Home » Culture, Darwinism, News » When Darwinism infects popular culture, confusion follows as well as nonsense

When Darwinism infects popular culture, confusion follows as well as nonsense

File:Nostradamus prophecies.jpg

Every so often, one reads a sentence that just takes one’s breath away from an otherwise intelligent writer who uses Darwinism to help explain the world: This from Colin Dickey’s “Quack Prophet” (Lapham’s Quarterly):

Whether it’s the Dead Sea Scrolls or Finnegan’s Wake, there’s a long literary history of taking the garbled and the fragmented and looking for lucid meaning beneath. The science writer and professional skeptic Michael Shermer has gone so far as to argue that we’re hard-wired, from an evolutionary perspective, to look for such hidden meanings. “From sensory data flowing in through the senses the brain naturally begins to look for and find patterns, and then infuses those patterns with meaning,” Shermer writes. “We can’t help it. Our brains evolved to connect the dots of our world.” By adjusting the signal-to-noise ratio, Nostradamus introduced enough static into his Prophecies that they could be all things to all readers, poetic Rorschach blots of detail and blur.

Excuse us, but: The Dead Sea Scrolls are a remarkable 1947 find (since augmented) of a group of manuscript fragments and artifacts that everyone knew had lucid meaning, but awaited translation and clarification. You didn’t need to be “hard-wired” to notice any of that. Finnegan’s Wake is a deliberately obscure novel written by Irish novelist James Joyce, pored over by generations of academic dullards – to Joyce’s huge amusement, had he lived to see that entire circus play out. Much of it probably did have some meaning; it was written in English by an already successful novelist. Again, no “hardwiring” required to suppose that, though a certain amount of denseness for spending a lot of time on the problem.

It’s not like seeing patterns in the clouds, which might actually be evidence for Shermer’s thesis if not pressed too far – which it nearly always is.

Conflating the Scrolls and Finnegan’s Wake, spiced up with some Shermerite nonsense about how our brains evolved to … whatever, is an appalling but telling example of cultural Darwinism at work.

Those who don’t believe in meaning corrupt and confound it.

Note: The ostensible subject of the piece is that reliable checkout counter tabloid icon, the “prophet” Nostradamus, who was obscure for an entirely unrelated reason – to avoid falsification. Reminds one of something, no … ?

  • Delicious
  • Facebook
  • Reddit
  • StumbleUpon
  • Twitter
  • RSS Feed

346 Responses to When Darwinism infects popular culture, confusion follows as well as nonsense

  1. The ostensible subject of the piece is that reliable checkout counter tabloid icon, the “prophet” Nostradamus, who was obscure for an entirely unrelated reason – to avoid falsification. Reminds one of something, no … ?

    It does indeed remind one of something.

    It’s reminiscent of the ID hypothesis….to wit:

    An unknown something, via an unknown process, designed an unkown thing at some unknown point in the past.

    Falsify that if you dare!

  2. But it must be asked, if a brain does this automatically, how would you know? It would be an unconscious process, one inivisble to the bearer, one possesed by all “evolved” subjects and operating, supposedly, in researcher and subject simulaneously.

    That would seem to render Shermer’s comments the aritfact of the process he’s attempting to describe – his brain is simply searching for patterns and infusing them, and any meaning the appear to containt, into the material he publishes and the comments he makes. The things he says, the assertions he makes, therefore, don’t actually have content, it’s just the random process of a brain drawing a line connecting dots for the sake of survival in a world that can never be understood by an evolutionary automaton.

  3. Seeing design and identifying a designer are two different things – you may effect one event without the other. Regarding the process, that of designing, we have examples of that in ourselves, so the prcess is known, in part, though applied to much simpler processes than those found in biological systems, but it can be inferred that design processes for the simpler systems have similar components. (If you’re a theist, or Creationsist, it’s perfectly legitimate to assert our attempts at design are miniature, though inferior, images of processes inherent to the Creator.) As to unknown point in the past – pinpointing a date for the advent of a design, though maybe possible, has no bearing on the more fundamental question of design proper. Regarding the design hypothesis and falsification – randomly produce a living system under laboratory conditions, and you’ve likely made a big step on the path to falsifying the theory.

    In answer to the question – no.

  4. Though the whole interview is excellent, this clip on epistemology is relevant:

    RC Sproul Interviews Stephen Meyer, Part 4 of 5
    http://www.youtube.com/watch?v=CM5J2zTBIzI

    Further notes;

    Science and Theism: Concord, not Conflict* – Robert C. Koons
    IV. The Dependency of Science Upon Theism (Page 21)
    Excerpt: Far from undermining the credibility of theism, the remarkable success of science in modern times is a remarkable confirmation of the truth of theism. It was from the perspective of Judeo-Christian theism—and from the perspective alone—that it was predictable that science would have succeeded as it has. Without the faith in the rational intelligibility of the world and the divine vocation of human beings to master it, modern science would never have been possible, and, even today, the continued rationality of the enterprise of science depends on convictions that can be reasonably grounded only in theistic metaphysics.
    http://www.robkoons.net/media/.....ffd524.pdf

    Materialism simply dissolves into absurdity when pushed to extremes and certainly offers no guarantee to us for believing our perceptions and reasoning within science are trustworthy in the first place:

    Should You Trust the Monkey Mind? – Joe Carter
    Excerpt: Evolutionary naturalism assumes that our noetic equipment developed as it did because it had some survival value or reproductive advantage. Unguided evolution does not select for belief except insofar as the belief improves the chances of survival. The truth of a belief is irrelevant, as long as it produces an evolutionary advantage. This equipment could have developed at least four different kinds of belief that are compatible with evolutionary naturalism, none of which necessarily produce true and trustworthy cognitive faculties.
    http://www.firstthings.com/ont.....onkey-mind

    The following interview is sadly comical as a evolutionary psychologist realizes that neo-Darwinism can offer no guarantee that our faculties of reasoning will correspond to the truth, not even for the truth he is giving in the interview, (which begs the question of how was he able to come to that particular truthful realization, in the first place, if neo-Darwinian evolution were actually true?);

    Evolutionary guru: Don’t believe everything you think – October 2011
    Interviewer: You could be deceiving yourself about that.(?)
    Evolutionary Psychologist: Absolutely.
    http://www.newscientist.com/ar.....think.html

    further notes:

    “Atheism turns out to be too simple. If the whole universe has no meaning, we should never have found out that it has no meaning…”
    CS Lewis – Mere Christianity

    “But then with me the horrid doubt always arises whether the convictions of man’s mind, which has been developed from the mind of the lower animals, are of any value or at all trustworthy. Would any one trust in the convictions of a monkey’s mind, if there are any convictions in such a mind?” – Charles Darwin – Letter To William Graham – July 3, 1881

    “It seems to me immensely unlikely that mind is a mere by-product of matter. For if my mental processes are determined wholly by the motions of atoms in my brain I have no reason to suppose that my beliefs are true. They may be sound chemically, but that does not make them sound logically. And hence I have no reason for supposing my brain to be composed of atoms.” J. B. S. Haldane ["When I am dead," in Possible Worlds: And Other Essays [1927], Chatto and Windus: London, 1932, reprint, p.209.

    This following video humorously reveals the bankruptcy that atheists have in trying to ground rational beliefs within a materialistic worldview;

    John Cleese – The Scientists – humorous video
    http://www.youtube.com/watch?v=-M-vnmejwXo

    verse and music:

    Luke 8:35
    and the people went out to see what had happened. When they came to Jesus, they found the man from whom the demons had gone out, sitting at Jesus’ feet, dressed and in his right mind; and they were afraid.

    Alison Krauss – There Is A Reason
    http://www.youtube.com/watch?v=UWXNm9b6pKs

  5. Fossfur

    Kindly lay off the strawman distortions.

    If you could show empirically that blind chance and necessity can produce functionally specific complex information beyond 500 – 1,000 bits (without smuggling in intelligence), the design inference and theory would collapse.

    The most directly relevant tests are those of random text generation, which show that spaces of 10^50 possibilities can be searched successfully, but the relevant scopes of search start at 10^100 beyond that.

    Going beyond, as you know or should know if you are going to seriously comment at UD, the scientific issue is to reconstruct the unobserved past using inference to best explanation on observed evidence and reasonably inferred causal dynamics in the present. That is the exact issue confronted by the likes of Lyell and Darwin in seeking to scientifically investigate natural history.

    In the case of the living cell, in the heart of the cell is digitally coded, functionally specific prescriptive information, in DNA and molecules informationally derived from it. That information ranges form about 100 – 1 mn bits at the low end, up to billions of bits. The ONLY observationally justified causal process for such digital information in such quantities is design, including design of the GAs sometimes used as an attempted counter-example.

    In that context, we are strongly entitled to infer that such dFSCI in particular is a reliable signature of design.

    So strong is this that we see objectors trying to tell us that the digital information in DNA is not digital information [e.g. I found the reference to its being alphabetic instead particularly astonishingly ill-informed], and the algorithmic, step by step processes by which it is put to work are not algorithmic processes [because they use the materials and forces of chemistry to do the work, as though it is not the case that engineering NORMALLY uses the materials and forces of nature!].

    GEM of TKI

  6. F/N: I saw a peculiar thing, my account labelled anonymous in the preview box while being written, which is happening again. WordPress Bug?

  7. Fossfur you state:

    Falsify that if you dare!

    Since kairos has laid out the falsification criteria of ID, how about we just falsify neo-Darwinism instead?

    Falsification Of Neo-Darwinism by Quantum Entanglement/Information

    Neo-Darwinian evolution purports to explain all the wondrously amazing complexity of life on earth by reference solely to chance and necessity processes acting on energy and matter (i.e. purely material processes). In fact neo-Darwinian evolution makes the grand materialistic claim that the staggering levels of unmatched complex functional information we find in life, and even the ‘essence of life’ itself, simply ‘emerged’ from purely material processes. And even though this basic scientific point, of the ability of purely material processes to generate even trivial levels of complex functional information, has spectacularly failed to be established, we now have a much greater proof, than this stunning failure for validation, that ‘put the lie’ to the grand claims of neo-Darwinian evolution. This proof comes from the fact that it is now shown from quantum mechanics that ‘information’ is its own unique ‘physical’ entity. A physical entity that is shown to be completely independent of any energy-matter space-time constraints, i.e. it does not ‘emerge’ from a material basis. Moreover this ‘transcendent information’ is shown to be dominant of energy-matter in that this ‘information’ is shown to be the entity that is in fact constraining the energy-matter processes of the cell to be so far out of thermodynamic equilibrium.

    notes:

    First, Here is the falsification of local realism (reductive materialism).
    Here is a clip of a talk in which Alain Aspect talks about the failure of ‘local realism’, or the failure of reductive materialism, to explain reality:

    The Failure Of Local Realism – Reductive Materialism – Alain Aspect – video
    http://www.metacafe.com/w/4744145

    The falsification for local realism (reductive materialism) was recently greatly strengthened:

    ‘Quantum Magic’ Without Any ‘Spooky Action at a Distance’ – June 2011
    Excerpt: A team of researchers led by Anton Zeilinger at the University of Vienna and the Institute for Quantum Optics and Quantum Information of the Austrian Academy of Sciences used a system which does not allow for entanglement, and still found results which cannot be interpreted classically.
    http://www.sciencedaily.com/re.....111942.htm

    Physicists close two loopholes while violating local realism – November 2010
    Excerpt: The latest test in quantum mechanics provides even stronger support than before for the view that nature violates local realism and is thus in contradiction with a classical worldview.
    http://www.physorg.com/news/20.....alism.html

    Quantum Measurements: Common Sense Is Not Enough, Physicists Show – July 2009
    Excerpt: scientists have now proven comprehensively in an experiment for the first time that the experimentally observed phenomena cannot be described by non-contextual models with hidden variables.
    http://www.sciencedaily.com/re.....142824.htm

    of note: hidden variables were postulated to remove the need for ‘spooky’ forces, as Einstein termed them — forces that act instantaneously at great distances, thereby breaking the most cherished rule of relativity theory, that nothing can travel faster than the speed of light. This following video illustrates just how ‘spooky’, to use Einstein’s infamous word, this quantum action truly is:

    Light and Quantum Entanglement Reflect Some Characteristics Of God – video
    http://www.metacafe.com/watch/4102182/

    And yet, this ‘spooky’ quantum entanglement, which rigorously falsified local realism (reductive materialism) as the ‘true’ description of reality, is now found in molecular biology on a massive scale!

    Quantum Information/Entanglement In DNA & Protein Folding – short video
    http://www.metacafe.com/watch/5936605/

    Quantum entanglement holds together life’s blueprint – 2010
    Excerpt: When the researchers analysed the DNA without its helical structure, they found that the electron clouds were not entangled. But when they incorporated DNA’s helical structure into the model, they saw that the electron clouds of each base pair became entangled with those of its neighbours (arxiv.org/abs/1006.4053v1). “If you didn’t have entanglement, then DNA would have a simple flat structure, and you would never get the twist that seems to be important to the functioning of DNA,” says team member Vlatko Vedral of the University of Oxford.
    http://neshealthblog.wordpress.....blueprint/

    The relevance of continuous variable entanglement in DNA – July 2010
    Excerpt: We consider a chain of harmonic oscillators with dipole-dipole interaction between nearest neighbours resulting in a van der Waals type bonding. The binding energies between entangled and classically correlated states are compared. We apply our model to DNA. By comparing our model with numerical simulations we conclude that entanglement may play a crucial role in explaining the stability of the DNA double helix.
    http://arxiv.org/abs/1006.4053v1

    Quantum Entanglement/Information is confirmed in DNA by direct observation here;

    DNA Can Discern Between Two Quantum States, Research Shows – June 2011
    Excerpt: — DNA — can discern between quantum states known as spin. – The researchers fabricated self-assembling, single layers of DNA attached to a gold substrate. They then exposed the DNA to mixed groups of electrons with both directions of spin. Indeed, the team’s results surpassed expectations: The biological molecules reacted strongly with the electrons carrying one of those spins, and hardly at all with the others. The longer the molecule, the more efficient it was at choosing electrons with the desired spin, while single strands and damaged bits of DNA did not exhibit this property.
    http://www.sciencedaily.com/re.....104014.htm

  8. The necessity of ‘transcendent’ information, to ‘constrain’ a cell, against thermodynamic effects is noted here:

    Information and entropy – top-down or bottom-up development in living systems? A.C. McINTOSH
    Excerpt: This paper highlights the distinctive and non-material nature of information and its relationship with matter, energy and natural forces. It is proposed in conclusion that it is the non-material information (transcendent to the matter and energy) that is actually itself constraining the local thermodynamics to be in ordered disequilibrium and with specified raised free energy levels necessary for the molecular and cellular machinery to operate.
    http://journals.witpress.com/paperinfo.asp?pid=420

    i.e. It is very interesting to note, to put it mildly, that quantum entanglement, which conclusively demonstrates that ‘information’ in its pure ‘quantum form’ is completely transcendent of any time and space constraints, should be found in molecular biology on such a massive scale, for how can the quantum entanglement ‘effect’ in biology possibly be explained by a material (matter/energy space/time) ’cause’ when the quantum entanglement ‘effect’ falsified material particles as its own ‘causation’ in the first place? (A. Aspect) Appealing to the probability of various configurations of material particles, as neo-Darwinism does, simply will not help since a timeless/spaceless cause must be supplied which is beyond the capacity of the energy/matter particles themselves to supply! To give a coherent explanation for an effect that is shown to be completely independent of any time and space constraints one is forced to appeal to a cause that is itself not limited to time and space! i.e. Put more simply, you cannot explain a effect by a cause that has been falsified by the very same effect you are seeking to explain! Improbability arguments of various ‘specified’ configurations of material particles, which have been a staple of the arguments against neo-Darwinism, simply do not apply since the cause is not within the material particles in the first place!
    ,,,To refute this falsification of neo-Darwinism, one must overturn Alain Aspect, and company’s, falsification of local realism (reductive materialism) !

