laughable thing here, Bob, is that you are asking design engineers to agree that a recursive, mechanical trial and error mechanism bounded in time and space can produce things more complicated than the space shuttle and all its manufacturing and support infrastructure. Any design engineer who uncritically accepts that without demonstrable proof should have his head examined. The problem isn’t with the mechanism but rather in the bounds. Given an infinite number of trials the mechanism is adequate but the number of trials isn’t infinite. It’s bounded by the size and age of the universe.


154

DaveScot

03/16/2008

4:12 am

Allen

For our purposes we need two definitions: intelligence and intelligent agency.

I propose that intelligence be defined as the ability to conceptualize patterns of matter and energy that aren’t known to exist in the real world. In other words intelligence is the ability to form abstractions or perhaps more apt is the ability to imagine things. Intelligent agency is the ability to translate what’s imagined into physical reality.

For instance we humans have long been able to imagine walking on the moon and eventually our ability as intelligent agents translated our imagination into reality.


155

kairosfocus

03/16/2008

4:51 am

Participants (esp. Mr Krebs and Dr MacNeill):

Interesting onward exchanges.

I further intervene for two reasons.

1] Mr Krebs:

Above, you made a serious accusatory statement regarding those on the other side of a curriculum dispute in Kansas.

I responded, at what is now 124, challenging you to substantiate your claims in light of certain considerations on the objective definition of science and related observations on rhetorical and regulatory tactics.

You have further interacted at 150, and I see that there is silence on a situation where you have asserted serious accusations; accusations that cannot just be left to stand on one’s say-so.

That silence, sir, if deliberate, is telling — and not in your favour.

So, I think you need to respond, and respond cogently on the substance.

2] A private contact

One of the lurkers has contacted me and suggests that I [and/or others] should raise a point on the main focus of the blog.

I will do so, without endorsing the remarks, to see what the more biologically oriented participants have to say:

+++++++

From Lurker X, as excerpted and re-organised:

First, a context:

Allen_MacNeill: “An interesting question is, did this fusion event have anything directly to do with the genetic and phenotypic divergence between the two lines of primates that eventually became chimps and humans? The answer is not immediately obvious, as simply fusing together two chromosomes doesn’t change the genetic information they carry nor how it is expressed, it only changes how it’s segregated during meiosis.

It does, however, strongly suggest that the two evolving lines of primates were sufficiently isolated from each other for long enough for such genetic differences to accumulate. …”

X’s remark on its underlying significance as he sees it:

[E1] . . . the problem for ‘modern evolutionary theory’ is that the best scientific and medical knowledge tells us that at the critical juncture, the logically necessary individuals to “explain” the difference of the human karyotype [in effect, chromosome set] from the ape karyotypes will have a reduced fertility.

Furthermore, the only way to even *get* the human karyotype in the first place is by the breeding together of such relatively infertile individuals (in which crossings their individual infertility is multiplied).

[E2] this particular hypothetical (and necessary, if humans are related to apes) chromosomal fusion … according current scientific and medical knowledge … will serve to reproductively isolate the two species of proto-humans and hypothetical-parent-species.

BUT . . . this reproductive isolation *also* applies at the proposed (and necessary for ‘modern evolutionary theory’) beginning of the formation of the proto-human species as a distinct breeding population.

What I mean is: the same facts that would explain why the (assumed) proto-human species and hypothetical-parent-species are reproductively isolated at some time after the hypothetical chromosomal fusion event *also* explain that the very first proto-humans (and indeed, the very first single individual proto-human) are reproductively isolated from the hypothetical-parent-species.

Dr MacNeill, just on a point of interest [for, to me, the issue of speciation and chromosome fusion events of humans relative to chimps is of relatively little significance relative to the origin of the information that makes us so different from our alleged chimp cousins, much less the overall origin of biofunctional, complex information challenge that is best illustrated by the macro-level diversity in the Cambrian revolution and in OOL], what is your response?

+++++++++

Okay,

GEM of TKI


156

DaveScot

03/16/2008

4:59 am

Allen

the surprising outcome has been that even some gene sequences that were thought to have been very important in selection (due to having been “conserved” over deep evolutionary time) are apparently insiginificant or even useless. We know this because knocking them out of the genome has no discernible effect on the survival or reproduction of the “knock-out” progeny. If one is the kind of “pan-adaptationist” that Lewontin and Gould criticized, this outcome should come as a severe shock, as it should to every IDer.

No shock to me. I’d already settled on a front loaded genome as the best explanation for phylogenesis. I called it a phylogenetic stem cell. My hypothesis required something other than natural selection that could preserve genetic information. It needs a mechanism for preserving unexpressed genome content over very long spans of time. Given the common mantra that “evolution is cleverer than you are” and given that I’m clever enough to devise ways to insure data integrity well beyond what’s required for my hypothetical front loaded genome (see here) it’s not a problem from a design theoretic view to preserve unexpressed genomic information for billions of years.

So it came as not a shock but rather a pleasant surprise that evidence of such a mechanism was discovered. It was a shock to the neo-Darwinists but not to me. I wrote about it over a year ago here.

I followed what the researchers have done since the shocking finding that deleting 2 million base pairs containing 1000 highly conserved non-coding sequences in a mouse genome produced GM mice with no detectable abnormalities. One might have thought they’d want to know what the hell conserved all that genetic code but they didn’t. The problem, Allen, is that no one is interested in testing natural selection anymore. It’s moved beyond theory to dogma. No one tests dogma. So instead of testing the theory that natural selection is the only force working to conserve genetic information they simply assumed there must be some unobserved selective advantage in the deleted code and left it at that. Dogmatic belief in chance & neccessity was a “science stopper” in this case, Allen. The researchers were interested in using conserved sequence knockouts to identify function of the sequences. Finding none in non-coding sequences highly conserved between man and mouse over some 180 million years of reproductive isolation, instead of asking why those sequences had no evident function they instead just brushed it off and decided to go further afield and do knockout experiments with sequences conserved between man and amphibian, man and reptile, and man and fish. So one of the most startling findings I’ve ever seen, a finding that would negate everything we think we know about natural selection and conservation of genomic information, was set aside as not interesting enough to investigate further. In the immortal words of the Saturday Night Live church lady “isn’t that just precious?” :-)


157

DaveScot

03/16/2008

5:50 am

kairos

Good point. The fusion event in a primate ancestor ostensibly happened in a single offspring. A haploid 24 parent birthed a haploid 23 offspring. How was this rare mutation propagated? Anyone? Allen?

One hypothesis that I really like is that endogenous retroviruses cause the same mutation to happen in a large number of individuals in the same generation. Individuals in contagious contact are also in breeding contact. Greg Bear in the science fiction work “Darwin’s Radio” used this hypothetical mechanism as a plot element. He spun a story (in grand Darwinian fashion) of a network of endogenous retroviruses being activated by an environmental stimulus to spawn Homo sapiens sapiens from Homo sapiens neanderthalensis in a saltation and then the same mechanism was triggered again in the present to saltationally produce a new species from H.sapiens sapiens. The new species of human was incapable of lying to other humans of the new species. What set them apart from their parents is they involuntarily communicated thought and emotion through pheromones and skin color changes. In more poetic language they wore their hearts on their sleeves. Imagine a world where lies can’t be told. Or better yet read what Bear imagined that world would be like… Lest one pooh-pooh this because it’s science fiction one should first read the review of it written by accomplished geneticist Michael Goldman and published in Nature.


158

kairosfocus

03/16/2008

6:54 am

Dave:

I see your:

One hypothesis [BTW -- any specific testable evidence for it?] that I really like is that endogenous retroviruses cause the same mutation to happen in a large number of individuals in the same generation. Individuals in contagious contact are also in breeding contact

Where this gets real interesting for me is, where does this retrovirus get its human-making, functionally specified and highly complex information from?

But also, Lurker X was raising an issue of lowered fertility, compounded through interbreeding.

So, I’d love to hear more on it . . .

GEM of TKI


159

allanius

03/16/2008

7:19 am

All right; so let’s concede (just to be nice–it is Sunday, after all) that the indirect evidence does not absolutely contradict abiogenesis. How then do we get, within a couple of short sentences, to the bold assertion that the evidence supports abiogenesis? There is quite a wide chasm between these two stances. We know that the gap between them cannot be bridged by direct empirical evidence. What could possibly be strong enough to hold them together in the same paragraph? Gosh, this is a tough one. I’ll have to think about it this morning in church.


160

kairosfocus

03/16/2008

7:51 am

Hi Allanius

I too gotta be getting up to go face the day [and will doubtless have occasion to reflect on Rom 1:1 9 – 20] — actually I had to go off to the local puddle-jumper-only airport already to see someone off. (It was interesting to sit by the a/p cafe, and hear Santo Domingo Spanish all around me, in a nominally anglophone territory!)

I note your:

. . . let’s concede (just to be nice–it is Sunday, after all) that the indirect evidence does not absolutely contradict abiogenesis

Similarly, per Sir Fred Hoyle’s famous remark, the logical and physical evidence does not ABSOLUTELY contradict the idea that a tornado passing through Seattle can assemble a flyable 747 from the various parts in a local junkyard.