    =================

    Alain Aspect and Anton Zeilinger by Richard Conn Henry – Physics Professor – John Hopkins University
    Excerpt: Why do people cling with such ferocity to belief in a mind-independent reality? It is surely because if there is no such reality, then ultimately (as far as we can know) mind alone exists. And if mind is not a product of real matter, but rather is the creator of the “illusion” of material reality (which has, in fact, despite the materialists, been known to be the case, since the discovery of quantum mechanics in 1925), then a theistic view of our existence becomes the only rational alternative to solipsism (solipsism is the philosophical idea that only one’s own mind is sure to exist). (Dr. Henry’s referenced experiment and paper – “An experimental test of non-local realism” by S. Gröblacher et. al., Nature 446, 871, April 2007 – “To be or not to be local” by Alain Aspect, Nature 446, 866, April 2007

    =================

    And to dovetail into Dembski and Marks’s previous work on Conservation of Information;,,,

    LIFE’S CONSERVATION LAW: Why Darwinian Evolution Cannot Create Biological Information
    William A. Dembski and Robert J. Marks II
    http://evoinfo.org/publication.....ation-law/

    ,,,Encoded ‘classical’ information such as what Dembski and Marks demonstrated the conservation of, and such as what we find encoded in computer programs, and yes, as we find encoded in DNA, is found to be a subset of ‘transcendent’ (beyond space and time) quantum entanglement/information by the following method:,,,

    ,,,This following research provides solid falsification for the late Rolf Landauer’s decades old contention that the information encoded in a computer is merely physical (merely ‘emergent’ from a material basis) since he believed it always required energy to erase it;

    Quantum knowledge cools computers: New understanding of entropy – June 2011
    Excerpt: No heat, even a cooling effect;
    In the case of perfect classical knowledge of a computer memory (zero entropy), deletion of the data requires in theory no energy at all. The researchers prove that “more than complete knowledge” from quantum entanglement with the memory (negative entropy) leads to deletion of the data being accompanied by removal of heat from the computer and its release as usable energy. This is the physical meaning of negative entropy. Renner emphasizes, however, “This doesn’t mean that we can develop a perpetual motion machine.” The data can only be deleted once, so there is no possibility to continue to generate energy. The process also destroys the entanglement, and it would take an input of energy to reset the system to its starting state. The equations are consistent with what’s known as the second law of thermodynamics: the idea that the entropy of the universe can never decrease. Vedral says “We’re working on the edge of the second law. If you go any further, you will break it.”
    http://www.sciencedaily.com/re.....134300.htm

    ,,,And to dot the i’s, and cross the t’s, here is the empirical confirmation that quantum information is in fact ‘conserved’;,,,

    Quantum no-hiding theorem experimentally confirmed for first time
    Excerpt: In the classical world, information can be copied and deleted at will. In the quantum world, however, the conservation of quantum information means that information cannot be created nor destroyed. This concept stems from two fundamental theorems of quantum mechanics: the no-cloning theorem and the no-deleting theorem. A third and related theorem, called the no-hiding theorem, addresses information loss in the quantum world. According to the no-hiding theorem, if information is missing from one system (which may happen when the system interacts with the environment), then the information is simply residing somewhere else in the Universe; in other words, the missing information cannot be hidden in the correlations between a system and its environment.
    http://www.physorg.com/news/20.....tally.html

    Further note:

    Three subsets of sequence complexity and their relevance to biopolymeric information – Abel, Trevors
    Excerpt: Shannon information theory measures the relative degrees of RSC and OSC. Shannon information theory cannot measure FSC (Functional Sequence Complexity). FSC is invariably associated with all forms of complex biofunction, including biochemical pathways, cycles, positive and negative feedback regulation, and homeostatic metabolism. The algorithmic programming of FSC, not merely its aperiodicity, accounts for biological organization. No empirical evidence exists of either RSC of OSC ever having produced a single instance of sophisticated biological organization. Organization invariably manifests FSC rather than successive random events (RSC) or low-informational self-ordering phenomena (OSC).,,,
    Testable hypotheses about FSC
    What testable empirical hypotheses can we make about FSC that might allow us to identify when FSC exists? In any of the following null hypotheses [137], demonstrating a single exception would allow falsification. We invite assistance in the falsification of any of the following null hypotheses:

    Null hypothesis #1
    Stochastic ensembles of physical units cannot program algorithmic/cybernetic function.

    Null hypothesis #2
    Dynamically-ordered sequences of individual physical units (physicality patterned by natural law causation) cannot program algorithmic/cybernetic function.

    Null hypothesis #3
    Statistically weighted means (e.g., increased availability of certain units in the polymerization environment) giving rise to patterned (compressible) sequences of units cannot program algorithmic/cybernetic function.

    Null hypothesis #4
    Computationally successful configurable switches cannot be set by chance, necessity, or any combination of the two, even over large periods of time.

    We repeat that a single incident of nontrivial algorithmic programming success achieved without selection for fitness at the decision-node programming level would falsify any of these null hypotheses. This renders each of these hypotheses scientifically testable. We offer the prediction that none of these four hypotheses will be falsified.
    http://www.tbiomed.com/content/2/1/29

    The following describes how quantum entanglement is related to functional information:

    Quantum Entanglement and Information
    Excerpt: A pair of quantum systems in an entangled state can be used as a quantum information channel to perform computational and cryptographic tasks that are impossible for classical systems.
    http://plato.stanford.edu/entries/qt-entangle/

    Anton Zeilinger, a leading researcher in Quantum mechanics, relates how quantum entanglement is related to quantum teleportation in this following video;

    Quantum Entanglement and Teleportation – Anton Zeilinger – video
    http://www.metacafe.com/watch/5705317/

    A bit more detail on how teleportation is actually achieved, by extension of quantum entanglement principles, is here:

    Quantum Teleportation
    Excerpt: To perform the teleportation, Alice and Bob must have a classical communication channel and must also share quantum entanglement — in the protocol we employ*, each possesses one half of a two-particle entangled state.
    http://www.cco.caltech.edu/~qoptics/teleport.html

  9. And quantum teleporation has now shown that atoms, which are suppose to be the basis from which ALL functional information ‘emerges’ in the atheistic neo-Darwinian view of life, are now shown to be, in fact, reducible to the transcendent functional quantum information that the atoms were suppose to be the basis of in the first place!

    Ions have been teleported successfully for the first time by two independent research groups
    Excerpt: In fact, copying isn’t quite the right word for it. In order to reproduce the quantum state of one atom in a second atom, the original has to be destroyed. This is unavoidable – it is enforced by the laws of quantum mechanics, which stipulate that you can’t ‘clone’ a quantum state. In principle, however, the ‘copy’ can be indistinguishable from the original (that was destroyed),,,
    http://www.rsc.org/chemistrywo.....ammeup.asp

    Atom takes a quantum leap – 2009
    Excerpt: Ytterbium ions have been ‘teleported’ over a distance of a metre.,,,
    “What you’re moving is information, not the actual atoms,” says Chris Monroe, from the Joint Quantum Institute at the University of Maryland in College Park and an author of the paper. But as two particles of the same type differ only in their quantum states, the transfer of quantum information is equivalent to moving the first particle to the location of the second.
    http://www.freerepublic.com/fo.....1769/posts

    Thus the burning question, that is usually completely ignored by the neo-Darwinists that I’ve asked in the past, is, “How can quantum information/entanglement possibly ‘emerge’ from any material basis of atoms in DNA, or any other atoms, when entire atoms are now shown to reduce to transcendent quantum information in the first place in these teleportation experiments??? i.e. It is simply COMPLETELY IMPOSSIBLE for the ’cause’ of transcendent functional quantum information, such as we find on a massive scale in DNA and proteins, to reside within, or ever ‘emerge’ from, any material basis of particles!!! Despite the virtual wall of silence I’ve seen from neo-Darwinists thus far, this is not a trivial matter in the least as far as developments in science have gone!!

    Does Quantum Biology Support A Quantum Soul? – Stuart Hameroff – video (notes in description)
    http://vimeo.com/29895068

    non-local ‘epigenetic’ information is implicated in controlling the 3-D spatial organization of body plans;
    https://docs.google.com/document/d/1iNy78O6ZpU8wpFIgkILi85TvhC9mSqzUSE_jzbksoHY/edit?hl=en_US

    verses and music:

    John 1:1-3
    In the beginning was the Word, and the Word was with God, and the Word was God. He was with God in the beginning. Through him all things were made; without him nothing was made that has been made.

    1 Corinthians 2:14
    The natural person does not accept the things of the Spirit of God, for they are folly to him, and he is not able to understand them because they are spiritually discerned.

    Brooke Fraser – Lord of Lords(Legendado Português) -
    http://www.youtube.com/watch?v=rkF3iVjOZ1I

  10. So strong is this that we see objectors trying to tell us that the digital information in DNA is not digital information [e.g. I found the reference to its being alphabetic instead particularly astonishingly ill-informed]

    And yet you offered no rebuttal to my reasoning, and ignored the fact that I was perfectly willing to accept as “digital” the switching mechanisms that control gene expression.

    In other words, I clearly have no problem with the idea that genes work “digitally”, yet you continue to assert that my case that DNA is not “base 4 digital code” is some kind of smokescreen to deny that there is anything digital about DNA lest I allow a Divine Foot in the door.

    DNA is not “base 4 digital code” because base (in the other sense) pairs are not entities that are switched between four possible states.

    If you disagree, please post your rebuttal. Simply describing it as “particularly astonishingly ill-informed”, and, moreoever, ascribing it to a desire on my pair to deny that cells are digital for fear of its ID implications, is what you might call an “ad hominem-laced straw man” ;)

  11. DNA Computer
    Excerpt: DNA computers will work through the use of DNA-based logic gates. These logic gates are very much similar to what is used in our computers today with the only difference being the composition of the input and output signals.,,, With the use of DNA logic gates, a DNA computer the size of a teardrop will be more powerful than today’s most powerful supercomputer. A DNA chip less than the size of a dime will have the capacity to perform 10 trillion parallel calculations at one time as well as hold ten terabytes of data. The capacity to perform parallel calculations, much more trillions of parallel calculations, is something silicon-based computers are not able to do. As such, a complex mathematical problem that could take silicon-based computers thousands of years to solve can be done by DNA computers in hours.
    http://www.tech-faq.com/dna-computer.html

  12. From your link:

    The page you’ve been trying to access was blocked to prevent access to malicious web content which may attack your computer

    ba77: DNA computing does not treat DNA as a “base 4 digital system”.

    Which is just as well, because DNA is not a “base 4 digital system”. The units in DNA computing are molecules (not base-pairs) that catalyze reactions, sometimes called “DNAzymes”.

    non-malicious wiki link

  13. Dr Liddle

    Pardon, but that is simply dancing wrong but strong.

    Between the letters a and B, what are the defined states of the alphabet, again?

    None.

    Alphabetic writing uses standard glyphs to define states of string data structures, which take meaning from functional specificity per a defined vocabulary [code] and rules of composition.

    In other words, the alphabet-based message is a digital system.

    And, R/DNA is a case in point, using four basic letters [three bases, like AUG], and three-letter words to define instructions to elongate AA chains.

    Also, if you look at say Eukaryotes, you will see that mRNA is nipped up and reassembled to form the actual code to be processed in the ribosome.

    The intensity of refusal to take correction on the point, is telling. You cannot even acknowledge the base-4 system being used, something as easily accessible as Wikipedia.

    In the section on the expanded code, we may see:

    Since 2001, 40 non-natural amino acids have been added into protein by creating a unique codon (recoding) and a corresponding transfer-RNA:aminoacyl – tRNA-synthetase pair to encode it with diverse physicochemical and biological properties in order to be used as a tool to exploring protein structure and function or to create novel or enhanced proteins.[36][37]

    H. Murakami and M. Sisido have extended some codons to have four and five bases. Steven A. Benner constructed a functional 65th (in vivo) codon.[38]

    As in, an empirically demonstrated, reprogrammable digital system.

    Please, think again.

    GEM of TKI

    PS: I am still seeing that "anonymous" in the preview window.

  14. The reason I refuse to take “correction”, kf, is simply that I do not believe I am incorrect.

    Tell me how a base pair can take one of four states, as it has to do if it is to be regarded as a “digit” in a “base 4 digital code”.

    I quite agree that DNA sequences can be described as “three letter words”. That was my point; that it is an alphabetic system not a “base 4 digital” system.

    And will you please walk back your insinuation that I am refusing to accept that DNA is a “base 4 digital” system because of its alleged implications for ID; it is self-evidently false, as evidenced by the fact that I have made it clear that I am quite happy to regard gene regulatory networks as digital, ergo, I have no problem with the idea that genetic processes are digital.

  15. 15

    It’s too bad that so many materialists/darwinists skip over BA77′s posts (or at least say they do), because he does an excellent job of refuting (with references and abundant resources) materialism and darwinism at the most fundamental level.

    Materialism and determinism have been effectively disproven for decades, yet darwinists and materialists still argue as if their basic, foundational concepts are still valid. Arguing evolution with a materialist is like arguing orbital satellite telemetry with a flat-earther.

  16. And in case it helps, here is an example of a DNA sequence containing five codons:

    AUGCCGACAGUAGAG

    here is a variant:

    AUGCCGACAGUAGUG

    Which you might conceivably call a change of “state” of the position marked in bold.

    But what about this variant:

    AUGCCGACAGUAGUAGAG

    What has changed state, if anything?

    or in this variant:

    AUGCCGACAGAG?

    This is why DNA cannot be usefully described as a “base 4 digital” system – it has nothing in common with a “base 4 digital” system, although it has plenty in common with a 4 letter alphabetic system in which sequences of “letters” have “meaning”.

    It could also be usefully described as a “base 2 digital system” because genes can be in one of two states: Off, and On, and indeed switching one gene Off can turn another one Off or On in a logical cascade in which certain inputs result in certain outputs.

    But Base 4 digital it ain’t.

  17. Dr Liddle: Again, do tell me what valid alphabetic value lies between A and B? GEM of TKI

  18. Elizabeth Liddle:

    This is why DNA cannot be usefully described as a “base 4 digital” system – it has nothing in common with a “base 4 digital” system, although it has plenty in common with a 4 letter alphabetic system in which sequences of “letters” have “meaning”.

    It could also be usefully described as a “base 2 digital system” because genes can be in one of two states: Off, and On, and indeed switching one gene Off can turn another one Off or On in a logical cascade in which certain inputs result in certain outputs.

    But Base 4 digital it ain’t.

    Yet another stunningly asinine Liddleism for the record books. You should present your analysis at a symposium.

  19. Perhaps you could explain to me why it is “asinine”. Simply asserting that it is is not persuasive, and quite rude.

  20. Dr Liddle: Again, do tell me what valid alphabetic value lies between A and B? GEM of TKI

    None, of course, kf. As I have made perfectly clear, I am happy to consider DNA (and RNA) an alphabetic system with a discrete set of “letters”. What I dispute is that these “letters” can usefully be called “digits” of a “base 4″ digital code.

    As you will see if you attempt to answer the questions I pose to you in 1.2.2.2.2

  21. Dr Liddle:

    Just as a reminder, let me clip Wikipedia on the reason why I ask this:

    A digital system[1] is a data technology that uses discrete (discontinuous) values. By contrast, analog (non-digital) systems use a continuous range of values to represent information. Although digital representations are discrete, they can be used to carry either discrete information, such as numbers, letters or other individual symbols, or approximations of continuous information, such as sounds, images, and other measurements of continuous systems.

    The word digital comes from the same source as the word digit and digitus (the Latin word for finger), as fingers are used for discrete counting. It is most commonly used in computing and electronics, especially where real-world information is converted to a digital format as in digital audio and digital photography.

    (And, as someone who has routinely taught digital systems, I cite this not as proof but as a way to try to communicate.)

    GEM of TKI

  22. I should also point out, kf, that your error is made explicit in your question: letters do not have “values”, they have referents, and the fact that we traditionally recite them in a sequence has no bearing on what those referents are. If it was agreed tomorrow that from henceforth alphabetical order would become:

    THEQUICKBROWNFXJMPSVLAZYDG

  23. it would make not the slightest different to the referent signified by any letter, and not a single text written in roman letters would change in meaning. On the other hand if it was agreed that the order of digits would become:

    8906245173

    it would be tantamount to changing the referent (a value) of every digit, and rendering vast numbers of arithmetical statement false.

    This is because a letter is a very different thing to a digit. DNA and RNA base pairs are not like digits. They are like letters. They have no “place value” or canonical order that makes any difference to their referents.

  24. Elizabeth Liddle I can’t quite follow your argument. Are you suggesting because DNA is grouped into “3 letter words” that that means it’s not base 4? In base 2 code, the 1s and 0s are grouped into 8 bit bytes. Consider for example ASCII which defines how our alphabet is encoded in base 2 using words 8 bits in length.

  25. Elizabeth Liddle:

    Perhaps you could explain to me why it is “asinine”.

    That would be as in fatuous, inane (extremely silly or stupid); to wit, being informed of yet in obdurate denial of the definitions of base-four numbering systems.

    Simply asserting that it is is not persuasive, and quite rude.

    It wasn’t meant to persuade. As for being rude, that would be in the eye of the beholder, now wouldn’t it.

    If you don’t like your intellectually dishonest arguments being called for what they are, you might try persuading with facts instead of unfounded speculation and engaging the questions put to you instead of deflecting them and implying novel meanings to suit your semantics.

  26. kf, let me requote the statement of yours that I objected to:

    So strong is this that we see objectors trying to tell us that the digital information in DNA is not digital information [e.g. I found the reference to its being alphabetic instead particularly astonishingly ill-informed]

    Where have I ever said that base pairs were not “discrete”? What I said was that they were analogous to [discrete] letters, not [discrete] digits. You described my “reference to its being alphabetic instead” as “astonishingly ill-informed”. So clearly it is not any assertion of mine that base-pairs are not discrete that you can have objected to because alphabetical letters are discrete. Your stated objection was that I considered them alphabetic not digital.

    So this:

    The word digital comes from the same source as the word digit and digitus (the Latin word for finger), as fingers are used for discrete counting. It is most commonly used in computing and electronics, especially where real-world information is converted to a digital format as in digital audio and digital photography.

    is irrelevant.

    Please answer my questions in 1.2.2.2.2

  27. Elizabeth Liddle, regarding your new alphabet, if it was implemented tomorrow the internet would likely stop working. As well as every computer that expected ‘a’ to refer to position 1, ‘b’ to refer to position 2 etc.

  28. That would be as in fatuous, inane (extremely silly or stupid); to wit, being informed of yet in obdurate denial of the definitions of base-four numbering systems.

    And yet I see no rebuttal.

    Simply asserting that it is is not persuasive, and quite rude.

    It wasn’t meant to persuade. As for being rude, that would be in the eye of the beholder, now wouldn’t it.

    Not really. Most civilised people would regard the description of someone else’s position as “a stunningly asinine [person's surname]ism” as rude, especially if posted without any rebuttal.

    If you don’t like your intellectually dishonest arguments being called for what they are, you might try persuading with facts instead of unfounded speculation and engaging the questions put to you instead of deflecting them and implying novel meanings to suit your semantics.

    Well, perhaps you could set an example and address my questions in 1.2.2.2.2 and by responding to my request for an explanation as to why you regard my position as “asinine”.

    Also, as “dishonest”.

    Put up or shut up.

  29. Elizabeth Liddle, regarding your new alphabet, if it was implemented tomorrow the internet would likely stop working.

    No, it would not. Dictionaries wouldn’t work too well, but most other things would work fine. Alphabetical order is just a convention that has no bearing on the referents signified by each letter.

    This is not the case with digits, where digits are ordered in ascending numerical value, and any change to their ordering would change their numerical value.

    Also, see my post at 1.2.2.2.2

    As well as every computer that expected ‘a’ to refer to position 1, ‘b’ to refer to position 2 etc.

    Yes, alphanumeric systems would be messed up. Which actually makes my point. Alphabets are only digital when treated as digits, as in alphanumeric numbering systems. Treated as graphemes, they are not.

    DNA base pairs act as grapheme-like units, not digit-like units.

  30. Alphabets are only digital when treated as digits

    That’s how the internet works.

    Consider “www” in binary:
    011101110111011101110111
    which is, the first letter (a:01100001) plus 22
    under your new system ‘w’ would translate to the first letter plus 11 or
    01101011
    so nothing would work anymore

  31. Elizabeth Liddle I can’t quite follow your argument. Are you suggesting because DNA is grouped into “3 letter words” that that means it’s not base 4? In base 2 code, the 1s and 0s are grouped into 8 bit bytes. Consider for example ASCII which defines how our alphabet is encoded in base 2 using words 8 bits in length.

    No, I’m not saying that DNA is not base 4 because it’s grouped in “3 letter words”. It could be grouped in any-number-of-letter words and it still wouldn’t be in base 4 digital, because in base N numbering systems you have a set of positions that can take one of N values. This is not the case with DNA. For a start, within a single organism we hope that none of sequence changes at all (or we may get cancer). But even if we consider DNA variants within a population, the changes are not rung by changing the “state” of “positions” but by changing the sequence in various ways, where it is not the position that matters, but the sequential context. Sometimes the variants actually “SNPs” – substitution of one base-pair by another, and if all variants were of this type, maybe you could call the system “base 4 digital”. But all variants are not of this type, and deletions, insertions and duplication are a major feature of DNA variation. Such variants are not “digital” at all, because no entity changes “state”; rather the sequence is rearranged. That’s why the system is much more like text than like digits, and why “base 4 digital” is a very misleading description.

    Which is not an ideological point at all, as I’ve said – I see no problem in regarding cells as operating a “base 2 digital” system of gene regulation. But it is being touted by kf as an ideological point, and I’m still waiting for him to walk that back, whether he continues to disagree with me on the “base 4 issue” or not.

  32. Elizabeth Liddle:

    Well, perhaps you could set an example and address my questions in 1.2.2.2.2 and by responding to my request for an explanation as to why you regard my position as “asinine”.

    Because adenine uracil guanine and cytosine represent the four possible values of a DNA “digit” and those digits may be combined into longer strings of digits, which longer strings (genes) whether encoded or not (on or off) does not transform the four values of adenine uracil guanine and cytosine into two (base-2) values.

    Canonical order is found in the strings, not in the values of digits. A string of digits clearly has canonical order. Whether adenine has a higher value than quanine is arguable, but irrelevant in the example of DNA because it is more like content-addressable memory than address-accessed memory, i.e. it the pattern in the string of digits that is determinitive, not any expected relative canonical ordering of adenine uracil guanine and cytosine per se.

    Also, as “dishonest”.

    But you knew all that, yet obdurately insist otherwise and failed to engage the accepted definitions of base four systems as repeatedly explained to you, ad nauseum.

    If you think your view is correct, then truely you should present it in a paper at a symposium. Perhaps those attendess will explain it to you further in terms you’ll find less rude.

  33. Dunsinane:

    That’s how the internet works.

    Consider “www” in binary:
    011101110111011101110111
    which is, the first letter (a:01100001) plus 22
    under your new system ‘w’ would translate to the first letter plus 11 or
    01101011
    so nothing would work anymore

    Well, obviously if you changed the mapping of alphabetical letters to digital code in a computer then “nothing would work any more”!

    That’s not what I said! I said that the order in which we recite the alphabet has no bearing on the referent (a sound) for each letter. But clearly, if a digital mapping is based on alphabetical order it will change the mapping.

    That makes my point, not yours!!!!

  34. arkady967

    Seeing design and identifying a designer are two different things – you may effect one event without the other.

    No, that is not true. It’s impossible to recognize conscious design without at least some external knowledge of the designer – its capabilities, the material resources it has available, knowledge of other designs it has done.

    ID makes the unwarranted assumption that all design must be like human design, then attempts to match unknown items to known human-produced forms with a subjective superficial examination (“Looks designed to me!). This includes coming up with meaningless metrics for measuring complexity, like dFSCI.

    Logically there is no difference between “that fluffy cloud looks like a choo-choo train, so it must be designed!” and “that flagella looks like an outboard motor, so it must be designed!”

  35. GinoB:

    It’s impossible to recognize conscious design without at least some external knowledge of the designer – its capabilities, the material resources it has available, knowledge of other designs it has done.

    That is unsupportable nonsense. All we need is knowledge of cause and effect relationships.

    All we know about the designers of Stonehenge we got from studying the evidence left behind.

    ID makes the unwarranted assumption that all design must be like human design,

    No, ID makes no such assumption.

    And in the end all YOU have to do to refute ANY given design inference is to actually step up and demonstrate that blind, undirected processes can account for it.

    You sure as heck are not going to refute ID with your whining ignorance.

  36. Dr Liddle:

    Perhaps, it has not been recognised by you that once the alphabet is discrete state, it is perforce digital?

    You appear to have a fixed confusion about what defines a digital system.

    I am therefore simply pointing out (again) that it is discrete stateness that defines a digital system, and that the system of alphabetic spelling — a digital conversion of speech BTW — is such that words carry the string data structure *-*-*-*- . . ., where the *’s denote valid positions. The symbol *, takes values from the set A, B, C . . . (with extensions) and between any two neighbouring letters such as A and B there is no third valid letter-value.

    Insistence on such a basic error as though force of will and novel terms like “graphemes,” can change the basic definition and why it is made (the key distinction is that we have a fundamental PHYSICAL and conceptual contrast: discrete/continuous . . . ), does your position no good.

    When we convert one digital thing to another, we can do so without data loss, but for continuous state — analogue — systems, we have to accept a certain level of error, throwing away things beyond a certain precision.

    But once we accept that conversion error, we can then take steps to essentially eliminate further noise, within limits. (Notice how digital TV is usually very good, then beyond a certain limit utterly broken up into horrible distortions?)

    And, yes, I am entirely correct to speak of “values,” as the old RION set of scales reminds us: ratio, interval, ordinal, NOMINAL.

    This inherent digitalness is why the alphabetic system was so easily represented in the old 5-bit Baudot code, then onward to 7/8-bit ASCII [and EBCDIC etc]and now 16-bit Unicode.

    Building on this, I have always been struck by the very direct comparison of 8-bit punched paper tape and how mRNA works in the ribosome. Of course the tape used punched holes, vs non punched, but that is of no great consequence. I have similarly highlighted how Braille used a 6-bit raised dot code, and how von Neumann’s original description of the self replicator, used bars of differing height to encode information. (For that matter, Yale type keys do much the same and bars of cams are again similar.)

    DNA, again, uses a 4-state per digit string data structure. Alphabetic writing, uses a 26 state [or extended to 128 or more depending] system.

    Maybe, the key thing is to note that digital is not to be equated to binary digital, which happens to be a very convenient base to use in technology.

    GEM of TKI

  37. in base N numbering systems you have a set of positions that can take one of N values. This is not the case with DNA.

    There are 4 possible values TCAG, therefore N=4.
    Given a word of length 3, position 1 can contain T, C, A, or G, position 2 can contain T, C, A, or G, position 3 can contain T, C, A, or G.

    What am I missing here? Do you think because the way the “memory” works is different that that means it’s not base 4?

  38. Elizabeth Liddle:

    Well, perhaps you could set an example and address my questions in 1.2.2.2.2 and by responding to my request for an explanation as to why you regard my position as “asinine”.

    Because adenine uracil guanine and cytosine represent the four possible values of a DNA “digit” and those digits may be combined into longer strings of digits, which longer strings (genes) whether encoded or not (on or off) does not transform the four values of adenine uracil guanine and cytosine into two (base-2) values.

    Canonical order is found in the strings, not in the values of digits. A string of digits clearly has canonical order. Whether adenine has a higher value than quanine is arguable, but irrelevant in the example of DNA because it is more like content-addressable memory than address-accessed memory, i.e. it the pattern in the string of digits that is determinitive, not any expected relative canonical ordering of adenine uracil guanine and cytosine per se.

    A “string of digits” is a string. The elements of a string are not digits (though they may be alphanumeric). As you say, it is irrelevant whether “adenine has a higher value than guanine”, and also completely meaningless. It’s meaningless because unlike in a “base N digital” system, the “digits” have no quantitative or place value at all. Place is irrelevant, in fact – what matters is the sequence.

    Which is why, if you look at my examples in 1.2.2.2.2 you will see variants in which “place” is a meaningless concept. It is not “positions” that change “state”, but sequences that can change by means of insertion, deletion and duplication as well as substitution.

    Also, as “dishonest”.

    But you knew all that, yet obdurately insist otherwise and failed to engage the accepted definitions of base four systems as repeatedly explained to you, ad nauseum.

    Please explain to me the “accepted definitions of base four systems”.

    Here is one from wiki:

    In mathematical numeral systems, the base or radix for the simplest case is the number of unique digits, including zero, that a positional numeral system uses to represent numbers. For example, for the decimal system (the most common system in use today) the radix is ten, because it uses the ten digits from 0 through 9.</blockquote

    DNA is not a positional numeral system.