Indeed, on the foundation of the 2 LOT, my favourite Russians have this to say, as I report and comment in my Appendix A to the always linked:

Yavorski and Pinski, in the textbook Physics, Vol I [MIR, USSR, 1974, pp. 279 ff.], summarise the key implication of the macro-state and micro-state view well: as we consider a simple model of diffusion, let us think of ten white and ten black balls in two rows in a container. There is of course but one way in which there are ten whites in the top row; the balls of any one colour being for our purposes identical. But on shuffling, there are 63,504 ways to arrange five each of black and white balls in the two rows, and 6-4 distributions may occur in two ways, each with 44,100 alternatives. So, if we for the moment see the set of balls as circulating among the various different possible arrangements at random, and spending about the same time in each possible state on average, the time the system spends in any given state will be proportionate to the relative number of ways that state may be achieved. Immediately, we see that the system will gravitate towards the cluster of more evenly distributed states. In short, we have just seen that there is a natural trend of change at random, towards the more thermodynamically probable macrostates, i.e the ones with higher statistical weights. So “[b]y comparing the [thermodynamic] probabilities of two states of a thermodynamic system, we can establish at once the direction of the process that is [spontaneously] feasible in the given system. It will correspond to a transition from a less probable to a more probable state.” [p. 284.] This is in effect the statistical form of the 2nd law of thermodynamics. Thus, too, the behaviour of the Clausius isolated system above is readily understood: importing d’Q of random molecular energy so far increases the number of ways energy can be distributed at micro-scale in B, that the resulting rise in B’s entropy swamps the fall in A’s entropy. Moreover, given that FSCI-rich micro-arrangements are relatively rare in the set of possible arrangements, we can also see why it is hard to account for the origin of such states by spontaneous processes in the scope of the observable universe.

In short, there are two senses of exclusion: something may be outright logically absurd or physiucally impossible relative to our observed cosmos. But also, we may see something that as far as bare possibility is concerned, is not forbidden, but is so utterly improbable that it — reliably — will not be observed to occur.

In the case of things that exhibit functionally specified, complex information beyond the Dembski-type universal probability bound, we see complexity [i.e low inherent probability, or high contingency/ large information storage capacity] and tight functional specification of the observed configuration which combine to make intelligent agency a better explanation than chance + necessity only. For, whenever we directly know the origin of an item that exhibits FSCI, it is the product of an agent. [E.g. the long enough posts in this thread are the product of agents not lucky noise.]

So spontaneous origin of life by chem evo etc does not meet absolute logical or physical roadblocks, but is so utterly complex and specified that it falls into a class of entities that we know through experience and observation are the routine product of agents. But, that is plainly cutting across some “preferred” – i.e materialist — scenarios on origins so it is being resisted by power holders in a lot of relevant institutions.

GEM of TKI


161

Joseph

03/16/2008

8:01 am

Allen,

Science has demonstrated that only life begets life.

So where does that leave non-telic abiogenesis?

Bob O’H:
I can tell you how machines come into existence. It’s called reproduction.

Production is also how machines come into existence.

As for reproduction, if you want to use that then you have to demonstrate how it came into exitence.

Bob O’H:
More seriously, I think you’ve made my point - we don’t know of any intelligence that is capable of designing something as complex as a vole.

We don’t know of ANY mechanism capable of creating a vole.

So we go with what we do know- that is every time we observe complex specified information and know the cause it is ALWAYS via some agency- always. And until someone can come along and demonstrate that CSI can arise without an agency it is safe to infer all CSI requires agency involvement at some level.


162

Joseph

03/16/2008

8:07 am

I grow tired of saying this, so this will be the last time: verification (or lack thereof) of any of the current hypotheses about the origin of life have literally no bearing on the overwhelming majority of the topics subsumed under the term “evolutionary biology”, including the “origin of species” and the evolution of humans.-Allen MacNeill

That’s false. Again if living organisms were designed then most likely their subsequent evolution was part of the design.

If humans, or any organism, was a target- an intended outcome- then the current ToE would require a major overhaul.

Darwin didn’t write about the OOL of life at all (for good reasons); who am I to gainsay him?–Allen MacNeill

Darwin didn’t know any better. You should.

I would go even further to say had Darwin known what was in that black box called a living organism he would not have written “On the Origins of Species….” or it would have been a pro-ID book if he had.


163

Jack Krebs

03/16/2008

8:49 am

Kairofocus writes,

Above, you made a serious accusatory statement regarding those on the other side of a curriculum dispute in Kansas.

I responded, at what is now 124, challenging you to substantiate your claims in light of certain considerations on the objective definition of science and related observations on rhetorical and regulatory tactics.

You have further interacted at 150, and I see that there is silence on a situation where you have asserted serious accusations; accusations that cannot just be left to stand on one’s say-so.

That silence, sir, if deliberate, is telling — and not in your favour.

In unrealistic of you to be drawing inferences based on lack of response - people are often busy (I was yesterday), and the fact that I threw in a little cheerleading post doesn’t mean that I had time to respond to your lengthy post earlier. So I suggest you lighten up a bit.

I also am not quite sure what “serious accusatory statement” I made “regarding those on the other side of a curriculum dispute in Kansas.” The part of my post that you quoted was

[JK, 117:] I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . .

Where is the “serious accusatory statement” here? Everyone of the points in that quote is a factual statement (except for the word “good”, which is my and many others judgment about the standards.) I know I disagree with what the minority did, but disagreement isn’t accusation.

Now the substantive topic that you want to discuss is the description of the nature of science issue in the Kansas standards, and I do intend to respond to that, as it is an important topic. So just stay cool and I’ll try to get something written today.


164

Bob O'H

03/16/2008

9:26 am

So we go with what we do know- that is every time we observe complex specified information and know the cause it is ALWAYS via some agency- always.

Can you show me the calculation of CSI in the vole, please? Just the reference will do.


165

jerry

03/16/2008

9:41 am

The OOL life issue has been traditionally not part of the evolution debate from the start. One can decry this but it is a fact that those who were involved in the debate did not discuss OOL.

Pasteur’s study which eliminated spontaneous generation as a cause of life’s origin happened after Darwin published the “Origin” when his work was publicized in 1864. The cell as the basic structure for life itself was only discovered about 20-30 years before the “Origin” and it took till the 1880’s to discover mitosis or almost 30 years after the “Origin.” During this time the evolution debate was in high gear without any consideration of the cell.

Even in the 20th century the complexity of the cell was not fully understood and the ubiquitous term, protoplasm, was used to describe the contents of the cell. By this time the modern synthesis was formed and genetics well established but no understanding of DNA was known.

Now you can argue from retrospect that the debate on evolution should include biogenesis but traditionally the evolution debate had no need for it. When the debate moved into the micro-biology era maybe OOl issues should have been considered but the evolutionary biologists were more interested in a system that explained the evolution of life not the creation of life so it never became an issue for them.

So we here can take pop shots at the current dichotomy but the evolutionary biologist can claim they are quite different issues and that people in the two fields really study different processes. And for the most part I agree. What I have read in both areas, there is usually little in common in what they study or the type of research they do.

A lot of ID looks mainly at the issue of the creation of DNA as well as evolutionary biology issues. Evolutionary biology looks only at the expansion or reorganization of the DNA. ID looks at both issues. I consider most of Dembski’s work at one end of the life debate, namely its creation. Behe’s work is at the other end or the naturalistic changes of DNA once it is there examining the effect of point mutations or more complicated mutations and do they really exist.

So even if we do not agree with the distinction between the two areas, we should understand why they exist. It is not a conspiracy.


166

DaveScot

03/16/2008

11:37 am

Bob

Can you show me the calculation of CSI in the vole, please? Just the reference will do.

The whole vole is intractibly complex and it’s unneccessary to consider the whole animal. We can take just one tiny bit of the vole and analyze the CSI of that bit. How about we use the vole’s ATP synthase as the bit to analyze? As a bonus we get to apply the same analysis to every other living thing on the planet.


167

DLH

03/16/2008

11:53 am

DaveScott at 157 & Allen et al.

even some gene sequences that were thought to have been very important in selection (due to having been “conserved” over deep evolutionary time) are apparently insiginificant or even useless. We know this because knocking them out of the genome has no discernible effect on the survival or reproduction of the “knock-out” progeny.

This sounds suspiciously alike evidence for large scale robust design that can tolerate major damage and still function. e.g. by redundant or duplicate or parallel pathways.

See Peter Borger Genetic Redundancy: The Ultimate Evidence of the Design of Life

Over the past two decades scientists have observed the peculiar biological phenomenon of genetic redundancy, which pertains to genes or genetic systems that seem to have no obvious function. Indeed, genetic redundancy is now defined as the situation in which the disruption of a gene is selective neutral. Genetic redundancy is the resultant of cooperating scale free genetic networks that provide robustness to organisms. One of the biggest surprises of modern biology genetic redundancy terminates Darwin’s era of natural selection.


168

Jack Krebs

03/16/2008

11:54 am

That seems reasonable. Can you show the calculation of the CSI in the vole’s ATP synthase?


169

DaveScot

03/16/2008

12:03 pm

Jack

One of the other authors here (DLH?) who’s a fan of ATP synthase as an icon of intelligent design can insert himself here.

Allen

I feel your weariness over saying that OOL has no bearing on evolutionary biology. I’m just as weary in pointing out that if your assertion is true then evolutionary biology should have no objection to a very complex beginning wherein all the diversity of life today existed as unexpressed genomic information in one or several common ancestors hundreds of millions or billions of years ago.

Either say evolutionary biology has no problem with an uber-complex genome as the starting point for descent with modification or admit that OOL does indeed figure prominently into evolutionary biology. Actions speak louder than words, Allen. The mere mention of descent with modification beginning with complex intelligently designed forms invariably brings on shouts of protest from evolutionary biologists. Prove to me first that you’re an exception to the rule then most importantly prove to me that it isn’t a rule at all.


170

Bob O'H

03/16/2008

12:10 pm

Jack, you took the words right out of my keyboard!

Joseph and Dave - let’s see your calculations!


171

DaveScot

03/16/2008

12:31 pm

Bob & Jack,

let’s see your calculations!

Very well.

ATP synthase:

Complexity > 500 bits

(I couldn’t quickly find the number of amino acids in ATP synthase but hope you’ll agree it’s greater than 100 residues at 5 bits per residue)

Specification = storage of energy for use by other sub-cellular machines

It should be mentioned that this needs to run through the explanatory filter which adds the requirement that no known physical laws make the CSI in the ATP synthase machine much more probable than any other similarly complex pattern of residues.


172

Jack Krebs

03/16/2008

12:46 pm

But this assumes that all parts of the ATP synthase came together simultaneously and by pure chance, which is an unverified assumption and is certainly not a hypothesis made by any one studying this topic.


173

DaveScot

03/16/2008

12:53 pm

Jack

You asked me to calculate the CSI of ATP synthase. I did that. It’s my turn now to ask you for a calculation. Show me a plausible and likely path for law and chance to assemble an ATP synthase molecule. The ball is now in your court. Failing that we can then analyze the CSI of a lead acid battery and show that intelligent agency is a mechanism which can produce similarly complex means of energy storage. Or you can just concede the point right away and save us both the effort of belaboring the obvious.


174

DaveScot

03/16/2008

1:17 pm

The crux of the matter here is that intelligent design proponents can point to a mechanism (intelligent agency) which can demonstrably create specified complexity but we can’t point to a known instance of such agency in the prehistoric past. On the other hand chance & neccessity proponents can point to a mechanism which did exist in the distant past (mutation & selection) but can’t demonstrate it has the capacity to produce specified complexity. It would seem we’re at a stalemate for the time being. If your side would admit the stalemate and give intelligent design a fair hearing alongside chance & neccessity I’d have no further objections. Let the ideas speak for themselves. Of course that’s not acceptable because you very rightly fear that your explanation has little credibility compared to ours.


175

Bob O'H

03/16/2008

1:19 pm

Dave, I don’t understand your calculation. First, where does the 500 bits come from? And secondly, how does the specification fit in?


176

DaveScot

03/16/2008

2:06 pm

The 500 bits comes from 5 bits per amino acid in the molecule. There are 20 possible amino acids. 5 bits is the smallest possible container size that can specify one of twenty possibilities. If you don’t understand that I suggest you brush up on binary arithmetic.

The specification fits in where one possible arrangement of 500 bits of information can be independently described. If you don’t understand that we need to talk about Granville’s example in statistical mechanics. Take all the possible arrangements of matter that can be made out of that which comprises a space shuttle. The vast majority of such arrangements won’t meet the specification of being able to carry passengers to earth orbit and return them safely. That specification is for all practical purposes statistically impossible for law and chance alone to assemble from the vast number of other arrangements of matter which don’t meet the specification.

If you can’t describe how law and chance can assemble an ATP synthase molecule from the 10^150 (or more) other possible arrangements of 100 (or more) amino acids then we have a problem in that statistical mechanics says it’s practically impossible for this to happen by law and chance alone.

The ball is in your court. I’m quite willing to hear you describe how law and chance work together to make the composition of ATP synthase much more probable than any other possibility.

Of course that’s far less than just the tip of the iceberg in the vole, Bob. The next problem is paradoxical. Which came first, the cellular machinery that relies on ATP to function or the machine that makes ATP for them? Modern knowledge of the nanometer scale complexity in living cells has really brought intelligent design into focus. Story telling about how the camera eye might have formed by gradual improvements is easy compared to explaining how the carbon based nanotechnology in the simplest living cell formed out of inanimate chemicals.


177

ericB

03/16/2008

2:24 pm

bFast (140):

“This is the core of ReMine’s claim that there has been far too much mutational change between humans and chimps to be accounted for by the theory. He has the support of the famous evolutionist Haldane. To make matters worse, he works on a calculation of 1% difference between human and chimp. The latest estimate is more like 5%. I think he has a convincing argument.”

It seems that matters would be even worse than worse, if we consider two other qualifications that don’t even show up in the X% figure.

1) The traditional X% figure only considered differences in protein coding sequences in DNA, not the rest of DNA, which now is known to be able to influence interpretation.

2) Even in regard to coding DNA, the traditional X% figure ignores sections where chimps and humans have nothing in common. It only measures differences in shared coding regions.

More here: re: Speaking of Comparisons, Two Common Huge Oversimplifications

Now I wonder if evolutionists who complain that IDers don’t do more research would support giving science grants to fund research by those who would investigate the limits of evolutionary change? (Not holding my breath. ;-)


178

irreducible_complacency

03/16/2008

2:30 pm

Dave do you think that it is possible to systematically use taxonomic characters in calculation of CSI? If species are related to each others like the evolutionists say then surely it is possible to use comparisons between things like voles and analyze them in terms of how much information is shared and how much is different between these supposedly related species of voles.

If instead we look at DNA as a program, the question of whether or not it had a designer has no bearing on our view of how it functions and is expressed. It seems that one could compare these things across taxa without even making the evolutionary assumptions. this means not drawing the trees that darwinists always point at and say see this proves you are just an animal, but the hard math is the same. Just no hidden metaphysical assumptions. Wouldn’t this standardize our observations of CSI added or subtracted between species?


179

ericB

03/16/2008

2:41 pm

Re: “where does 500 bits come from?”

One small point. Some may not know the connection between “500 bits” and “10^150″.

There are 2^500 different possibilities with 500 bits. If you use Google’s handy calculator feature by typing in 2^500 in the search box and pressing return, you will see that 2^500 equals 3.27339061 × 10^150.

So they are two different ways of expressing essentially the same number and the same probability bound. One in 2^500 is about one in 10^150.


180

Bob O'H

03/16/2008

2:49 pm

The 500 bits comes from 5 bits per amino acid in the molecule. There are 20 possible amino acids. 5 bits is the smallest possible container size that can specify one of twenty possibilities. If you don’t understand that I suggest you brush up on binary arithmetic.

You still haven’t explained where it comes from. Is it the probability that a random sequence of 100 amino acids would have one particular sequence? i.e. 20^-100? If so, I’d like to see your response to Jack’s point.

The specification fits in where one possible arrangement of 500 bits of information can be independently described. If you don’t understand that we need to talk about Granville’s example in statistical mechanics. Take all the possible arrangements of matter that can be made out of that which comprises a space shuttle. The vast majority of such arrangements won’t meet the specification of being able to carry passengers to earth orbit and return them safely. That specification is for all practical purposes statistically impossible for law and chance alone to assemble from the vast number of other arrangements of matter which don’t meet the specification.

Your specification was of the form “it does something”. It said nothing about the range of possible amino acid sequences that could accomplish this task.


181

sparc

03/16/2008

2:59 pm

Just a few questions: How would a designer design the DNA encoding ATP Synthase? Two separate strands that he later annealed? Would he synthesize a single strand 5′–>3′ or 3′–>5′? Would he put in introns early or late? And what about codon usage?


182

Patrick

03/16/2008

4:53 pm

Dave,

Either say evolutionary biology has no problem with an uber-complex genome as the starting point for descent with modification or admit that OOL does indeed figure prominently into evolutionary biology. Actions speak louder than words, Allen. The mere mention of descent with modification beginning with complex intelligently designed forms invariably brings on shouts of protest from evolutionary biologists. Prove to me first that you’re an exception to the rule then most importantly prove to me that it isn’t a rule at all.

Allen “sort of” answered that question back in these 2 comments:

My suggested “middle ground”.

The response

Essentially it sounds like he wants a long-term ID research program established before he’d consider accepting it.


183

DLH

03/16/2008

7:08 pm

DaveScott at 177
A refinement on the calculations is incorporate the “degeneracy” (or “redundancy”)* or duplications in the DNA coding resulting from 20 amino acids out of a 4^3 or 64 bit coding space. This amounts to about 4.139 bits per codon rather than 6 bits. However, we then have overlapping DNA coding as Yockey calculates:

As I have shown in Table 6.3, sites that have functionally equivalent amino acids have information content lower than 4.139 bits.

Hubert P. Yockey (2005 p 92) Information Theory, Evolution, and the Origin of Life, ISBN 978-0-521-80293-2.

Let’s use 4.139 bits/codon for such ballpark estimates.

* PS. Yockey (2005, Sect 5.2 p 42) vehemently insists on describing the genetic code as “redundant” rather than “degenerate”. I am unpersuaded and believe “degenerate” better describes reality.


184

ericB

03/16/2008

8:40 pm

Five observations about Allen_MacNeill’s OOL response.

1) Allen defeated his own argument about OOL when he clarified the meaning of the main premise.

2) The rosy picture Allen painted of the state of OOL research does not correspond to reality.

3) Allen failed to really engage the issue that he was ignoring empirical evidence against abiogenesis (thereby violating the spirit of Huxley’s principle).

4) Instead, Allen reemphasized points that were not in dispute.

5) Nevertheless, among evolutionary biologists who engage in dialog, Allen is exemplary as a scholar and gentleman.

My overall observation is that, under the influence of the materialism’s blinders, the possibility that undirected material processes may be insufficient tends to not even enter into consideration. It is not rejected so much as invisible.