    Please let me have a definition for "base 4 digital" that refers to systems other than positional numeral systems, or, alternatively, define "position" for me in the context of a DNA base pair, with reference to the examples I gave in 1.2.2.2.2.

    Charles:

    If you think your view is correct, then truely you should present it in a paper at a symposium. Perhaps those attendess will explain it to you further in terms you’ll find less rude.

    I doubt if any symposium would accept a paper that made the perfectly obvious point that a system based on strings made up of permutations of four discrete units, and varied by deletion, insertion, duplication and substitution, is not a “base 4 digital” system.

    Especially when it has no bearing on anything other than what appears to be a desire to use computer terminology when talking about living things. Even though computer terminology is perfectly valid for living things, if used in a way that actually makes sense.

  39. F/N: Cams (and I believe Yale locks), of course are actually ANALOGUE.

  40. Simply incredible Ms. Liddle, instead of clearly seeing that a base 4 DNA based computer greatly exceeds our best base 2 silicon based ‘super-computers’ you act as if you are being reasonable. Simply completely unbelievable!!! No arrogance in all that denial is there???

    here are more notes for you to ignore Ms. Liddle:

    Biophysicist Hubert Yockey determined that natural selection would have to explore 1.40 x 10^70 different genetic codes to discover the optimal universal genetic code that is found in nature. The maximum amount of time available for it to originate is 6.3 x 10^15 seconds. Natural selection would have to evaluate roughly 10^55 codes per second to find the one that is optimal. Put simply, natural selection lacks the time necessary to find the optimal universal genetic code we find in nature. (Fazale Rana, -The Cell’s Design – 2008 – page 177)

    Deciphering Design in the Genetic Code
    Excerpt: When researchers calculated the error-minimization capacity of one million randomly generated genetic codes, they discovered that the error-minimization values formed a distribution where the naturally occurring genetic code’s capacity occurred outside the distribution. Researchers estimate the existence of 10 possible genetic codes possessing the same type and degree of redundancy as the universal genetic code. All of these codes fall within the error-minimization distribution. This finding means that of the 10 possible genetic codes, few, if any, have an error-minimization capacity that approaches the code found (semi) universally in nature.
    http://www.reasons.org/biology.....netic-code

    Ode to the Code – Brian Hayes
    The few variant codes known in protozoa and organelles are thought to be offshoots of the standard code, but there is no evidence that the changes to the codon table offer any adaptive advantage. In fact, Freeland, Knight, Landweber and Hurst found that the variants are inferior or at best equal to the standard code. It seems hard to account for these facts without retreating at least part of the way back to the frozen-accident theory, conceding that the code was subject to change only in a former age of miracles, which we’ll never see again in the modern world.
    https://www.americanscientist.org/issues/pub/ode-to-the-code/4

    Evolutionists have long argued that the optimal genetic code is universal for all lifeforms, and maintain that that fact is strong evidence for evolution from a universal common anscestor, yet it appears they were wrong once again:

    Venter vs. Dawkins on the Tree of Life – and Another Dawkins Whopper – March 2011
    Excerpt:,,, But first, let’s look at the reason Dawkins gives for why the code must be universal:
    “The reason is interesting. Any mutation in the genetic code itself (as opposed to mutations in the genes that it encodes) would have an instantly catastrophic effect, not just in one place but throughout the whole organism. If any word in the 64-word dictionary changed its meaning, so that it came to specify a different amino acid, just about every protein in the body would instantaneously change, probably in many places along its length. Unlike an ordinary mutation…this would spell disaster.” (2009, p. 409-10)
    OK. Keep Dawkins’ claim of universality in mind, along with his argument for why the code must be universal, and then go here (linked site listing 23 variants of the genetic code).
    Simple counting question: does “one or two” equal 23? That’s the number of known variant genetic codes compiled by the National Center for Biotechnology Information. By any measure, Dawkins is off by an order of magnitude, times a factor of two.
    http://www.evolutionnews.org/2.....44681.html

    As well, besides the optimality found for the DNA code, there is a ‘optimality’ found for the 20 amino acid set used in the ‘standard’ Genetic code when the set was compared to 1 million randomly generated alternative amino acid sets;

    Does Life Use a Non-Random Set of Amino Acids? – Jonathan M. – April 2011
    Excerpt: The authors compared the coverage of the standard alphabet of 20 amino acids for size, charge, and hydrophobicity with equivalent values calculated for a sample of 1 million alternative sets (each also comprising 20 members) drawn randomly from the pool of 50 plausible prebiotic candidates. The results? The authors noted that: “…the standard alphabet exhibits better coverage (i.e., greater breadth and greater evenness) than any random set for each of size, charge, and hydrophobicity, and for all combinations thereof.”
    http://www.evolutionnews.org/2.....45661.html

    Moreover the first ‘optimal’ DNA code of life on earth had to be at least as complex as the current DNA code found in life or mathematical impossibilities arise:

    Shannon Information – Channel Capacity – Perry Marshall – video
    http://www.metacafe.com/watch/5457552/

    “Because of Shannon channel capacity that previous (first) codon alphabet had to be at least as complex as the current codon alphabet (DNA code), otherwise transferring the information from the simpler alphabet into the current alphabet would have been mathematically impossible”
    Donald E. Johnson – Bioinformatics: The Information in Life

    DNA – The Genetic Code – Optimal Error Minimization & Parallel Codes – Dr. Fazale Rana – video
    http://www.metacafe.com/watch/4491422

    Nick Lane Takes on the Origin of Life and DNA – Jonathan McLatchie – July 2010
    Excerpt: It appears then, that the genetic code has been put together in view of minimizing not just the occurence of amino acid substitution mutations, but also the detrimental effects that would result when amino acid substitution mutations do occur.
    http://www.evolutionnews.org/2.....36101.html

    Though the DNA code is found to be optimal from a error minimization standpoint, it is also now found that the fidelity of the genetic code, of how a specific amino acid is spelled, is far greater than had at first been thought:

    Synonymous Codons: Another Gene Expression Regulation Mechanism – September 2010
    Excerpt: There are 64 possible triplet codons in the DNA code, but only 20 amino acids they produce. As one can see, some amino acids can be coded by up to six “synonyms” of triplet codons: e.g., the codes AGA, AGG, CGA, CGC, CGG, and CGU will all yield arginine when translated by the ribosome. If the same amino acid results, what difference could the synonymous codons make? The researchers found that alternate spellings might affect the timing of translation in the ribosome tunnel, and slight delays could influence how the polypeptide begins its folding. This, in turn, might affect what chemical tags get put onto the polypeptide in the post-translational process. In the case of actin, the protein that forms transport highways for muscle and other things, the researchers found that synonymous codons produced very different functional roles for the “isoform” proteins that resulted in non-muscle cells,,, In their conclusion, they repeated, “Whatever the exact mechanism, the discovery of Zhang et al. that synonymous codon changes can so profoundly change the role of a protein adds a new level of complexity to how we interpret the genetic code.”,,,
    http://www.creationsafaris.com.....#20100919a

    further notes:

    The coding system used for living beings is optimal from an engineering standpoint.
    Werner Gitt – In The Beginning Was Information – p. 95

    Collective evolution and the genetic code – 2006:
    Excerpt: The genetic code could well be optimized to a greater extent than anything else in biology and yet is generally regarded as the biological element least capable of evolving.
    http://www.pnas.org/content/103/28/10696.full

    Here, we show that the universal genetic code can efficiently carry arbitrary parallel codes much better than the vast majority of other possible genetic codes…. the present findings support the view that protein-coding regions can carry abundant parallel codes.

    The data compression of some stretches of human DNA is estimated to be up to 12 codes thick (12 different ways of DNA transcription) (Trifonov, 1989). (This is well beyond the complexity of any computer code ever written by man). John Sanford – Genetic Entropy

    “In the last ten years, at least 20 different natural information codes were discovered in life, each operating to arbitrary conventions (not determined by law or physicality). Examples include protein address codes [Ber08B], acetylation codes [Kni06], RNA codes [Fai07], metabolic codes [Bru07], cytoskeleton codes [Gim08], histone codes [Jen01], and alternative splicing codes [Bar10].
    Donald E. Johnson – Programming of Life – pg.51 – 2010

    DNA Caught Rock ‘N Rollin’: On Rare Occasions DNA Dances Itself Into a Different Shape – January 2011
    Excerpt: Because critical interactions between DNA and proteins are thought to be directed by both the sequence of bases and the flexing of the molecule, these excited states represent a whole new level of information contained in the genetic code,

    Ends and Means: More on Meyer and Nelson in BIO-Complexity – September 2011
    Excerpt: According to Garrett and Grisham’s Biochemistry, the aminoacyl tRNA snythetase is a “second genetic code” because it must discriminate among each of the twenty amino acids and then call out the proper tRNA for that amino acid: “Although the primary genetic code is key to understanding the central dogma of molecular biology on how DNA encodes proteins, the second genetic code is just as crucial to the fidelity of information transfer.”

  41. Joseph

    All we know about the designers of Stonehenge we got from studying the evidence left behind.

    Er…no. We already had considerable knowledge of human capabilities, evidence of local human habitation, previous examples of human stone monument building, etc. that all helped determine Stonehenge was made by humans.

    But thanks for your usual blithering fact-free inputs.

  42. Dunsinane, thank you for your cool responses :) Things are getting a little steamy in here, and I appreciate your objective tone :)

    There are 4 possible values TCAG, therefore N=4.
    Given a word of length 3, position 1 can contain T, C, A, or G, position 2 can contain T, C, A, or G, position 3 can contain T, C, A, or G.

    What am I missing here? Do you think because the way the “memory” works is different that that means it’s not base 4?

    All you are “missing” is the fact that we are not “given a word length 3″. What we have are long sequences of variable length, but similar “meaning” (e.g. produce comparable proteins). Comparing variants, then, “place” has no meaning. If you insert or delete a multiple of three bases, you radically change the “place” of the basepairs either side of the change, but they retain the same “meaning” in terms of their amino acids. To give an example: these three alphabetic sentences all mean roughly the same thing:

    I am very happy to hear your exciting news.
    I am very happy to hear your news.
    I am very very happy to hear your exciting news.

    even though, in the second, the value of every “position” after the word “your” is radically altered, and in the third, after the first “very”. Contrast this with three digital items:

    100110001
    10011001
    1001110001

    In text, the “meaning” of a letter sequence depends on the order of the letters, regardless of their “place” or “position” relative to some absolute location, whereas in a digital system, the meaning depends on the state of a given “place” or position. There is simply no equivalent to “place value” in text, so there is nothing that can “take one of 27 states”, nor is there in DNA. Both are sequence systems not positional systems, and when DNA varies, there is no “position” to change state, but plenty of “sequence” to change order.

    Not that it makes the slightest difference to ID either way!

  43. Elizabeth Liddle:

    A “string of digits” is a string. The elements of a string are not digits (though they may be alphanumeric).

    Wrong. Each element of a string is a “digit” where its value is any of the possible states allowed by the system upon which the string is built. In the case of binary systems that is any of two states “up down”, “on off” “0 1″; in trinary systems “up flat down”, “0 1 2″; and similary adenine uracil guanine and cytosine are the four allowed “states” of an RNA “digit”

    DNA is not a positional numeral system.

    As I already stipulated, but you knew that and yet blew right past it.

    Please let me have a definition for “base 4 digital” that refers to systems other than positional numeral systems, or, alternatively, define “position” for me in the context of a DNA base pair, with reference to the examples I gave in 1.2.2.2.2.

    Again I already explained that but either in intransigence or inexperience you blew right past that too.

    I doubt if any symposium would accept a paper that made the perfectly obvious point that a system based on strings made up of permutations of four discrete units, and varied by deletion, insertion, duplication and substitution, is not a “base 4 digital” system.

    I too doubt your paper would be accepted, because you would be confronted with refutations from reviewers of your premises and novel conceptual conflations.

  44. F/N: Cams (and I believe Yale locks), of course are actually ANALOGUE.

    In what sense – that ‘locked’ and ‘unlocked’ are not discrete states but exist on a continuum of effectively infinite resolution, or that setting the lock into one of two discrete states requires the operation of a mechanical system?

    Logic gates are analogue – they consist of very high gain amplifiers with hysteresis. Does that make all computers analogue?

  45. Thanks William J Murray, at least I can take comfort in the fact that you have read it and have understood.

  46. Dr Liddle:

    Perhaps, it has not been recognised by you that once the alphabet is discrete state, it is perforce digital?

    No, it has not been recognised by me, kf, because it is not true. “Discrete” does not mean the same as “digital”. Letters as used in words are discrete, that does not mean they are digital.

    You appear to have a fixed confusion about what defines a digital system.

    Well, my view is that the “fixed confusion” is on your side, kf. :)

    I am therefore simply pointing out (again) that it is discrete stateness that defines a digital system, and that the system of alphabetic spelling — a digital conversion of speech BTW — is such that words carry the string data structure *-*-*-*- . . ., where the *’s denote valid positions. The symbol *, takes values from the set A, B, C . . . (with extensions) and between any two neighbouring letters such as A and B there is no third valid letter-value.

    Well, obviously if you define any system with discrete parts as “digital” then, yes. But then why single out DNA? Any molecule is “digital” by that definition, because it is composed of “discrete” parts. And quantum physics tells us that the whole world is “digital” because is is quantized. If you define “digital” simply to mean “discrete” then you lose all meaning from the term, and it still doesn’t allow you describe it as being in “base 4″ because however you idiosyncratically you define “digital”, “base 4″ is a description of a positional numeric system, which DNA is not. It’s neither numeric (as Charles says, no one base has a higher or lower “value” than any other) nor positional (it’s not the absolute position that determines the “meaning” of a base, but its place in a sequence).

    Insistence on such a basic error as though force of will and novel terms like “graphemes,” can change the basic definition and why it is made (the key distinction is that we have a fundamental PHYSICAL and conceptual contrast: discrete/continuous . . . ), does your position no good.

    “Grapheme” is not a “novel term” kf. And using it doesn’t alter the fact that in normal English usage “discrete” and “digital” are not synonyms.

    When we convert one digital thing to another, we can do so without data loss, but for continuous state — analogue — systems, we have to accept a certain level of error, throwing away things beyond a certain precision.

    But once we accept that conversion error, we can then take steps to essentially eliminate further noise, within limits. (Notice how digital TV is usually very good, then beyond a certain limit utterly broken up into horrible distortions?)

    Yes, indeed, kf, but that is entirely off point, as at no time have a suggested that DNA is a analog system. But there are more kinds of systems in heaven and earth Horatio than analog and digital systems. One of them is alphabetic.

    And, yes, I am entirely correct to speak of “values,” as the old RION set of scales reminds us: ratio, interval, ordinal, NOMINAL.

    And letters are nominal. Because they don’t have [quantitative] values. That’s why they are called “nominal” from the Latin for “name”, not “numerical” from the Latin for “number”.

    This inherent digitalness is why the alphabetic system was so easily represented in the old 5-bit Baudot code, then onward to 7/8-bit ASCII [and EBCDIC etc]and now 16-bit Unicode.