For the details on each observation, please see the post Observations on Materialism’s Ideological Blinders Impeding Science.

p.s. Does anyone have any good links to information on the metaphysical basis that supported the expectation that alchemy was true? Thanks in advance.


185

bFast

03/16/2008

9:16 pm

Bob O’H (153):

More seriously, I think you’ve made my point - we don’t know of any intelligence that is capable of designing something as complex as a vole. Unless one wants to claim knowledge of one of the many revealed religions.

It is true that we don’t know of any intelligence that is capable of designing something as complex as a vole. It is true that we don’t know of any intelligence capable of designing something as complex as any living organism. We certainly don’t know of any intelligence capable of designing something as complex as the highly tuned big bang event.

Our inference of design in all of these instances is an extrapolation from what we know. The “fact” of a naturally occurring OOL is also an extrapolation. The fact that bacterial flagellum evolved via NFV+NS is also an extrapolation. As speciation has never been truly observed, even speciation is an extrapolation.

I suggest that ID’s inference in this matter is much less of an extrapolation than materialism’s.


186

kairosfocus

03/17/2008

5:16 am

Participants:

First, I see that Mr Krebs, sadly has shown us all [164 – and note how he leaves off reference numbers so it becomes hard for typical readers to check him . . .] that he, on the evidence of what he did overnight, has a challenge in reading text accurately and fairly, and in responding to issues on the full balance of the merits:

GEM, 156: Mr Krebs: Above [i.e. 117], you made a serious accusatory statement regarding those on the other side of a curriculum dispute in Kansas.

I responded, at what is now 124 [cf 123 – 4], challenging you to substantiate your claims in light of certain considerations on the objective definition of science and related observations on rhetorical and regulatory tactics.
You have further interacted at 150, and I see that there is silence on a situation where you have asserted serious accusations; accusations that cannot just be left to stand on one’s say-so.

That silence, sir, if deliberate, is telling — and not in your favour.
So, I think you need to respond, and respond cogently on the substance.

JK, 164: In unrealistic of you to be drawing inferences based on lack of response - people are often busy (I was yesterday) . . . . I also am not quite sure what “serious accusatory statement” I made “regarding those on the other side of a curriculum dispute in Kansas.”

Of course, in excerpting his own remarks at 117, he then proceeded to a telling ellipsis that makes it appear that I am making up a strawman to attack:

I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . . [LEFT OUT, the immediately following words: by a Board who ignored the very processes for writing curriculum that they had established . . . ]

So, sir, there is an answer to your: Where is the “serious accusatory statement” here? YOU LEFT IT OUT THROUGH USING A MATERIALLY MISLEADING ELLIPSIS. That tells us a lot about how you reason and argue, and — sadly — none of it good. But, let us trust that in your onward response, we will see a better, more fairly put case. (Sigh . . .)

It is worth pausing to point out that in fact, between about 1999 and 2007, there has been a considerable back-forth in Kansas, in which the side Mr Krebs represents – what we may appropriately term, “the party of Darwin”cf. Jerry at 116] — has inserted an unfortunately question-begging, ideologically loaded, historically, logically, educationally and philosophically unjustifiable, indoctrination agenda-serving materialist [re-]“definition” of science. The other side, which he and others of his ilk have vilified, has tried to stand up for a more objective definition and approach, which I noted on at 123 - 4 above. I of course also paused to take time to follow up the other side of the claim, and met with the following FAQs cited at 124 above, in addressing the procedure violation issue he claims – and BTW, to go with a well-justified minority report, ever since the days of the 12 spies in Canaan, has often been wise [though, typically not popular, of course] :

In particular, given the objection on violation of procedure in 117, I note the balancing FAQs:

Q: What is the scientific basis for the changes?

A: Most of the changes reflect common sense and all have a solid scientific basis. They were crafted by eight members of the Writing Committee (the Authors), three of which hold doctoral degrees in the life sciences (biochemistry, entomology and medicine). They were then scientifically and educationally validated by 23 experts during 3 days of hearings in May, 2005 by 5 PhD biologists/ molecular biologists, 4 PhD biochemists, 3 PhD Chemists (2 with expertise in theories of chemical evolution - origin of life), 1 PhD Geneticist (the inventor of the Gene Gun), 1 PhD Quantum Physicist, 3 Philosophers of Science (two with PhD’s), 1 PhD Professor of Education, 3 biology teachers, a Muslim journalist and an attorney.

Q: Why do we get conflicting reports about the changes to the standards?

A: Organizations that oppose the changes are unwilling to publicly debate evolution because they falsely claim it is not scientifically controversial. To avoid a discussion of the real controversy they unfairly demean those who seek it. See http://www.KansasScience2005.com for an explanation of the strategy of the media and public relations officer of Kansas Citizens for Science: our “strategy” is to “portray” those who seek an objective discussion of evolution “in the harshest light possible, as political opportunists, evangelical activists, ignoramuses, breakers of rules, un-principled bullies, etc.” The boycott of hearings that discussed key issues of science and education is an example of this strategy - to demean rather than to discuss.

So, it seems to me that, on the evidence of what the party of Darwin has done, my own call to Mr Krebs at 123 above is well-warranted: I therefore call upon you to help undo the harm you and your ilk have done.

Now, too, I took some time to look back on the thread, and see a crucial and very general point by Dr MacNeill, at 99, which leads to a key chain of reasoning:

1] Dr MacNeill:

I believe that artificial genomes, generated by genetic engineering by human genetic engineers are, indeed, intelligently designed.

Now, show me how you have determined the same thing for, say, Microtus pennsylvanicus, using empirical methods. Then I will freely admit that Microtus pennsylvanicus is intelligently designed.

2] To this, RRE at 112 first responded:

Thank you for admitting genomes can be generated by genetic engineers (whether artificial or not does not even matter) — which are intelligent designers who have successfully added concept onto matter to make a machine work, in this case, a cell by manipulating its code. This genetic code coupled with the mitochondrial DNA code is the complete set of instructions for all the cell lines of the species and is especially important when placed inside of the female reproductive cell . . .

–> In short, Dr MacNeill acknowledges, appropriately, that it is empirically well-supported that intelligent agents can make genes and insert them into living organisms.

–> Further to this, it entails that he accepts that complex codes are in at least some cases an empirical sign of such agents at work.

–> Now, can he identify a case within our observation that shows that such codes [beyond 500 – 1,000 bits of information] can be made by non-intelligent forces, i.e . by chance + necessity?

–> We know as a commonplace that intelligent agents are capable of developing such FSCI, and even that we are able to make more and more complex systems which if arrayed in a temporal line will show an apparent evolutionary development but one by design [cf here Berra's infamous blunder on the Corvette's evolution]

[ . . . ]


187

kairosfocus

03/17/2008

5:17 am

3] RRE then went on to a mostly-correct point (sadly, somewhat spoiled by failing to accurately refer to the cited species as a vole; which was rhetorically exploited in a way that unfortunately distracted from what he got right, crucially right):

–> I therefore adapt his remarks slightly:

. . . Microtus pennsylvanicus is [a complex bio-system based on the cell, i.e. on] a MICROSCOPIC MACHINE with an even smaller genetic CODE or INSTRUCTION SET to BUILD proteins [its key parts] from scratch.
The bacterium [cell, thus also the animal built up from cells organised in tissues, organs and body plans,] fits the standard definition of a machine [AmHD: “A device consisting of fixed and moving parts that modifies mechanical energy and transmits it in a more useful form”]; you can look it up yourself. All machines when studying [for which we directly know] their origin were intelligently designed. So [from repeated and so-far exception-less empirical observation, we reliably know] it takes intelligent causes to produce them . . . .
Show me any machine or code [M-WD: “a system of signals or symbols for communication”] that can be produced without intelligence. You cannot do it [or you would have dome so already]. Only human intelligent designers [have been observed to] make machines and codes, with the very real exception being biological organisms, which are more complex machines with a more complex code than we can make today with our own intelligent designing skills. So the finger goes back to you—YOU must empirically demonstrate a [functioning, complex] code or machine that has been caused into existence without using intelligent causes– purely naturalistic mechanisms as you say. Since you are excluding intelligent causes from your origins hypothesis a priori, as well the scientific realm when it comes to machines and codes, then YOU must provide and demonstrate empirically, a CODE and a MACHINE from some OTHER MECHANISM.

–> In short, the onus of demonstration, once — through the discovery of DNA and the nanotechnology of proteins, ribosomes, enzynmes etc that give effect tot he information so encoded — the bridge has been opened from the molecular scale biology of the cell to issues of the design and functioning of complex codes and machines, properly lies on those who have advocated that functionally specified, complex coded information and the machinery that executes such can originate by chance + necessity only.

–> As for Bob O’H at 165: Can you show me the calculation of CSI in the vole, please? Just the reference will do.

Actually, we need not calculate specifically for the vole, nor do we need to go to a journal article to find the calculation; it is within reach of a 6th former who knows how to do log calculations on a scientific calculator. For, we long since know that the minimal bio-functional genome of 300 – 500 k base pairs, has complexity of 150 k bits up, or a config space in excess of 4^300k ~ 9.94 *10^180,617. If there are for the sake of argument 10^1000 relevant islands of functionality in the genome space, say of size 10^150 each, the non-functional space would be well in excess of 10^180,000 cells. That is, just to get to minimal life, we are already well into complexity of an order that makes the islands of functionality so isolated that a random walk starting from an arbitrary initial point is maximally unlikely to find any functional forms. And, since a vole as a complex animal probably has a genome of order 100’s millions to billions of base pairs, what holds for the minimal cell holds a fortiori for the vole. Indeed, the point of Meyer’s justifiably famous PBSW article was in material part, that there is a serious leap in CSI to achieve the dozens of new phyla and subphyla in the Cambrian revolution, and that for instance to get to a modern arthropod you are looking at 180 mn base prs, up from the mere millions in typical unicellular organisms. Just 500 – 1,000 bits of information storage puts us into the range where chance + necessity find themselves running out of probabilistic resources to create functionally specified, complex information bearing structures.

–> to date, the burden to show that such FASCI can originate by chance + necessity only has not been clearly met by the evo mat advocates, and instead we see turnabout burden of proof-shifting tactics as just rebutted, or the cordoning off of the potentially decisive OOL issue as if it were not germane to the question, or — far worse – rhetorical, indoctrination [as opposed to education] and political spin tactics like trying to redefine science in such a way that the known cause of complex codes and machines is excluded from the outset.

–> Such tactics do not lend us confidence in the theories that are being defended by using such plainly questionable means.

4] What about the chimp-man issue?

First, both chimps and men are made from cells, so the same issue just raised obtains. Also, there is need to credibly account on chance + necessity only, for how one gets to the complex body plan shared in common to a great extent by humans and chimps, even before we explain the observed differences. Plainly, that has not been done.
Now, we may turn to the issues of genetic links and differences and body-plan differences:

a –> We speak, vocalising ideas in spoken words in sound-based languages; chimps etc. evidently cannot (though of course parrots can verbalise words and in some cases may possibly understand some of what they say). How is this accounted for on the known claimed small percentage DNA differences between us and our “cousins” [was it 1%, 2%, or – per ericB at 178, 5%, and BTW where does that figure come from, and to what phenotypical significance, chromosome by chromosome?]? How has this been accounted for in terms of chance + necessity only, working through random variation and natural selection, beyond ad hoc just-so stories, i.e. on an empirically testable “scientific” basis? I see here ericB’s telling remark:

The traditional X% figure only considered differences in protein coding sequences in DNA, not the rest of DNA, which now is known to be able to influence interpretation . . . . Even in regard to coding DNA, the traditional X% figure ignores sections where chimps and humans have nothing in common. It only measures differences in shared coding regions.

b –> We express ourselves in complex, arbitrary verbal codes that embrace concepts of identity, action, effect, purpose, past, present, future, abstract concepts etc. The various apes etc do not. How is this accounted for on the same terms?

c –> We have fully opposable thumbs, apes etc — as a rule — evidently do not. That seems a simple enough modification, and is plainly highly useful – it is critical to the capability of the human hand. If our populations diverged in similar environments at the same time [and were close enough to hybridise with ancestral chimps], why did we develop such full opposability fairly rapidly, while our ape “cousins” as a whole did not? Conversely, if our ape cousins did not need it to survive and thrive in evidently similar environments, why and how did we develop the fully opposable thumb? [I am here speaking to the issue of mutations, environmentally driven selection and change vs stability of organism architecture.]

d –> In short, I am speaking to two key differences between us and our cousins: (i) the verbalising, conceptualising mind-brain system, and (ii) the hand that gives effect to what is conceived. That is, the issue is: how do we account for these key differences within the allegedly small genomic changes, and the time available and the similarity of environments in which the change vs stasis are claimed to have happened?

e –> Further to this, how do we account for the issues on fertility and reproductive isolation vs hybridising that are associated with this thread, in the context of the key changes noted?
_______________

I think that these five points help put issues over chromosome 2 or the X-chromosome, etc in context.

Namely, when we have an empirically well-supported, coherent, non ad hoc account of macroevolution and its capacity to account for complex codes, machines, body plans, mind-brain systems, language-based speech and the hand, then we will see reason to take its claims more seriously as scientifically well-established.

GEM of TKI


188

Frost122585

03/17/2008

5:23 am

Karios, do you accept common ansestry or no?


189

kairosfocus

03/17/2008

5:25 am

ERRATUM: I forgot to check myself at point 3, 10^178,000 not 10^180,000. Of course, it makes no material difference, as both are utterly beyond 10^150.


190

kairosfocus

03/17/2008

5:58 am

Hi Frosty:

You ask about a matter [common descent] that is irrelevant to the empirical observation of design based on FSCI.

Accordingly, I hold no public brief either way. (And my personal views on scientific models of the projected deep past, especially here on earth, are just that — I only note that they are open to change, and have changed across my lifetime. Currently, I am far more impressed by astrophysical models than by much of what I see going on in the provinces of Biology and Geology. And, even so, I note that scientific explanations and associated theory-embedded fact claims are open to correction and even abandonment. So, I recommend critically aware open-mindedness, as scientist, educator, sci-tech oriented curriculum developer, consultant and under whatever other hats I occasionally wear. That is what gets me annoyed when I see antics by those who shape young minds through dangerously distorted and misleading educational curricula such as those I just sharply critiqued above. [Cf here Rom 1:19 - 22 in its context.])

My interest, as the always linked will show, is that information is a critical constituent of the cosmos as we observe it in the present. When that information rises to the level of FSCI, we have good observational and theoretical grounds for inferring to agency as the decisive cause.

That is IMHBCO, sufficient to decisively undercut evolutionary materialism [which is also logically incoherent via reductio ad absurdum], and once that is done, it is sufficient to address other matters of import.

GEM of TKI


191

kairosfocus

03/17/2008

6:03 am

PS: Sigh: I just looked up IMHBCO, and see that this too has been taken up with “correct.” I mean CONSIDERED. I guess I have to use IMHBCSO or the like.


192

Frost122585

03/17/2008

6:36 am

So basically your on the fence. Thanks for entertaning my question.


193

Joseph

03/17/2008

7:00 am

Bob O’H and Jack,

You don’t need a calculation to falsify ID.

What you two should concentrate on is finding something- anything- that supports your PoV.

IOW demonstrate that ATP synthase can come into existence via non-telic processes.

THAT is what it will take to falsify ID- actual scientific data.

To Leo,

Until universal common descent can be objectively tested it does not belong in a science classroom- to date all the data that supports UCD can also be used to support alternative scenarios.


194

kairosfocus

03/17/2008

7:33 am

Leo:

1] You will first observe, kindly, that I have long since pointed out the underlying material but too often overlooked issue that scientific theories and knowledge claims are inherently provisional.

2] Indeed, above, I linked on how I once taught TEACHERS on the nature of science and science education, including on Lyellian Geology and Darwinian Biology, in that context.

3] I excerpt, FYI:

During the nineteenth century, the two Sir Charleses — Lyell and Darwin — led similarly sweeping revolutions in Geology and Biology, respectively building modern Uniformitarian Geology and [Macro-]Evolutionary Biology. Mendel’s peas and Pavlov’s salivating dogs were foundational for Genetics and Experimental Psychology. Mendeleev’s Periodic Table of the Chemical Elements (1869 – 1871) transformed Chemistry, and John Meynard Keynes’ Aggregate (Macro-) analysis of the 1930’s in his General Theory radically shifted the classical tradition of thought in Economics, which grew from Adam Smith’s 1776 book: The Wealth of Nations. Gauss’ pioneering work on non-Euclidean Geometry — also in the nineteenth century! — forever changed Mathematics, and thus helped provide the analytical tools (such as Riemannian Geometry, Matrix Algebra and Boolean Algebra) needed for modern scientific theories and technologies. And in our computerised era, we look to Charles Babbage’s magnificent failure, the Analytical Engine, as the dawn of the Computer Age.

4] You will further note that I pointed out the field of science which IMHBXO — using chi for “considered” — has the most credible dating estimate on an old cosmos: astrophysics.

5] Also, please observe that I have argued that presently observable evidence, even on the conventional — and not at all properly “consensus” as if that were decisive on truth — is sufficient to show that information that is functionally specific and complex is a key constituent of the universe as we see it. The observation that such FSCI credibly traces to agency is sufficient to highlight that intelligent agency is the best explanation for OOL, body plan level biodiversity and the organised complexity of the cosmos. And that is more than enough for my purposes, scientific, philosophical and educational.

6] Now as to my opinion, perhaps I can beg to remind you that a healthy agnosticism or even skepticism based on specific technical questions on methods and results and assumptions is itself an opinion and a serious option? [This too is my response on say Climate Change. When I wear the sustainability consultant hat, I am a "skyptical environmentalist." That means that on a least regrets basis, I will recommend only actions justifiable on a least regrets basis that is independent of the accuracy or otherwise of the IPCC's projections.]

7] So, Leo, I HAVE given my opinion, and with my reasons in outline. Just, they do not neatly line up with the usual pigeonholes.

8] And, I would advise you to see the specific “antics” I rebuked above at 123 - 4 before making comments as you have.

9] For, science is not properly to be “defined” as in effect applied materialism — that is question begging as a matter of philosophy, is historically demonstrably false and is educationally manipulative. Nor is that manipulative redefintion properly the consensus view of the relevant discipline, philosophy of science.

10] As to the claimed consensus paradigm, evolutionary materialism (and its associated belt of theories and models), I have never advocated not teaching it, but that it should be discussed in a properly balanced historic, philosophical and scientific context, i.e shown warts and all.

11] To do less than that is to violate principles of education, and to slide instead into indoctrination and in some cases — where one is sufficiently educated and responsible to know better or where one should know better — outright deception by suppression of material truth.