    Sure, but that doesn’t make it a digital system, just because it can be rendered on one. Recall: I do not dispute that alphabetical letters are discrete. Indeed they are a way of rendering discrete the continuous sounds we utter as speech. But they are not “digital” in any normal sense of the word, and certainly not in a “base”.

    Building on this, I have always been struck by the very direct comparison of 8-bit punched paper tape and how mRNA works in the ribosome. Of course the tape used punched holes, vs non punched, but that is of no great consequence. I have similarly highlighted how Braille used a 6-bit raised dot code, and how von Neumann’s original description of the self replicator, used bars of differing height to encode information. (For that matter, Yale type keys do much the same and bars of cams are again similar.)

    Sure, but none of that makes it “digital” in the sense of being a “base N” system. Some cam systems are analog and some digital (music boxes for instance). Some systems in the cell act like cams. Doesn’t make them Base N digital. Though at least one system arguably is, IMO, i.e. the regulatory network.

    DNA, again, uses a 4-state per digit string data structure. Alphabetic writing, uses a 26 state [or extended to 128 or more depending] system.

    Well, no. Not unless you define “digital” as “discrete”, and even then you don’t get to call it “base N” unless your code depends on changing the state of some position. If your code depends on changing the sequence of symbols then it could still be a discrete system, but it isn’t a digital base N system.

    Maybe, the key thing is to note that digital is not to be equated to binary digital, which happens to be a very convenient base to use in technology.

    No indeed. But nor is it, IMO, to be equated to “discrete” without serious loss of meaning.

    And “Base N” does not mean “a code that uses N different symbols”.

    But if it makes you happy I am happy to stipulate that DNA is a code that uses permutations of 4 discrete entities.

    Now, will you place take back the implication that I am rejecting the notion that DNA is a “base 4 digital” system because I fear the ID implications?

  47. Dr Liddle:

    Pardon, but the projection of a nefarious motive is out of order.

    Let’s just say that any of my students over the many years who insisted on refusing to accept that a discrete state system is perforce a digital one would have demonstrated that s/he was unteachable.

    Such a student would be unable to understand an A/D converter or a D/A converter and why we use a low pass filter for the latter.

    Among many other problems.

    A better explanation, it seems, frankly, is that for whatever reason, some objectors tot he design inference, are refusing to acknowledge the discrete state thus digital nature of the information stored in DNA and processed using inter alia mRNA and ribosomes, because they would find it harder to make some of their preferred objections.

    Do you not see that if the key-lock DNA worked like a cam bar instead [i.e. was continuous state], that analogue info storage and processing would be info storage and processing, and it would be a simple matter of identifying the bit depth of the equivalent digital info, for analytical purposes?

    Indeed, have you not understood why it is that I compare Mt Rushmore and Old Man of the Mountain, Nefertiti and a wire-mesh of a dolphin? The analogue info in the facial portraits, is reducible to a nodes and arcs data structure, which can then be digitised to whatever degree of precision is required to process with adequate fidelity.

    In short, the issue analogue/digital is NOT a critical one to the question of inferring design. It is a simple matter of a key scientific value: being reasonable, well warranted and accurate in using concepts to analyse phenomena.

    DNA uses a string-structure, 4-stste digital storage system, which is processed step by step in ribosomes to make proteins, i.e is algorithmic.

    That is accurate description not crude or loose analogy.

    That this would be a sticking point, is telling on the balance of the case on the merits.

    And, if it is not clear to you by now that I despise rhetorical stratagems that try to manipulate by playing on misconceptions, perceptions and feelings, instead of taking on issues of fact, concept, assumptions/ premises and logic, with epistemology hovering in the background [even to the fault of being challengingly complex], something is wrong.

    If you need it, here is my view as I picked up for myself and then learned was in Aristotle: arguments persuade by appeal to fact and logic, to authority, or to emotions. Of these the LEAST persuasive, short term, is the only one that actually can warrant: facts and logic.

    But, long term this is the one that is decisive.

    Guess why I insist on going for facts and logic, and will point out the distractive, strawman distortion and ad hominem tactics that so often are used to object to design theory and thinkers.

    No prizes for guessing why.

    GEM of TKI

  48. I think I get the idea now. If we imagine a DNA “variable”, the basic operators we can use on an integer (+, -, /, *, less then, greater than etc.) wouldn’t apply, neither would bitwise operators (|, &). The operations on the variable would be like operations on an array. That is an important point, but it doesn’t mean it’s not base 4. It just means we can’t use arithmetic.

  49. 49

    No, that is not true. It’s impossible to recognize conscious design without at least some external knowledge of the designer – its capabilities, the material resources it has available, knowledge of other designs it has done.

    I challenge you to respond to the following: If we find what appears to be to some an ancient, abandoned alien space ship on an otherwise deserted and desolate planet, how would one go about establishing, as best explanation, that the object in question was probably designed and built by an intelligent alien species? Or are we committed by the definition of science to just keep tyring to find a natural explanation for the object?

    ID makes the unwarranted assumption that all design must be like human design,

    No, it doesn’t; it rightfully limits its potential recognition of designed artifacts to those that are similar enough to human design parameters to be rigorously quantified as designed. Design theorists do not claim that that ID metrics can identify all artifacts of ID, only those that fall within the metric.

    then attempts to match unknown items to known human-produced forms with a subjective superficial examination (“Looks designed to me!). This includes coming up with meaningless metrics for measuring complexity, like dFSCI.

    Then please tell us how we can make a determination that the object in my example is best explained as being the artifact of some as-yet unknown alien intelligence?

    Logically there is no difference between “that fluffy cloud looks like a choo-choo train, so it must be designed!” and “that flagella looks like an outboard motor, so it must be designed!”

    Then, in your opinion, if we happen upon what appears to some to be an ancient alien artifact on some desolate world, there’s simply no way to attempt to explain it except as naturally occurring artifacts?

    Unless you are going to claim that human ID is supernatural or unique, there is no scientific difference in examining the effects of vulcanism or erosion on Earth, and then matching those characteristic features with features on other planets and theorizing that non-terrestrial vulcanism and erosion might be responsible for those featurs, and finding the telltale characteristics of human intelligent design and then using that category of characteristics to identify potential cases of non-human ID.

  50. Elizabeth Liddle:

    A “string of digits” is a string. The elements of a string are not digits (though they may be alphanumeric).

    Wrong. Each element of a string is a “digit” where its value is any of the possible states allowed by the system upon which the string is built. In the case of binary systems that is any of two states “up down”, “on off” “0 1?; in trinary systems “up flat down”, “0 1 2?; and similary adenine uracil guanine and cytosine are the four allowed “states” of an RNA “digit”

    Please define the “RNA ‘digit’” that can take “four allowed ‘states’”?

    Adenine can’t take the state of “guanine”, can it? So what is this mysterious “RNA ‘digit’” that can take “four allowed ‘states’”?

    It is because there is no coherent answer to that question that DNA/RNA is not a “digital” system. In a digital system there are a finite number positions that are always in one state or another. There are is no such finite set of “positions” in a polynucleotide, because sequences are not altered by changing the “state” of positions” (except in the case of single nucleotide substitutions) but by insertion, deletion, duplication – oh, and recombination – all of which move the “positions” around. In other words “position” is an irrelevant concept, and thus there is no “position” that can take one of “four allowed states”.

    DNA is not a positional numeral system.

    As I already stipulated, but you knew that and yet blew right past it.

    Yes, you appeared to stipulate it! Which makes your position all the more bizarre. If you agree that DNA is not a positional numeral system, then in what sense is it in “digital base 4″?

    Please let me have a definition for “base 4 digital” that refers to systems other than positional numeral systems, or, alternatively, define “position” for me in the context of a DNA base pair, with reference to the examples I gave in 1.2.2.2.2.

    Again I already explained that but either in intransigence or inexperience you blew right past that too.

    Um, no you didn’t. And it’s absolutely critical. If you want to claim that a system is in “base 4 digital” then please provide a definition of “base 4 digital” that doesn’t refer to a positional numeral system. If it’s your own personal definition, that’s fine, but then don’t come on at me for “dishonesty”. I’m using something that at least finds support in wiki. Where is yours?

    I doubt if any symposium would accept a paper that made the perfectly obvious point that a system based on strings made up of permutations of four discrete units, and varied by deletion, insertion, duplication and substitution, is not a “base 4 digital” system.

    I too doubt your paper would be accepted, because you would be confronted with refutations from reviewers of your premises and novel conceptual conflations.

    Please provide your definition (with references) of “base 4 digital” or retract your allegations that mine is “novel”.

  51. Dr Bot:

    You have some fairly serious explaining to do on another thread.

    Be that as it may, I will note here that electronic logic gates generally speaking — let’s leave off Emitter Coupled Logic, a special case formerly used to get out of problems of saturation and cutoff to gain speed — are amps run between cutoff and saturation, usually with defined thresholds for high and low. The defined ststes and trheholds are what make them digital, for info processing purposes.

    Those of us who have had to deal with designs, often know that analogue problems can bleed over into the systems. let’s just say that I once had a ckt that insisted that a Ceramic disk capacitor could not do power supply glitch decoupling, only Silvered Mica — about 100 times as expensive — would do.

    Well, it was a one off situation, and I saved time; which was more valuable. A USD 2.00 Silvered mica got soldered in. Never mind the sack of 1,000 otherwise perfectly good Cer disks sitting next to me that came in at about 1 c each.

    Electronic logic systems are BOTH analogue and digital, with the Analogue usually being responsible for the subtler design headaches.

    Cam bars use smooth follower mechanisms, and Yale locks seem to use essentially infinitely variable 2-part, spring-loaded pins along a cylinder to line up a shear line. That’s a threshold, but the way you get there is at least potentially infinitely variable, though I suspect a lot of locks get built by having three pin positions for the key’s teeth: high, mid and low.

    (DNA is similar, but uses a length-match between the two different pairs of bases, the chemical structure essentially defining a 4-state discrete state per digit string structure.)

    GEM of TKI

  52. Dr Liddle:

    Pardon, but you are dancing wrong but strong.

    By pretty direct inspection, we can easily see that DNA is a string structure, using the Sugar-phosphate backbone. In each position, A, G, C, or T/U (for RNA) can fit. Each of these matches to its partner monomer base in a tRNA anticodon or the complementary DNA strand, etc.

    4-states per place or digit, discrete state so digital. And that is why it is commonplace to talk about the DNA or Genetic CODE.

    GEM of TKI

  53. GinoB,

    We did not know humans designed and built it until we studied what was left behind. And even then we knew they were capable of bulding Stonehenge because, ummm, Stonehenge exists.

    If Stonehenge didn’t exist we wouldn’t infer the people of that age had those capabilities- the capabilities to build such a structure. It is as simple as you are.

    BTW there aren’t any previous stone structures like Stonehenge- so your “reference” is misleading at best.

    The point is an always has been that in the absence of direct observation or designer input, the only possible way to make any determination about the designer(s) or the specific process(es), is by studying the design in question.

    Saying “humans didit” is as “useless” as saying some unknown agency did it- at least we know an agency did it and we go from there.

    So we know what the capabilities of the designer(s) and builders were because they left stuff behind for us to examine.

    It is just unbelievable that you don’t understand that.


  54. All we know about the designers of Stonehenge we got from studying the evidence left behind.

    Er…no. We already had considerable knowledge of human capabilities, evidence of local human habitation, previous examples of human stone monument building, etc. that all helped determine Stonehenge was made by humans.

    You just confirmed what I said…

  55. And BTW designing agencies, successsful designing agencies anyway, usually do have the capability to design what it is they are designing.

  56. Dunsinane:

    I think I get the idea now. If we imagine a DNA “variable”, the basic operators we can use on an integer (+, -, /, *, less then, greater than etc.) wouldn’t apply, neither would bitwise operators (|, &). The operations on the variable would be like operations on an array. That is an important point, but it doesn’t mean it’s not base 4. It just means we can’t use arithmetic.

    OK, thanks. Well, I guess it all comes down to how we define “base N” systems then :)

    It’s certainly a 4 element system. I just don’t see a radix there, so I think describing it as “base 4 digital” is misleading, and certainly building any kind of case on it being “base 4 digital” is building it on sand IMO.

    But I’ll wait and see of Charles (or someone) can come up with a reasonably widely recognised definition of “base N digital” that covers DNA ;)

    The ones I’m familiar with don’t.

  57. Dr Liddle:

    Pardon, but you are dancing wrong but strong.

    By pretty direct inspection, we can easily see that DNA is a string structure, using the Sugar-phosphate backbone. In each position, A, G, C, or T/U (for RNA) can fit. Each of these matches to its partner monomer base in a tRNA anticodon or the complementary DNA strand, etc.

    4-states per place or digit, discrete state so digital. And that is why it is commonplace to talk about the DNA or Genetic CODE.

    GEM of TKI

    In other words you are saying that “discrete” and “digital” are synonyms.

    They aren’t, in normal English usage. But if we accept your idiosyncratic usage, then sure, if by “digital” you mean “discrete” then DNA, like any molecule, is “digital”.

    And if by “base 4″ you mean that “four different elements are permuted in the sequence” then, sure, it’s “base 4 digital”.

    In other words, if you redefine both “digital” and “base N” to mean something other than what they normally mean, your claim can be correct. But it remains highly misleading because what most people mean by “base 4 digital” is a positional numeric system, which DNA isn’t, or some kind of discrete state-changing system, which it is at gene level (binary), but not at base-pair level.

    And are you going to take back your implication that my position on this an attempt to deny that cells are “digital” because I fear the ID implications?

    Because I’ve made this request several times now. It is completely irrelevant to whether you think I am wrong about base 4 or not.

  58. kairosfocus:

    the chemical structure essentially defining a 4-state discrete state per digit string structure.

    Per what?

    This is the problem! There isn’t anything to put in that place! Nothing “changes state” so nothing can take “one of four states”. And unless something can take “one of four states” you don’t have a “base 4 digital” system!!!

    That’s why you and Charles are having difficulty in articulating what it is that changes state!

  59. Elizabeth Liddle:

    Please define the “RNA ‘digit’” that can take “four allowed ‘states’”?

    My exact words were:

    where its value is any of the possible states allowed by the system upon which the string is built. … and similary adenine uracil guanine and cytosine are the four allowed “states” of an RNA “digit”

    “possibly allowed” does equate to having “take[n][all] “four states”. Not all permutations exist. But the absence of some permutations does not change the fact that each permutation consists of not more than four possible states.

    But the answer you need is the “RNA ‘digit’” which can take [one of the] “four allowed ‘states’” would be one half of a base-pair. Each RNA “digit” is paired with another RNA “digit” to form a base-pair and base-pairs are strung together in strands, strands strung together in kilobase pairs,… etc.

    Um, no you didn’t. And it’s absolutely critical.

    Yes I did. And it’s absolutely critical that you stop ignoring the answers you’ve been given. That is intellectual dishonesty. If you don’t understand, then ask. But stop presuming you know what you’re bloviating about. You don’t.

    If you want to claim that a system is in “base 4 digital” then please provide a definition of “base 4 digital” that doesn’t refer to a positional numeral system.