__________

As the justly revered Jewish Mother [and I have one as yet another adoptive "mother"!] says: a half-truth is a whole lie.

GEM of TKI


195

Jack Krebs

03/17/2008

8:02 am

Kairsofocus today at post 187 makes a serious accusation about my behavior, writing,

Of course, in excerpting his own remarks at 117, he [Krebs] then proceeded to a telling ellipsis that makes it appear that I am making up a strawman to attack:

“I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . . [LEFT OUT, the immediately following words: by a Board who ignored the very processes for writing curriculum that they had established . . . ]”

So, sir, there is an answer to your: Where is the “serious accusatory statement” here? YOU LEFT IT OUT THROUGH USING A MATERIALLY MISLEADING ELLIPSIS. That tells us a lot about how you reason and argue, and — sadly — none of it good. But, let us trust that in your onward response, we will see a better, more fairly put case. (Sigh . . .)

Now I have been working on a post on the substantive issue of the description of science in the Kansas Science standards, but now I feel I must respond to this accusation because kairosfocus is DEAD WRONG, and if he in fact had read the posts in question he would understand that it was he himself who left out the phrase in question and inserted the ellipsis. I had no idea what “serious accusatory statement” he was accusing me of making because he didn’t quote the part of my post that he felt was a serious accusation! How was I to know that he was referring to a part of post 117 that he didn’t quote. I’m not a mind-reader, and so I assumed that the statement that he was concerned about was in fact contained in the part of my post he quoted.

So now, in the interest of an evidence-based approach to research, I need to take the time to establish what happened. So here we go.

——————
In post 117, I wrote,

I was not “defending Darwin.” I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted by a Board who ignored the very processes for writing curriculum that they had established.

——————
In post 123, kairosfocus wrote,

Mr Krebs:

I must take you up on a claim you made in 117, above. One that is very relevant to the overall context of this blog and which reveals a lot of what has gone wrong with science, science education, the media and public policy:

[JK, 117:] I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . .

Note very well that here he omitted the phrase about the Board and that he inserted the ellipsis.

——————-
In post 164, I wrote,

I also am not quite sure what “serious accusatory statement” I made “regarding those on the other side of a curriculum dispute in Kansas.” The part of my post that you quoted was

[JK, 117:] I was a member of the state science standards committee who wrote good, well-researched standards which summarized the main points of science that are accepted world-wide. I was defending those standards against changes that were inserted by a minority on the committee and that were adopted . . .

Where is the “serious accusatory statement” here? Everyone of the points in that quote is a factual statement (except for the word “good”, which is my and many others judgment about the standards.) I know I disagree with what the minority did, but disagreement isn’t accusation.

Note that I clearly point out that I am quoting his quote of me! - and since he had left out the phrase in question, so did I. I also made it clear that I didn’t know what he was accusing me of. Now we see that the reason I didn’t is because he never included the statement that he was concerned about.

So kairosfocus is quite wrong to say to me that “YOU LEFT IT OUT THROUGH USING A MATERIALLY MISLEADING ELLIPSIS.” He left the phrase out, and he inserted the ellipsis.

It would be nice if kairosfocus acknowledged his error.


196

kairosfocus

03/17/2008

8:18 am

Onlookers:

Note, again the sadly commonly encountered Darwinista [and fellow-traveller] tendency to closed-minded, irrelevancy-laced objectionism; in this case following red herrings away to convenient strawmen soaked in oil of ad hominem, that can be ignited. (Notice the sneering reference to a live instance of just how I have taught TEACHERS on Lyell and Darwin, in response to an accusation that I would suppress such “consensus views” in teaching.)

Meanwhile the main matter of substance [cf 187 - 188 just above] is dodged and dismissed in the hypnotic light of the resulting inferno.

FYI, Leo, first, at a reading rate of 300 wpm [which is marginal for a College-educated person; and can easily be doubled with a basic speed reading course] the comment would take just over 2 minutes to read. That is a lot less time than it took to scoop it out, put it into a word processor, do a word count, then compose several ad hominem laced distracting remarks.

Especially, in a context where you have not addressed a material misrepresentation of another person that you unfortunately committed. Much less, the matters in the main.

Onlookers, instead, let us address the substantial and serious matters above, on the merits.

GEM of TKI


197

DaveScot

03/17/2008

8:20 am

On universal common descent.

Perhaps the most compelling thing in support of universal common descent is called the law of biogenesis. In every observed case (billions of observations) life is only seen coming from other life. When so many observations are made without exception this promotes theory to law as far as science is concerned. With perfect infallibility we can predict that any living thing we see, when its origin can be determined, came from another living thing very much like itself.

This is a double-edged sword for Darwinian evolutionists however. It makes any hypothetical origin of life from a non-living source have to violate what appears to be a law of nature. Also, since all observed instances of life come from something very similar to itself it makes the story of bacteria morphing into men a bit hard to swallow. It’s only the fact that new forms aren’t quite an exact copy of the parent that gives the over arching morphogenesis theory any legs to stand on.

Personally I hold the law of biogenesis as inviolable until such time as there’s overwhelming evidence to the contrary. For that reason (among others) I believe the best explanation for the origin of life on earth is that it originated from another living thing not of the earth and moreover it was placed here purposefully. This is called “directed panspermia” and was perhaps most famously described and supported by the Nobel prize winning discoverer of DNA - Francis Crick.


198

Jack Krebs

03/17/2008

8:32 am

===============
P.S. to the above post.

Let me emphasize that in 164 I asked, after quoting his quote of me, “Where is the “serious accusatory statement” here?” If kairosfocus would have noticed and responded to that question, he could have avoided the error he made in 187 of accusing me as he did.


199

Jack Krebs

03/17/2008

8:34 am

Oops - intervening post problem: I mean P.S. to post 198:

Let me emphasize that in 164 I asked, after quoting his quote of me, “Where is the “serious accusatory statement” here?” If kairosfocus would have noticed and responded to that question, he could have avoided the error he made in 187 of accusing me as he did.


200

kairosfocus

03/17/2008

8:45 am

Mr Krebs:

I will note on points, on your remarks at 198:

1–> Notice, I gave the thread-number of your original remarks, and also stated in summary that you had accused the Kansas Science education Board circa 2005 of procedural violation, in 123 – 4. Note this from 124, repeated in 187 just before excerpting again the FAQ : In particular, given the objection on violation of procedure in 117, I note the balancing FAQs . . . [FAQs cited] . That is, had you been concerned to see what I was objecting to, there was more than enough evidence to show just what I found to be a serious accusation. [One that by virtue of your diversion to red herrings, strawmen and ad hominems as just seen, seems to be very likely without proper justification on the merits. Of course, Mr Krebs, you may take time and show [a] why the Board circa 2005 violated procedure in a materially significant way, and [b] how that made their work on identifying what science is like and how students should be taught about it, in dangerous error warranting [c] the public castigation they suffered at your hands and that of your ilk, which was then [d] spread to the world through the mass media. Failing that, I will have reason to conclude that you and others of your ilk willfully neglected a serious duty of care. So, sir, please make your case.]

2 –> So, the claim that you didn’t understand that I was spaking of how you accused the Board circa 2005 of being “. . . a Board who ignored the very processes for writing curriculum that they had established . . .” than that is hardly my fault.

3 –> In short, now you are materially misrepresenting me, the better to set up and ignite a strawman laced with oil of ad hominem. That is, onlookers, this its the same rhetorical challenge of objecitonism that I remarked on, only a few moments ago for Leo.

4 –> Onlookers, observe as well how Mr Krebs has taken a lot of time to misrepresent me and what I have had to say, all the while utterly failing to even initially address or just link on the substantial issue of an unwarranted, ideologically loaded re-definition of science as in effect applied materialism, taught to students in Kansas as if it were the unchallengeable truth.

___________

What does this tell us about what is really going on with science education in Kansas and elsewhere?

GEM of TKI


201

kairosfocus

03/17/2008

9:00 am

Dave:

Serious points.

Life only from life. And functionally specified, complex information only from intelligent agency. [Per observations and the issue of finding islands of functionality in vast config spaces.]

Directed (presumably front-loaded) panspermia is indeed an option; albeit a bit sci fi-ish for some (but that would nmean that the space-folding problem has been solved so long distance rapid space travel is possible . . .). I’d love to visit a few star systems before I pass on . . .

BTW: Could you give a cite on how Crick advocated DIRECTED, not just simple panspermia?

On common descent, one issue is that much of it can be accounted for on common design, too; cf Berra’s blunder. [And design is not necessarily optimal design as we would do it . . . design optimisation is relative to the purposes of hte designer, and what seems bad work to one is sound relative to the situations and constraints to another . . . the general theory of second best, . . . ]

GEM of TKI


202

kairosfocus

03/17/2008

9:11 am

Leo:

Please look at my corrections to Mr Krebs’ remarks, at 203.

You will see that there was adequate information in 123 - 4 for him to see exactly what I was speaking of; were he seriously concerned to be accurate. That is, he has constructed a strawman, which he soaked in ad hominem oil and ignited. One may do that through careless thinking, but it also can be a deliberate tactic when one does not have a good case in the main on the merits. [Kindly cf 187 - 8 where I address the issues in the main in this thread as I see them; and my always linked where I give my general discussion.]

So, please, don’t get caught up in the trap — or rhetorical game — of distractions, misrepresentations and ad hominems while dodging the issue in the main. (Also, I have already taken time to correct your own particular remarks that, unfortunately, fall into that trap.)

Now, can we return to dealing with the issues in the main?

GEM of TKI


203

kairosfocus

03/17/2008

9:16 am

PS: I am not taking any position on either the age of the earth or common descent as such. I am taking a position on the difficulties faced by such models, and on the issues faced by giving the impression that the dominant school in any given discipline of science at any time — especially on matters of a distant unobserved past — is in effect “Truth” or a near approximation thereto.


204

Jack Krebs

03/17/2008

9:25 am

Thanks to Leo for supporting my point on the omitted phrase and insertion of the ellipsis. And I’ve probably gotten all the response I’m going to get from kairosfocus on the issue.

Now, however, kf says,

Onlookers, observe as well how Mr Krebs has taken a lot of time to misrepresent me and what I have had to say, all the while utterly failing to even initially address or just link on the substantial issue of an unwarranted, ideologically loaded re-definition of science as in effect applied materialism, taught to students in Kansas as if it were the unchallengeable truth.

Let me note that I have said several times that I am working on a post about the description of science in the Kansas science standards. In fact, that was my morning project today until the business about the missing phrase came along, which I felt I needed to respond to. And now, because of the accusation kairosfocus has made, I want to respond to and support my claim that the state Board “ignored the very processes for writing curriculum that they had established,” further delaying my post on the description of science.

So hang in there, kf, and I’ll get around to the description of science.


205

kairosfocus

03/17/2008

10:18 am

Mr Krebs:

I see further pummelling of a strawman, a misrepresentation I have already long since corrected at 203.

FYFI, Mr Krebs, this, from is my response at 203, on the matter of the ellipsis in 123 - 4 in response to 117:

I will note on points, on your remarks at 198:

1–> Notice, I gave the thread-number of your original remarks [i.e. 117], and also stated in summary that you had accused the Kansas Science education Board circa 2005 of procedural violation, in 123 – 4. Note this from 124, repeated in 187 just before excerpting again the FAQ : In particular, given the objection on violation of procedure in 117, I note the balancing FAQs . . . [FAQs cited] . That is, had you been concerned to see what I was objecting to, there was more than enough evidence to show just what I found to be a serious accusation. [One that by virtue of your diversion to red herrings, strawmen and ad hominems as just seen, seems to be very likely without proper justification on the merits. Of course, Mr Krebs, you may take time and show [a] why the Board circa 2005 violated procedure in a materially significant way, and [b] how that made their work on identifying what science is like and how students should be taught about it, in dangerous error warranting [c] the public castigation they suffered at your hands and that of your ilk, which was then [d] spread to the world through the mass media. Failing that, I will have reason to conclude that you and others of your ilk willfully neglected a serious duty of care. So, sir, please make your case.]

2 –> So, the claim that you didn’t understand that I was spaking of how you accused the Board circa 2005 of being “. . . a Board who ignored the very processes for writing curriculum that they had established . . .” then that is hardly my fault.

Observe, had you simply been concerned to see what I actually said in 123 - 4, instead of scooping an excerpt out of its proper context, to turn it into a strawman, you would not have made the mistake.

I have now pointed your mistaken attack on a strawman of your own making [the claimed misleading ellipsis on my part] out and corrected it, and you insist on being wrong but strong.

Sorry, but on that evidence, you are now being closed mindedly insistent on a material misrepresentation, compounded by labelling me as making “accusations” in a classic turnabout rhetorical tactic. No Mr Krebs, I simply correctly described and cited what YOU did, in 117, calling on you to address the matter properly. It is you who have an “accusation” to back up with cogent facts.

And, all the while the long since asked for response on the actual merits of your redefinition of “science” languishes, unaddressed — even while a lot of time is taken up on an atmosphere-poisoning side issue off a secondary, distracting point.

Onlookers

What does that tell us about what is likely to have happened in Kansas; circa 2005 - 7? [Notice the major complaint cited by JK in 117 is on a claimed procedural violation, not on the substantial issue: was the materialism-laced redefinition put forward by his side of the dispute and which now obtains for Kansas circa Feb 2007, well-warranted?]

Let us wait and see if there will be an actual response on the merits of this secondary but important issue.

Not to mention, the general response on the issue in the main for the thread, for instance as I summarised in 187 - 8.

GEM of TKI


206

kairosfocus

03/17/2008

10:20 am

Leo:

FYI, many ID thinkers hold to common descent with front loading or something like that.

GEM of TKI


207

Jack Krebs

03/17/2008

11:39 am

After some confusion about what he was concerned about, I now understand that kairosfocus feels I have made a serious accusation when I wrote

I was defending those standards against changes that were inserted by a minority on the committee and that were adopted by a Board who ignored the very processes for writing curriculum that they had established.

{DLH ended blockquote per Krebs below at 214.}

So in answer I will explain why I think the statement in bold is accurate.

There have been two science standards situations in Kansas, the first in 1999-2001 and the second in 2004-2007. In both cases, the following occurred:

1. The state Board appointed a committee to work on the standards. Following established procedures, the Board appointed some of the committee members and the Department of Education appointed others, that committee prepared drafts to present to the Board, and the public, including the scientific and education communities, was invited to comment.

2. Instead of following the recommendations of the committee they had appointed, creationist members of the state Board worked with various Intelligent Design/creationist advocates, in ways that are not part of the established procedures, to revise the committee’s recommended standards and eventually adopt standards which the committee disowned and rejected.

Let’s look briefly at the details.

In 1999, the committee had written a draft of the standards that included a mainstream view of evolution and the nature of science. However, the Board was made up of a majority of conservatives who were all young-earth creationists. One of them, Steve Abrams, worked with a group led by Tom Willis of the Creation Science Association of Mid-America to write a secret draft of the standards that omitted most of the material on the history of the universe, the earth, and life on earth, including the evolutionary mechanisms responsible for that diversity. Abrams used this secret draft to revise the committee’s draft and presented his draft to the Board as if it were his own work. In August 1999 the first set of creationist-influenced standards were passed. At the meeting in which Abrams submitted his revisions, he lied to the Board about the existence of the secret draft.

Only later, following detective work by myself and others did it become clear that Abrams had copied 98% of what he inserted in his revisions from the secret draft written by Tom Willis et al. (By the way, I used a design inference and a probability argument in doing so! :-) )

I think in this case it is clear that the Board ignored their own procedures: they not only ignored the recommendations of the committee, they let a private citizen’s group secretly revise the standards, and the creationist members deceived their fellow Board members about the source of those revisions.

2004

Again, the duly-appointed committee wrote a draft and submitted it to the Board. A Minority (about 8 out of 26) of the committee were ID/creationism supporters, and they had brought a number of changes to the committee, all but one of which the committee democratically voted down.

The Minority was led by lawyer John Calvert, head of the Intelligent Design network. Calvert was not a member of the committee, and yet, working once again with Abrams who was now Board president, Calvert was allowed unprecedented access to the Board: he wrote most of the Minority Report which brought the Minority’s changes to the Board, at times he had access to the Board equivalent to the committee’s chair, Steve Case, and he was allowed to arrange the 2005 Science hearings which were designed to showcase the Minority revisions. See here for a history of how those hearings came about.

After March 2005, the Board ignored and effectively disbanded the committee, and eventually adopted standards which incorporated the Minority revisions. The committee (of which I was a member) voted to have our names taken off the standards: we renounced them.

So again the Board ignored established procedures: they rejected the work of the very committee they established to work on the standards, and they (the Board) allowed a private citizen power and control over the process.

Therefore, I stand by my original statement:

I was defending those standards against changes that were inserted by a minority on the committee and that were adopted by a Board who ignored the very processes for writing curriculum that they had established.

Note well that the issue here is not whether one thinks the revisions made by the ID/creationists deserved to be made: I don’t think they did, obviously, but that is not the issue I am addressing.

The issue is whether the Board ignored established procedures, and on that I think the evidence is abundantly clear that indeed they did ignore said procedures.


208

larrynormanfan

03/17/2008

11:45 am

kairosfocus, I’ve reviewed this thread and think that Jack is right. The first person to mention the ellipsis as a supposed evasion was you, in 187:

Where is the ’serious accusatory statement’ here? YOU LEFT IT OUT THROUGH USING A MATERIALLY MISLEADING ELLIPSIS.

Wow. An accusation serious enough to merit ALL CAPS. But the ellipsis in question was provided by you in 123, quoting Jack in 117. Jack was quoting your quotation of him. When called on it you didn’t say “My goodness, you’re right! How careless of me to accuse you of providing an ellipsis that was my invention in the first place!” Instead, you refer to “following red herrings away to convenient strawmen soaked in oil of ad hominem, that can be ignited.”

Why parody your own writing in this way? Why not just admit your error and apologize?


209

Jack Krebs

03/17/2008

11:47 am

Damn, and my apologies: I didn’t proofread well and got and end-blockquote wrong.

Only the part that says,

I was defending those standards against changes that were inserted by a minority on the committee and that were adopted by a Board who ignored the very processes for writing curriculum that they had established.

is actually a quote in post 212. The rest is new material.
{DLH ended blockquote in Krebs above in 212.
PS Jack you might be able to edit by clicking the “e” below your name.}


210

sparc

03/17/2008

12:53 pm

Dave

A haploid 24 parent birthed a haploid 23 offspring. How was this rare mutation propagated? Anyone? Allen?