    Data processing systems employ logical operators (AND, OR, XOR, Compare, shift, copy, etc.) as well as mathematical. A base-four system merely does this with strings wherein each element (bit or digit) is in 1 of 4 possible states. That in RNA, strings are not found reflecting all possible permutations in no way changes the irrefutable fact that any position will never have anything other than either adenine uracil guanine or cytosine; regardless of the operation, the allowed values of each position will always be adenine uracil guanine or cytosine.

    The example I gave, which in your inexperience you twice now have failed to comprehend is content addressable memory. Present memory architectures mostly use two-state address-selected memory with many special applications that use content addressable instead. These same operations have been repeated in tri-state systems. To my knowledge, no one has attempted a 4-state processing system because there are no 4-state devices and regardless the practical limitations on adoption preclude any benefit.

    But as I mentioned, the operation by which strings of base-pairs are somehow compared and matched, taking note of markers denoting coding vs non-coding regions is essentially a 4-state content-addressing mechanism: The content is found and its address (endpoints) is subsequently used for “unzipping” and encoding (or not).

    I’m using something that at least finds support in wiki. Where is yours?

    You could interpolate from the same article. It lists commonly used numeral systems and gives examples of base-8 and base-16, albeit the implementations are all on binary base-2 machines. But a base-4 numeral system would have values “0, 1, 2, 3″ as its four allowed states. A base-4 RNA system has adenine uracil guanine or cytosine as its four allowed states. But again, as RNA is not a machine which employes math and all abstract permutations of numbers, as RNA employs logical operators similar to comparison and XOR and is not an abstract system, you should not expect to find all permutations of adenine uracil guanine or cytosine.

    Just because you found the subject matter you sought doesn’t equate to having sought the applicable subject matter.

    kairosfocus has already, ad nauseum, provided you with cites defining four-state systems.

  60. Dr Liddle:

    That digital MEANS discrete state is by no means idiosyncratic. As even so humble a source as Wikipedia will verify, it is the standard technical usage, for reasons as already identified.

    And it seems I need to make a point clear: a 4- discrete- state per- digit string- structure.

    Digital string systems do not always change states, indeed ROM (read only memory) is set up precisely NOT to change state but as reference information pre-loaded into the system, and that is what DNA is.

    All the peculiarities that you may look at are things that make DNA a particular kind of digital entity, they do not affect the basic empirical fact that it is a discrete-state (thus, digital) info-storing entity. Just as, had it been more like a cam, it would have been an analogue info storing entity.

    GEM of TKI

  61. 1.2.2.2.34

    Elizabeth,

    That DNA is a code constitutes a scientific fact.

    1. DNA carries instructions, consequently information.
    2. This information can be represented by strings composed using an alphabet that consists of 4 letters.

    Not all strings defined on the 4-letter alphabet have an associated biological meaning. Similarly, not all strings of some given length using letters of the English or any other alphabet, have meaning. Nonetheless, the above considerations allow the scientific community to agree that DNA is a code. To dispute that seems really strange.

  62. Elizabeth Liddle:

    But it remains highly misleading because what most people mean by “base 4 digital” is a positional numeric system,

    That would be most people who have neither built machines from 2-state or 3-state devices, nor implemented logical operations as opposed to merely numeric, but have authored highly misleading wiki articles for people who can’t tell the difference.

  63. Dr Bot:

    You have some fairly serious explaining to do on another thread.

    No I don’t. But I believe you do. I’m getting a bit fed up of the way you preach at and bully others simply because they disagree with you – and quite often people who have considerably more expertise than you.

    As for digital logic – it is quite clear that you failed to understand my point. The more I see your posts, riddled with grand claims backed up by no evidence and followed up by bullying attacks on others, the more I am inclined to think … Dunning Kruger.

    Please put a sock in your uncivilized behavior and try treating others as you expect to be treated. (Except of course you seem to expect others to treat you as an infallible source of knowledge and truth, which is a bit of a problem considering you are so often wrong)

  64. Dr Liddle:

    Pardon, but the projection of a nefarious motive is out of order.

    Thank you for clarifying that you do not consider the point of view that DNA is not in “base 4 digital” as being an attempt to deny that cells contain the “dfCSI” and therefore “signature of design”. As I have made it very clear, I think that in many ways cells do behave like digital systems, and in that sense contain “digital functional complex specified information”. I just don’t think that intentional design is the only explanation for such a system.

    Let’s just say that any of my students over the many years who insisted on refusing to accept that a discrete state system is perforce a digital one would have demonstrated that s/he was unteachable.

    So are you really insisting that “digital” and “discrete” are synonyms? And has it never occurred to you that when you meet a student who does not agree with you that rather than the student being “unteachable”, it might be you?

    Seriously kf, if you go through life, as you seem to do, assuming that anyone who disagrees with you has simply not understood what you are trying to say, or worse, culpably resists “correction”, you are doing yourself a disservice. If we cannot learn from our students we have no business teaching.

    Such a student would be unable to understand an A/D converter or a D/A converter and why we use a low pass filter for the latter.

    Among many other problems.

    Not at all. You are making a classic logical error:

    All cats have tails.
    This animal has a tail
    Therefore this animal is a cat.

    All digital systems are discrete.
    This system is discrete.
    Therefore this system is digital.

    And, in case you are not aware of it, I do a fair bit of signal processing myself. In fact, I had to go and sort out an analog-digital converter box 20 minutes ago.

    A better explanation, it seems, frankly, is that for whatever reason, some objectors tot he design inference, are refusing to acknowledge the discrete state thus digital nature of the information stored in DNA and processed using inter alia mRNA and ribosomes, because they would find it harder to make some of their preferred objections.

    And there you go again!!! Nobody at all, to my knowledge, has ever denied that polynucleotides consists of discrete nucleotides. Or that they contain information. So you have yet another straw man there, kf, and are soaking it in ad hom: we do not “refuse to acknowledge” that the information in DNA/RNA is digital “because [we] would find it harder to make some of [our] preferred objections”, we refuse to do so because discrete is not a synonym for digital and polynucleotides are not in “base 4″ in any definition of “base 4″ that I for one am aware of. Except that there are “four kinds of base pairs” but that would be to equivocate painfully with the word “base”.

    Do you not see that if the key-lock DNA worked like a cam bar instead [i.e. was continuous state], that analogue info storage and processing would be info storage and processing, and it would be a simple matter of identifying the bit depth of the equivalent digital info, for analytical purposes?

    Pretty well any information can be digitized, kf, so of course. But my point is not that DNA is not discrete, but that it isn’t digital. You seem to think those words mean the same thing.

    Indeed, have you not understood why it is that I compare Mt Rushmore and Old Man of the Mountain, Nefertiti and a wire-mesh of a dolphin? The analogue info in the facial portraits, is reducible to a nodes and arcs data structure, which can then be digitised to whatever degree of precision is required to process with adequate fidelity.

    Just because information can be digitised doesn’t mean it is digital information.

    In short, the issue analogue/digital is NOT a critical one to the question of inferring design. It is a simple matter of a key scientific value: being reasonable, well warranted and accurate in using concepts to analyse phenomena.

    No, it’s completely irrelevant, because, as I keep saying, I am not claiming that polynucleotide information is not discrete. It obviously is. I’m saying it’s not digital, and not in base 4.

    DNA uses a string-structure, 4-stste digital storage system, which is processed step by step in ribosomes to make proteins, i.e is algorithmic.

    That is accurate description not crude or loose analogy.

    That this would be a sticking point, is telling on the balance of the case on the merits.

    Yes, it’s algorithmic. It’s just not base 4 digital. Actually, in some ways it’s cam-like, but, as DrBot says, that doesn’t mean it’s not discrete.

    And, if it is not clear to you by now that I despise rhetorical stratagems that try to manipulate by playing on misconceptions, perceptions and feelings, instead of taking on issues of fact, concept, assumptions/ premises and logic, with epistemology hovering in the background [even to the fault of being challengingly complex], something is wrong.

    No, it isn’t clear to me that you “despise rhetorical stratagems that try to manipulate by playing on misconceptions, perceptions and feelings”, kairosfocus. To be perfectly honest, I’d say you indulge in such strategems regularly, as in your recent spate of “BLOOD LIBEL!” posts. I think you operate a marked double standard, whereby you feel free to attribute all kinds of dishonest motivations to those who disagree with you, but react in horrified indignation if you perceive (often erroneously, IMO) a slur cast on you yourself, as in the case of Dawkins and Craig. There was no “blood libel” – Dawkins made the perfectly straightforward point that Craig regarded genocide as not evil if commanded by God. Ergo, Craig was condoning genocide, albeit in specific circumstances (although setting a dangerous precedent – didn’t the 9/11 hijackers think that they were obeying God’s commands?). He did not accuse all Christians of condoning genocide, and your response, was, IMO, a “rhetorical stratagem… that tr[ied] to manipulate by playing on misconceptions, perceptions and feelings”. So no, it is not clear to me that you despise such “stratagems”, merely that you despise those who, in your view, use them against yourself. Which, most of the time, IMO, they are not doing.

    If you need it, here is my view as I picked up for myself and then learned was in Aristotle: arguments persuade by appeal to fact and logic, to authority, or to emotions. Of these the LEAST persuasive, short term, is the only one that actually can warrant: facts and logic.

    But, long term this is the one that is decisive.

    Guess why I insist on going for facts and logic, and will point out the distractive, strawman distortion and ad hominem tactics that so often are used to object to design theory and thinkers.

    No prizes for guessing why.

    GEM of TKI

    Except that your diagnostic capacity is unreliable, kf. You have made a logical error here. While all digital systems are discrete, not all discrete systems are digital. In DNA, there is nothing that “can take one of four states”, as in a “base 4 digital” system. Rather, there are sequences made of permutations of four elements.

    This is not a “straw man distortion” of your argument, but a simple exposure of what seems to me to be a logical error on your part.

  65. Elizabeth Liddle:

    But it remains highly misleading because what most people mean by “base 4 digital” is a positional numeric system,

    That would be most people who have neither built machines from 2-state or 3-state devices, nor implemented logical operations as opposed to merely numeric, but have authored highly misleading wiki articles for people who can’t tell the difference.

    Tell me what it is that “changes state” in the DNA sequences I gave as examples in post 1.2.2.2.2, which I note that no-one has even quoted yet, despite the fact that I asked some clear questions in it, and repeated them in posts since then.

    And people accuse me of intellectual dishonesty and of not answering questions. Sheesh.

    You know what?

    I’ll make your own argument for you, seeing as no-one seems to want to step up to the plate.

    What I think you mean is that if you start “reading” a gene from one end to the other, what “changes state” is the thing you are currently reading. So what does the cell “read” when it “reads” DNA? Let’s look at how translation occurs:

    First thing that happens is that RNA polymerase binds to a promotor region of DNA. Is this a “digital” process? Not really. Either there’s a promoter sequence or there isn’t. As far as I know, nothing reads the promoter sequence sequentially, it’s just a chemical binding between one molecule and a section of another. If all you had in a testtube was a TATA box section of DNA and some RNA polymerase, they’d bind to each other, in a manner that is not, AFAICT, qualitatively different from the binding of any pair of reactive molecules. However, once the transcription process has been initiated, and the DNA gene “unzipped” and exposed, we do have a sequential “reading” in that the exposed DNA now forms a template for the sequential assembly of an RNA copy (with uracil replacing thymine of course). So maybe you could call this part “digital base 4″, as I guess the RNA polymerase “reads” one DNA base at a time and depending on the “state” of the “read” base, “selects” an appropriate RNA base to add to the emerging mRNA strand. But it’s a bit of a stretch, to my mind, and we haven’t reached the “coding” bit yet.

    OK. Now we have our messenger RNA molecule. This in turn is “read” sequentially by the translation machinery. So again we could regard “what is read” as the thing that “changes state”. And what is, in fact, read at this point? Not the individual bases, it turns out, but the triplets. So now we have moved into “base 64″. Depending on the “state” of “what is read” i.e. the codon currently in the system, a specific amino acid is joined to the emerging protein.

    So, considered as an information transfer system that conveys information from the DNA molecule to the protein-making system, I guess you could call it “digital”, except that the important part is in “base 64″ not “base 4″ (because I’d scarcely call a templating process a “digital” process, even if it is sequential – it’s more like an extrusion, really).

    However, considered as a system that conveys information about how to build a functional organism from parent to child, it isn’t digital at all, because there are no “state changes” between parent DNA and child DNA, although there are a lot of changes, and those changes embody information that has come from the environment about what has produced viable organisms in the past, as well as novel information about how to build this particular organism, that may or may not prove advantageous. If it does, it is more likely to be passed on to further generations.

    Lastly, there is the transfer of information from cell to cell, and from environment to cell, about what to do next, during development, maintenance, and function of the organism. And this really is digital, but it turns out to be in Base 2, and involves the switching on and off of genes so that the right proteins are made at the right time, in the right place, in response to the right chemical signals.

    So there you have a decent counter-argument, courtesy of me.

    I agree that there is an attenuated sense in which DNA can be considered as being involved in a “base 4 digital” information transfer process but only at the transcription stage where the exposed DNA acts as direct template. At the much more interesting information transfer process of translation, it is digital, but in base 64. At the information transfer process from parent to offspring, it isn’t digital at all, but alphabetic, as is the information transfer process from environment to population genome. And at the cell-to-cell information transfer process it is digital again, but this time in base 2.

    So, I will happily concede that at one level we do indeed have “base 4 digital” information transfer.

    I’m glad I was here to help myself.

    Cheers

    Lizzie.

  66. Eugene S:

    Elizabeth,

    That DNA is a code constitutes a scientific fact.

    No, it isn’t. There aren’t any “scientific facts”. It’s a scientific model. Also a metaphor. Quite a good one, I’d say.

    1. DNA carries instructions, consequently information.
    2. This information can be represented by strings composed using an alphabet that consists of 4 letters.

    Not all strings defined on the 4-letter alphabet have an associated biological meaning. Similarly, not all strings of some given length using letters of the English or any other alphabet, have meaning. Nonetheless, the above considerations allow the scientific community to agree that DNA is a code. To dispute that seems really strange.

    And I didn’t. As I said, I think it is better considered as “4-letter alphabet” code as you just did, not a “base 4 digital” code.

    However, as you will see from my post above, that when we consider various levels at which information transfer takes place in living things, one of them, I concede, could, at a stretch, be described as “base 4 digital”.

    I have no problem with the idea that information is transferred in living things – indeed I probably consider more kinds of information transfer than most people here, because I also consider the transfer of information form the environment to the population genome, which is the part that ID guys tend to leave out.

  67. Elizabeth Liddle:

    Please define the “RNA ‘digit’” that can take “four allowed ‘states’”?

    My exact words were:

    where its value is any of the possible states allowed by the system upon which the string is built. … and similary adenine uracil guanine and cytosine are the four allowed “states” of an RNA “digit”

    “possibly allowed” does equate to having “take[n][all] “four states”. Not all permutations exist. But the absence of some permutations does not change the fact that each permutation consists of not more than four possible states.