You should have heared about balanced translocations and how they arise during meiosis. Didn’t Allen explain this issue to you about a year ago in the 1n Jesus thread? For those who are interested: Allen later wrote a post on the impact of chromsomal aberrations on speciation on his own blog ( Island Mice May Evolve Faster: From one Species To Six In 500 Years).


211

DaveScot

03/17/2008

5:11 pm

sparc

Haven’t you read John Davison’s Semi-Meiosis hypothesis? It’s on the sideboard. He and Allen should get together for a meeting of the minds. Saltationists of a feather should stick together. I note that in the island mice thread on Allen’s blog the first commenter is “Martin” who is either a creation of Davison’s (as many suspect) or is Davison’s biggest fan as Martin appears everywhere Davison does.

But thanks for spurring me to read about the genetic effects of Robertsonian translocations. I was under the mistaken impression that mismatched chromosome counts are pretty bad news for fertility such as the horse/donkey which leads almost always to an infertile mule. I see now that isn’t always the case. In some cases fertility is merely reduced and not disastrously so (meiosis trying to sort 3 chromosomes into 2 gametes is going to result in some unviable gametes but also some possibly viable ones if there are no bad side effects from the fusion) so that the fused chromosome can propagate enough for two individuals heterozygous for the fusion to find each other, mate, and produce offspring homozygous for the fusion. The homozygous individual would suffer no loss of fertility with another homozygote. But if that’s the case it still doesn’t result in two separate species because the homozygote can still breed successfully with animals without the fusion. This would imply that man and chimp can produce fertile offspring. Can they?


212

DaveScot

03/17/2008

6:09 pm

Bob

500 bits is a measure of complexity. You must understand this to understand CSI. Do you understand the difference between a set with two members and a set with eight members? Do you understand that to number the members of the first set requires a 1 bit number assigned to each member of the set where to number the second set requires assigning each member a 3 bit number? The set of proteins with 100 residues has 2^500 members. To number the set you need a unique 500 bit number assigned to each of them. The number of unique members in a set is a measure of the complexity of the set. A specification is an independently given description that identifies some subset of the larger set. In this case the specification is “energy storage”. Some members of the set of all possible 100 residue sequences (I believe ATP synthase is much larger than 100 residues but that’s beside the point) will meet that specification but the vast majority will not so any random sample taken from the set will be unlikely to meet the specification just as any random assembly of the matter that makes up a space shuttle won’t likely be able to meet the specification of carrying passengers to space and back. The combination of a specification and greater than 500 bit complexity defines CSI. But CSI alone doesn’t warrant a design inference. There may be laws at work that prefer some patterns over another. For instance some snowflakes exhibit specified complexity but there are physical laws which prefer certain patterns in snowflakes so it doesn’t qualify for a design inference.


213

DaveScot

03/17/2008

6:43 pm

sparc

The fact that ATP synthase is composed of multiple protein products which must fit together precisely and be structured so that conformational changes result from external stimuli can be done by designing all components at once in the abstract then building them and fitting them together. How this is accomplished without planning is the essential question. This is difference between cellular machines and metabololic pathways. In the metabolic pathway independent proteins have separate inputs and outputs. The output of one is the input to another. There is a lot of flexibility in metabolic pathways. Not so in machines where the proteins operate together in unison.


214

DaveScot

03/17/2008

7:00 pm

Bob

It said nothing about the range of possible amino acid sequences that could accomplish this task.

Correct. We also don’t how many possible different combinations of the atoms in a space shuttle will carry passengers to space and back. We know from experience that most of them will not as it’s a lot harder finding arrangements that meet the specification versus finding arrangements that don’t meet it. A moron can build a space shuttle that doesn’t work. It took hundreds of man years of effort from very bright engineers to build one that does.

A physicist can explain to you precisely why most combinations of matter won’t fly to space and back but most people have a well enough developed sense of intuition to know this without invoking statistical mechanics.

I think we know from experience that the vast majority of combinations of amino acids won’t meet the specification of energy storage. ATP synthase is highly conserved in all forms of life. This is indicative that even small changes in sequence result in something that doesn’t fit the specification. If small random changes result in catastrophic failure that’s pretty compelling evidence that very few of all the possible polymer sequences meet the specification.

I suppose this could be better characterized by replacing the genes that specify the protein components in ATP synthase with random strings of codons and see how many of the random sequences still result in a working ATP synthase molecule. What I don’t suppose is anyone will bother doing it because the result is almost certain - no amount of effort will find a randomly generated sequence that works.


215

DaveScot

03/17/2008

7:23 pm

Jack

Are you going to respond to my request for a plausible and likely pathway for chance & neccessity to build an ATP synthase molecule?

See how easy it was for me to force you into a situation where your reliance on dogma is exposed? The only answer you can give is based on an informal fallacy. You hold a dogmatic belief that chance & neccessity is the only possibility so there must be a plausible likely pathway even if you can’t describe it. Is that how your brand of science works? Is that reflected in the science standards you were promoting? Things taken to be true without evidence are called articles of faith, Jack. Faith has no place in science. Faith’s place is in religion. The origin and diversity of life as explained by neo-Darwinian theory rests on articles of faith. It’s a religion, not a science. You, Jack, are as guilty as any young earth creationist of inserting your articles faith into science classrooms. I have no tolerance for articles of faith, yours or anyone else’s, in science.


216

larrynormanfan

03/17/2008

8:05 pm

I for one really like the current science standards in Kansas. What I especially like is that they make a case for materialism not as dogma but as a reflection of current scientific practice. They don’t try to define science once and for all but only for now:

Science is a human activity of systematically seeking natural explanations for what we observe in the world around us. Throughout history people from many cultures have used the methods of science to contribute to scientific knowledge and technological innovations, making science a worldwide enterprise. Scientists test explanations against the natural world, logically integrating observations and tested hypotheses with accepted explanations to gradually build more reliable and accurate understandings of nature. Scientific explanations must be testable and repeatable, and findings must be confirmed through additional observation and experimentation. As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes. (Emphasis added)

As a Christian, I don’t see anything wrong with that. It even opens the door to some return of non-natural explanations for natural events in the future. It just says they’re not a part of science now.


217

Jack Krebs

03/17/2008

8:05 pm

Hi Dave. I’m on spring break, so I have more time to participate here than usual. I’m working on the description of science post in response to kairosfocus right now, but I do have some response to you that I’ll try to get around to making soon.


218

DaveScot

03/17/2008

8:08 pm

For illustrative purposes:

ATP Synthase


219

DaveScot

03/17/2008

8:24 pm

larrynormanfan:

Science is a human activity of systematically seeking natural explanations for what we observe in the world around us.

So archeology isn’t a science in Kansas. Fascinating.

Where would my area of professional expertise, computer science, fit in here? We definitely aren’t seeking natural explanations.


220

Jack Krebs

03/17/2008

8:27 pm

Kairosfocus has brought up the issue of the description of science in the Introduction to the Kansas Science standards, stating that, in post 123,

or, was it that you and others, acting as advocates for in effect evolutionary materialism in the name of science, imposed a “standard” that in effect attempts to redefine “science” as the best materialistic [or, “naturalistic”] explanation of the cosmos from hydrogen to humans?

I’d like to explain what he is talking about, outline the history of the issue, and explain why I support the Kansas Science standard’s description and why I rejected the changes made by the Intelligent Design advocates.

A brief history of the description of the nature of science

The sentence in question occurs as the first sentence in a paragraph in the Introduction to the standards.:

The Nature of Science: Science is a human activity of systematically seeking natural explanations for what we observe in the world around us. Throughout history people from many cultures have used the methods of science to contribute to scientific knowledge and technological innovations, making science a worldwide enterprise. Scientists test explanations against the natural world, logically integrating observations and tested hypotheses with accepted explanations to gradually build more reliable and accurate understandings of nature. Scientific explanations must be testable and repeatable, and findings must be confirmed through additional observation and experimentation. As it is practiced in the late 20th and early 21st century, science is restricted to explaining only the natural world, using only natural cause. This is because science currently has no tools to test explanations using non-natural (such as supernatural) causes.

1999-2001: In 1999 a committee was formed by the state Board to completely revise the science standards. The previous 1995 standards had been merely an old-style list of topics to teach. The new standards were to be more in keeping with current curriculum practices, outlining with greater specificity what fundamental facts, concepts and skills students students should learn.

Along with many other topics, the first drafts from the committee had more specific statements about evolution than the 1995 standards. The committee’s draft also included the sentence in question about “natural explanations”.

In response to this, a group of young-earth creationists led by Tom Willis of the Creation Science Association of Mid-America conspired (literally and not just figuratively) with Board member Steve Abrams, also a young-earth creationist, to produce a secret draft of the standards that omitted most of the material on the history of the universe, the earth, and life on earth, including the evolutionary mechanisms responsible for that diversity, as explained in post 212.

At the same time both national and local Intelligent Design advocates, led by lawyer John Calvert and the Intelligent Design network (IDnet), became involved. Their one contribution to the secret draft was to substitute the word “logical” for “natural” in the description of science.

After the elections, which assured that a moderate majority would overturn the 1999 standards and adopt the committee’s recommended standards, Abrams worked with Calvert to make one last attempt to add ID-influenced changes to the standards. KCFS responded to the Board, explaining clearly why the IDnet’s suggested revisions should not be included. On February 14, 2001, the Board adopted standards based on the committee’s draft, rejecting both the 1999 standards and the IDnet’s suggested revisions.

At this point, the sentence “Science is a human activity of systematically seeking natural explanations for what we observe in the world around us” was offi