    But the answer you need is the “RNA ‘digit’” which can take [one of the] “four allowed ‘states’” would be one half of a base-pair. Each RNA “digit” is paired with another RNA “digit” to form a base-pair and base-pairs are strung together in strands, strands strung together in kilobase pairs,… etc.

    Wrong answer. There is only one “allowed state” for the other half of a base pair, given the first half. Yes, the basepairs are strung together in strands, but that’s not the answer to my question. My question was what thing, what entity, can take one of these four states.

    However, I’ve now answered it myself. The thing that can take one of four states is the base-pair being currently read by the the RNA polymerase during transcription. So you can have your “base 4 digital” for that part of the process. But only that part, because that is the only part that I can see where some entity (in this case “the base pair currently being read) that can take one of four “states”. At translation level, it is the codon that is read, and it can take one of 64 states. So yes, digital, but not base 4 any more. Indeed the mRNA may require editing so that it consist of integral triplets.

    Um, no you didn’t. And it’s absolutely critical.

    Yes I did. And it’s absolutely critical that you stop ignoring the answers you’ve been given. That is intellectual dishonesty. If you don’t understand, then ask. But stop presuming you know what you’re bloviating about. You don’t.

    I haven’t had answers to my questions IMO. Stop presuming that if someone thinks their question hasn’t been answered that it is she who doesn’t know what she is talking about. tbh, I thought you were bloviating, but I was too polite to say so. My question was quite simple (“what is it can take one of four states?”) and all I got was guff about half a base pair. Or an “RNA digit” which rather assumes the consequent.

    harrumph.

    If you want to claim that a system is in “base 4 digital” then please provide a definition of “base 4 digital” that doesn’t refer to a positional numeral system.

    Data processing systems employ logical operators (AND, OR, XOR, Compare, shift, copy, etc.) as well as mathematical. A base-four system merely does this with strings wherein each element (bit or digit) is in 1 of 4 possible states. That in RNA, strings are not found reflecting all possible permutations in no way changes the irrefutable fact that any position will never have anything other than either adenine uracil guanine or cytosine; regardless of the operation, the allowed values of each position will always be adenine uracil guanine or cytosine.

    And yet again you miss my point. What does “each position” mean”? DNA is not a “positional” system, but a sequential one. However, as I’ve said, I concede that if we think in terms of reading frames, at transcription level we can think of it as a base 4 system, and at translational level as a base 64 system.

    But the only person that has even mentioned reading frames in this thread is me, and it’s the only context in which “state” makes any sense, because the actual basepairs don’t change state at all within an organism (we hope) and between generations they don’t change digitally.

    The example I gave, which in your inexperience you twice now have failed to comprehend is content addressable memory. Present memory architectures mostly use two-state address-selected memory with many special applications that use content addressable instead. These same operations have been repeated in tri-state systems. To my knowledge, no one has attempted a 4-state processing system because there are no 4-state devices and regardless the practical limitations on adoption preclude any benefit.

    Look I don’t know how old you are, but from your manners I’m assuming younger than me. I hope that as you get older you will become less inclined to attribute disagreements to “inexperience” or “asinine” qualities on the part of your interlocutors. I’m shortly entering my 7th decade, and I have a fair bit of “experience” with digital systems of all kinds. And one thing I have learned from experience is that I am not infallible. I recommend the lesson.

    But as I mentioned, the operation by which strings of base-pairs are somehow compared and matched, taking note of markers denoting coding vs non-coding regions is essentially a 4-state content-addressing mechanism: The content is found and its address (endpoints) is subsequently used for “unzipping” and encoding (or not).

    Ah, at last. Not a model of clarity, but I agree, that the templating of RNA by DNA is sorta base 4 digital. Sorta.

    I’m using something that at least finds support in wiki. Where is yours?

    You could interpolate from the same article. It lists commonly used numeral systems and gives examples of base-8 and base-16, albeit the implementations are all on binary base-2 machines. But a base-4 numeral system would have values “0, 1, 2, 3? as its four allowed states. A base-4 RNA system has adenine uracil guanine or cytosine as its four allowed states. But again, as RNA is not a machine which employes math and all abstract permutations of numbers, as RNA employs logical operators similar to comparison and XOR and is not an abstract system, you should not expect to find all permutations of adenine uracil guanine or cytosine.

    You are confused again. You were almost there for a minute.
    First of, thank you, yes, RNA is not a system that involves math, although it does involve logical operators. And you are correct, it is not an abstract system. Glad to have established that. But now you’ve gone and swapped reference frames again. Considered as single items read sequentially, you can consider that “what is read” in a DNA strand (let’s denote it X) as having one of four states: AGCT – so sure, let’s call that “base 4 digital”. But if we consider it that way, any serial sequence is possible, and indeed all possible permutations occur. However, once we consider RNA, and the translation, we are no longer considering a one base reading frame but a three-base reading frame, i.e. “what is read” in an RNA strand (let’s denote it Y) can take one of 64 states, so we should call it “base 64 digital”. And again, lots of permutations of codons are possible.

    Just because you found the subject matter you sought doesn’t equate to having sought the applicable subject matter.

    No indeed.

    kairosfocus has already, ad nauseum, provided you with cites defining four-state systems.

    But what you were both extremely reluctant to do was tell me what, in a cell, can take one of four states.

    However, I found one: “what is read” in DNA while being templated by RNA polymerase.

  68. Elizabeth Liddle:

    Tell me what it is that “changes state” in the DNA sequences I gave as examples in post 1.2.2.2.2

    AUGCCGACAGUAGUAGAG

    What has changed state, if anything?

    That a state has to “change” is your misunderstanding. That there are obviously the same 4 possible states remaining (A, U, G, or C) is again your obdurate refusal to count.

    As far as I know, nothing reads the promoter sequence sequentially, it’s just a chemical binding between one molecule and a section of another.

    Agreed it isn’t sequential, it is rather a parallel pattern recognition (implemented in the machinery of chemical bonds), pattern recognition, analogous to “content addressable memory” which now is the 3rd time that has to be pointed out. That is why you get accused of intellectual dishonesty.

    But it’s a bit of a stretch, to my mind, and we haven’t reached the “coding” bit yet.

    Actually, it has already encompassed your example. The DNA and RNA sequences are “code”. Just like an encrypted message is code, just like a set of unexcuted computer instructions on paper is still code. The RNA polymerase binding, its “pattern matching”, is code.

    And what is, in fact, read at this point? Not the individual bases, it turns out, but the triplets. So now we have moved into “base 64?.

    Triplets of bases formed from A, U, G, or C, which is is still base-4. By asserting that is somehow base-64 (4x4x4) just demonstrates again your ignorance. You continue to conflate an abstract numbering system in which general purpose mathematical operations are done with a special purpose 4-state machine which only does some limited logical operations. By analogy, in a 2-state binary system (1, 0), 2x2x2 is a math operation yielding 8 (decimal) which is represented in binary by 1000, or in octal by 10 or in hexadecimal by 8. But underneath it all is the lowly 2-state transistor, which regardless of your confused conflations, didn’t become an 8-state transistor by stringing together a triplet of 2-state values. Likewise stringing together a triplet of 4-state base pairs doesn’t change the lowly A, U, G, or C molecules into 64-state molecules.

    And this really is digital, but it turns out to be in Base 2, and involves the switching on and off of genes so that the right proteins are made at the right time, in the right place, in response to the right chemical signals.

    What you mean is really “binary”. Binary is base 2, digital is a broader more generic term (humans are base-10 digital – we have 10 digits on our hands), but you’re still wrong, as a gene comprised of pairs of adenine thymine guanine and cytosine is still comprised of 4-state base pairs. As previously pointed out, the issue is not the number of permutations, but the number of states from which all possible permutations derive. Turning a gene on or off doesn’t change the adenine thymine guanine and cytosine composition from which it was built up. Analogously, turning off a binary memory cell does not add or subtract from the possible states each transitor in the memory cell can take; turning off a binary memory cell doesn’t transform it into a unary base.

    So there you have a decent counter-argument, courtesy of me.

    Hardly decent and hardly a courtesy.

    I agree that there is an attenuated sense in which DNA can be considered as being involved in a “base 4 digital” information transfer process but only at the transcription stage where the exposed DNA acts as direct template. At the much more interesting information transfer process of translation, it is digital, but in base 64.

    Yet another paper for you to submit to a symposium.

    So, I will happily concede that at one level we do indeed have “base 4 digital” information transfer.

    Now all you need do is demonstrate how information transfer from strings of base-4 base-pairs to other strings of base-4 base pairs is multiplicative to become 64 and then identify the 64 possible states in each base position (demonstrate not that 4x4x4=64, but that the transformation is multiplicative), and explain how the same base pairs were 4-state before but those same base-pairs become 64-state afterwards.

  69. Elizabeth Liddle:

    Wrong answer. There is only one “allowed state” for the other half of a base pair, given the first half.

    http://en.wikipedia.org/wiki/Base_pair

    The corresponding RNA sequence, in which uracil is substituted for thymine where uracil takes its place in the RNA strand:
    AUCGAUUGAGCUCUAGCG
    UAGCUAACUCGAGAUCGC

    State 1: A ( other half is U)
    State 2: U ( other half is A)
    State 3: C ( other half is G)
    State 4: G ( other half is C)

    Four possible states in different permutations (Take care you don’t start arguing combinations, as if position didn’t matter)

    My question was what thing, what entity, can take one of these four states.

    Asked and answered: one half of the base-pair – see above.

    DNA is not a “positional” system, but a sequential one.

    In a sequence, each component has its position, a position dictated by its relative appearance in the sequence. Point mutations, for example, are the substitution of a different base-pair into a specific position in a sequence of base pairs.

    But again, you already knew all the above.

  70. Dr Liddle:

    That digital MEANS discrete state is by no means idiosyncratic. As even so humble a source as Wikipedia will verify, it is the standard technical usage, for reasons as already identified.

    I agree that all digital systems are discrete. I do not accept that all discrete systems are digital. However, let me concede another point: let us regard any discrete information system as digital, regardless of whether it is alphabetic or numeric. And let us regard them as being in “base N” if “N” is the total number of kinds of item used, and if [what is read] at any given time can take one of N “states”.

    And it seems I need to make a point clear: a 4- discrete- state per- digit string- structure.

    And again, what goes wrong, kf is the bit after the “per”.

    There aren’t four states per “digit string structure” – “digit string structure” doesn’t mean anything. As I said, if [what is being read] is regarded as the thing that takes a state, you may have a point, but [what is being read] during transcription isn’t a “digit string structure” but a base pair. And [what is being read] in translation is a codon, which can take one of 64 states. Sure, those states are combinations of three RNA bases, but the three bases aren’t read sequentially, they simply act as a molecular unit with specific chemical properties.

    Digital string systems do not always change states, indeed ROM (read only memory) is set up precisely NOT to change state but as reference information pre-loaded into the system, and that is what DNA is.

    OK – if you are regarding DNA as a database (which I think is a good model btw) then whether you regard it as digital information in base 4 depends on the reading frame in the particular information-transfer process you are interested in. However, once you consider how that information is “pre-loaded into the system”, then you are not really talking about a digital information transfer system at all, because you are not talking about a system with a sequential reading frame.

    All the peculiarities that you may look at are things that make DNA a particular kind of digital entity, they do not affect the basic empirical fact that it is a discrete-state (thus, digital) info-storing entity. Just as, had it been more like a cam, it would have been an analogue info storing entity.

    GEM of TKI

    Well, as I said, I think you have to be very careful of what it is you are granting a “discrete state”. Is it the “state” of what the RNA polymerase is “reading” (4 possible states)? Is it the “state” of what the ribosome is “reading” (64 possible states)? Is it the state of a gene (two possible states, Off and ON)? Or is it the state of the of the locus of a gene (unlimited number of states aka alleles)? Or is it the state of the gene sequences that makes up a genome (billions, over time)? Or is it the state of the phenotype within a population (many states from dead to breeding madly)?

    Some of these information transfer-systems might be characterisable as being in base N, but some are in an indeterminate base number, and when we consider the origins of the “base 4 digital” DNA information that is “pre-loaded” into the genome, all these different kinds of “digital” systems, in both finite and undefined base systems, come into play.

    Yes, living things are packed full of information, and maybe you can call some, if not all, of it digital, but the information transfer systems certainly aren’t all in “base 4″.

    And perhaps this has been an illuminating conversation, because it makes me realise where you guys might be coming from. Yes, I will concede that there is a “base 4 digital” information transfer process in living things (transcription). But it’s only a tiny component in the vast system of information transfer that we see in Life itself, and completely ignores the information transfer systems that evolutionary theory posits as accounting for the origins of that information.

    So, I grant you your “base 4 digital” information transfer kf :)

    Now, look at the rest of the system!

  71. William J Murray

    I challenge you to respond to the following: If we find what appears to be to some an ancient, abandoned alien space ship on an otherwise deserted and desolate planet, how would one go about establishing, as best explanation, that the object in question was probably designed and built by an intelligent alien species

    Your example still assumes aliens built space ships the same way humans do and that we could recognize one just by looking at it. It’s just a modern spin on the Paley’s Watch argument that was rebutted over a hundred years ago.

    Your challenge is to detect design in an object that you have no external knowledge of. In the case of biological life, there is no relevant human design that it can be compared to.

    How about this: suppose we receive trustworthy information that somewhere in the tens of thousands of separate peaks in the Rocky Mountains is a peak that space aliens carved into a statue of their Great Leader. It has a designed function (a shrine) and it’s an exact copy so has lots of designed-in information (or CSI or dFSCI or whatever you want to call it). Unfortunately the space aliens all look a lot like craggy granite blocks. How would you go about determining which peak was designed?

    No, it doesn’t; it rightfully limits its potential recognition of designed artifacts to those that are similar enough to human design parameters to be rigorously quantified as designed.

    How do you rigorously and objectively quantify what ‘similar enough’ is? Seems to me that’s always going to be a subjective call, which is what keeps tripping up IDers. Features that ‘look designed’ to them don’t look designed to the scientific community, those who know of non-designed processes that produce the same features.

  72. Charles:

    Elizabeth Liddle:

    Wrong answer. There is only one “allowed state” for the other half of a base pair, given the first half.

    http://en.wikipedia.org/wiki/Base_pair

    The corresponding RNA sequence, in which uracil is substituted for thymine where uracil takes its place in the RNA strand:
    AUCGAUUGAGCUCUAGCG
    UAGCUAACUCGAGAUCGC

    State 1: A ( other half is U)
    State 2: U ( other half is A)
    State 3: C ( other half is G)
    State 4: G ( other half is C)

    Four possible states in different permutations (Take care you don’t start arguing combinations, as if position didn’t matter)

    States of what?

    My question was what thing, what entity, can take one of these four states.

    Asked and answered: one half of the base-pair – see above.

    No, you aren’t getting it. Forget the bottom half of the base-pair (because it is entirely predicted by the top half) and just look at the top row. What is it that can take one of the four states? Do look at my post 1.2.2.2.2, it might help.

    DNA is not a “positional” system, but a sequential one.

    In a sequence, each component has its position, a position dictated by its relative appearance in the sequence. Point mutations, for example, are the substitution of a different base-pair into a specific position in a sequence of base pairs.

    But again, you already knew all the above.

    Yes, and you know that I know it, because I’ve mentioned point mutations several times. What you are not addressing is the fact that point mutations are only one of several kinds of mutation, that include insertion, deletion, duplication and recombination. What “changes state” when any of these other mutations occur?

    Look again at my post 1.2.2.2.2

  73. Elizabeth Liddle:

    Forget the bottom half of the base-pair (because it is entirely predicted by the top half) and just look at the top row. What is it that can take one of the four states? Do look at my post 1.2.2.2.2, it might help.

    Fine. Looking now at only the top half:
    http://en.wikipedia.org/wiki/Base_pair

    The corresponding RNA sequence, in which uracil is substituted for thymine where uracil takes its place in the RNA strand:
    AUCGAUUGAGCUCUAGCG
    UAGCUAACUCGAGAUCGC

    State 1: A
    State 2: U
    State 3: C
    State 4: G

    The top half can each take one of the four possible states.

    What you are not addressing is the fact that point mutations are only one of several kinds of mutation, that include insertion, deletion, duplication and recombination.

    Irrelevant to the 4 possible molecules of A, U, C, or G from which the mutation is comprised.

    What “changes state” when any of these other mutations occur?

    The base-pair in any given position in the sequence, changes. But a change of any particluar base-pair, a change in the content of its position in the sequence, doesn’t alter the fact that base pair is still comprised from one of four possible molecules: A, U, C, or G (whether you look at the top or bottom half).

    Look again at my post 1.2.2.2.2

    You still have same four possible molecules: A, U, C, or G, no matter the sequence.

  74. Pardon a necessary off Topic.

    Dr Bot:

    You have now definitively crossed the threshold of incivility.

    Sad, but I need to let you know that per the direct implication of what you have said, you falsely accused me of support for genocide etc.

    You now refuse to explain yourself.

    Your choice; I will make mine.

    Good day

    GEM of TKI

  75. State 1: A
    State 2: U
    State 3: C
    State 4: G

    Thats wrong, it should be:

    State 1: G
    State 2: C
    State 3: A
    State 4: U

    oh, hang on, no, its:

    State 1: U
    State 2: A
    State 3: C
    State 4: G

  76. Sad, but I need to let you know that per the direct implication of what you have said, you falsely accused me of support for genocide etc.

    You LIAR! (slanderer even! )

    You really are the most despicable excuse for a human being I have ever had the displeasure of encountering.

    I find myself hoping that the god of Christianity exists just because it would be comforting to know that at some point you will ultimately be shown the true scale of your hipocracy.

    I have not engaged in the debate over genocide as the record on this blog will attest, yet you now claim that I am accusing you of supporting genocide – that is a flat out lie KF and you know it.

    Now do the decent, Christian, thing: withdraw the accusation and apologize – or do I have to get my lawyers involved, I hear that British libel laws can have a long reach ;)

  77. GinoB:

    Features that ‘look designed’ to them don’t look designed to the scientific community, those who know of non-designed processes that produce the same features.

    That is a lie as no one knows of any non-design processes that can produce a living organism from non-living matter nor any new, useful and functional multi-part system.

    Ya see if there was such evidence then we wouldn’t be having this discussion. Your lies mean nothing here.

  78. Apologies, Charles, missed this post:

    Elizabeth Liddle:

    Tell me what it is that “changes state” in the DNA sequences I gave as examples in post 1.2.2.2.2

    AUGCCGACAGUAGUAGAG

    What has changed state, if anything?

    That a state has to “change” is your misunderstanding. That there are obviously the same 4 possible states remaining (A, U, G, or C) is again your obdurate refusal to count.

    I didn’t say the states had to change. I asked what changed when the states did change. I posted sequences with changes. What changes state?

    As far as I know, nothing reads the promoter sequence sequentially, it’s just a chemical binding between one molecule and a section of another.

    Agreed it isn’t sequential, it is rather a parallel pattern recognition (implemented in the machinery of chemical bonds), pattern recognition, analogous to “content addressable memory” which now is the 3rd time that has to be pointed out. That is why you get accused of intellectual dishonesty.

    Have I denied that the system is “analogous to ‘content addressable memory’”? Please don’t move the goalposts and then accuse me of “intellectual dishonesty”.

    But it’s a bit of a stretch, to my mind, and we haven’t reached the “coding” bit yet.

    Actually, it has already encompassed your example. The DNA and RNA sequences are “code”. Just like an encrypted message is code, just like a set of unexcuted computer instructions on paper is still code. The RNA polymerase binding, its “pattern matching”, is code.

    OK. What I meant is that we haven’t reached the part usually called “the genetic code”. I agree it can all be considered code. In some sense.

    And what is, in fact, read at this point? Not the individual bases, it turns out, but the triplets. So now we have moved into “base 64?.

    Triplets of bases formed from A, U, G, or C, which is is still base-4. By asserting that is somehow base-64 (4x4x4) just demonstrates again your ignorance. You continue to conflate an abstract numbering system in which general purpose mathematical operations are done with a special purpose 4-state machine which only does some limited logical operations. By analogy, in a 2-state binary system (1, 0), 2x2x2 is a math operation yielding 8 (decimal) which is represented in binary by 1000, or in octal by 10 or in hexadecimal by 8. But underneath it all is the lowly 2-state transistor, which regardless of your confused conflations, didn’t become an 8-state transistor by stringing together a triplet of 2-state values. Likewise stringing together a triplet of 4-state base pairs doesn’t change the lowly A, U, G, or C molecules into 64-state molecules.

    It is not I who am conflating an “abstract numbering system” with the what is going on in the cell. And I quite agree that we don’t have “64 state molecules”, and I didn’t say so. I said we have a 64 state reading frame, not a four state reading frame.

    And this really is digital, but it turns out to be in Base 2, and involves the switching on and off of genes so that the right proteins are made at the right time, in the right place, in response to the right chemical signals.

    What you mean is really “binary”. Binary is base 2, digital is a broader more generic term (humans are base-10 digital – we have 10 digits on our hands)

    Yes, that’s why I said “base 2″.

    but you’re still wrong, as a gene comprised of pairs of adenine thymine guanine and cytosine is still comprised of 4-state base pairs. As previously pointed out, the issue is not the number of permutations, but the number of states from which all possible permutations derive. Turning a gene on or off doesn’t change the adenine thymine guanine and cytosine composition from which it was built up.

    No, I know it doesn’t. I didn’t say it did. In fact, I specifically pointed out that it doesn’t. Gene regulation remains, however, a network that can be well described as an information processing network (with inputs and outputs) that is binary. And extremely complex and clever.

    Analogously, turning off a binary memory cell does not add or subtract from the possible states each transitor in the memory cell can take; turning off a binary memory cell doesn’t transform it into a unary base.

    Of course it doesn’t.

    So there you have a decent counter-argument, courtesy of me.

    Hardly decent and hardly a courtesy.

    sheesh.

    I agree that there is an attenuated sense in which DNA can be considered as being involved in a “base 4 digital” information transfer process but only at the transcription stage where the exposed DNA acts as direct template. At the much more interesting information transfer process of translation, it is digital, but in base 64.

    Yet another paper for you to submit to a symposium.

    So, I will happily concede that at one level we do indeed have “base 4 digital” information transfer.

    Now all you need do is demonstrate how information transfer from strings of base-4 base-pairs to other strings of base-4 base pairs is multiplicative to become 64 and then identify the 64 possible states in each base position (demonstrate not that 4x4x4=64, but that the transformation is multiplicative), and explain how the same base pairs were 4-state before but those same base-pairs become 64-state afterwards.

    Because the base pairs were never “4-state”. What was “4-state” was the reading frame of the RNA polymerase.

    Look, as I’ve said, I’m more than happy to call the system “alphabetic” – we have letters at DNA level, that are transcribed into “word” at RNA codon level, and than translated into sentences” at ribosome level. And if you call the roman alphabet a “digital base 26″ system (or more than 26 if you count other characters) then I guess you can call genetics a “digital base 4″ system. My point is that in terms of information generation, processing, and transfer, Life does not behave like a digital system in base 4, but a whole nested system of systems, some of which are digital, some of which have finite base numbers and some don’t, and some of which are not digital at all.

    Oddly, “materialists” are accused of being “reductionist” but I strongly resist the kind of “reductionism” implied by trying to cram the all of life’s information handling processes into “digital base 4″. It completely leaves out the systems by which the information actually gets into the DNA in the first place (not by changing the “state” of “basepairs”, in general), so I guess it’s not surprising that IDists keep challenging “Darwinists” where it comes from.

  79. 79

    GinoB/Thornton

    You missed a key detail of William’s question. He said it ‘appears to be a space ship.’

    The fallacy he is exposing is that apparently you only have two ways of explaining what appears to be designed. If you know exactly who designed it, you allow for design.

    But if it is of unknown origin you eliminate design immediately. It can’t be designed because you don’t know who or what designed it.

    That is an argument from ignorance that sustains ignorance, because it limits your potential knowledge to your current knowledge. If you don’t know who designed it then you can never know, because you cannot allow for the possibility that it was designed.

    Necessity requires that we consider some possibilities and discard others. Probability is not a perfect filter, but it sure beats ideology. But I don’t think you even have an ideology. You just read something somewhere and decided to argue about it. Unlike some evolutionists, I really don’t think you know what you believe.

  80. Elizabeth Liddle:

    Forget the bottom half of the base-pair (because it is entirely predicted by the top half) and just look at the top row. What is it that can take one of the four states? Do look at my post 1.2.2.2.2, it might help.

    Fine. Looking now at only the top half:
    http://en.wikipedia.org/wiki/Base_pair

    The corresponding RNA sequence, in which uracil is substituted for thymine where uracil takes its place in the RNA strand:
    AUCGAUUGAGCUCUAGCG
    UAGCUAACUCGAGAUCGC

    State 1: A
    State 2: U
    State 3: C
    State 4: G

    The top half can each take one of the four possible states.

    “The top half”? Oh boy. OK, let me make it easier: are you saying that each position can take one of four states? I guess you are. Now insert a triplet randomly somewhere in the middle, between an existing pair of triplets. Tell me what has changed state now (the sequence will now have 21 positions of course.

    What you are not addressing is the fact that point mutations are only one of several kinds of mutation, that include insertion, deletion, duplication and recombination.

    Irrelevant to the 4 possible molecules of A, U, C, or G from which the mutation is comprised.

    um, no, it’s not “irrelevant”. The information is contained in those “states” right? So how can it be “irrelevant” if in one organism the sequence is:

    AUCGAUUGAGCUCUAGCG

    and in another it is

    AUCGAUUGAUGAGCUCUAGCG?

    And if the second results in a slightly more successful phenotype than the first, and so eventually all the organisms in the second population have the second sequence, and the sequence thus embodies the information that the second system works rather well?

    That information is not represented by a “state change” is it?

    What “changes state” when any of these other mutations occur?

    The base-pair in any given position in the sequence, changes. But a change of any particluar base-pair, a change in the content of its position in the sequence, doesn’t alter the fact that base pair is still comprised from one of four possible molecules: A, U, C, or G (whether you look at the top or bottom half).

    Well, no it doesn’t, but it does make the idea that the information relevant to the success of the phenotype is expressed by the “state” of a particular position rather untenable. It’s not the state of a particular position that matters, because “position” is not constrained in a gene – the gene can take lots of different lengths. What embodies the relevant information is the sequence – the order of the bases, not the “state” of any given position.

    Look again at my post 1.2.2.2.2

    You still have same four possible molecules: A, U, C, or G, no matter the sequence.

    Yes, I know. And let me repeat once more, with feeling: it is not the state of a “position” that embodies the information but the ordering of the bases. This is what, in my view, makes it an alphabetic system, not a “base 4 digital” system, except, possibly, at the level of transcription, but certainly not at the really important level of how the information as to how to make a well-adapted functional organism got into the sequence in the first place. Thinking of DNA as a “four state” information system is thus, to my mind, highly misleading, because the only thing that can take “four states” is the position in a gene, and position isn’t an absolute value by any means, because genes themselves – even the coding parts – vary in length.

  81. ScottAndrews2

    You missed a key detail of William’s question. He said it ‘appears to be a space ship.’

    No I didn’t. He’s just restating the Paley’s Watch argument (‘it appears to be a watch’) that was rejected a century ago.

    But if it is of unknown origin you eliminate design immediately. It can’t be designed because you don’t know who or what designed it.

    No one here has made that argument, but keep pounding that strawman if it makes you happy. Then address the real argument, which is how to tell design when you have no outside knowledge and nothing similar known-designed to compare it to.

    Why do you keep calling me ‘Thornton’? Does that have some sort of secret UD meaning?

  82. Sorry GinoB but science requires knowledge and the design inference rests on our knowledge of cause and effect relationships.

    That said:

    “Our ability to be confident of the design of the cilium or intracellular transport rests on the same principles to be confident of the design of anything: the ordering of separate components to achieve an identifiable function that depends sharply on the components.”- Dr Behe in “Darwin’s Black Box”

  83. Elizabeth Liddle:

    Have I denied that the system is “analogous to ‘content addressable memory’”?

    You kept insisting I hadn’t given you an example of something processed by “position” as opposed to sequence.

    And I quite agree that we don’t have “64 state molecules”, and I didn’t say so. I said we have a 64 state reading frame, not a four state reading frame.

    You said:

    However, once we consider RNA, and the translation, we are no longer considering a one base reading frame but a three-base reading frame, i.e. “what is read” in an RNA strand (let’s denote it Y) can take one of 64 states, so we should call it “base 64 digital”. And again, lots of permutations of codons are possible.

    You are in contradiction with your wiki cite.

    In mathematical numeral systems, the base or radix for the simplest case is the number of unique digits, including zero, that a positional numeral system uses to represent numbers.

    The operative terms there are “simplest” and “unique”, not complex and repetitive.

    The simplest unique “states” in RNA are the 4 possible molecules forming the base pairs: adenine uracil guanine or cytosine, not the more complex frames in which they repeat.

    Further, by redefining the base to be dependent on the scope of an arbitrary amount of information, you have no meaningful metric. If the scope of information includes as well the “state” frames, codons, or even chromosomes or genomes (or in extremes: populations, evironments, planetary alignment, cosmic microwave background radiation, etc.), beyond simply the unique possible molecules which implement DNA or RNA, then the number of “states” while arguably distinguishable, have no bearing on what consititutes the coded information (whether designed or not). The information, the code, is embodied in the sequences of base-pairs. That 4-state base-pairs form triplets, strands, … chromosomes, etc is no different than 2-state bits forming bytes, words, instructions, buffers, records, etc. To otherwise expand the scope of what constitutes the unit of state information is to move goal posts.

    Further to argue that as a defense in light of your cite of wiki and your original denial, to wit:

    This is why DNA cannot be usefully described as a “base 4 digital” system – it has nothing in common with a “base 4 digital” system, although it has plenty in common with a 4 letter alphabetic system in which sequences of “letters” have “meaning”.

    It could also be usefully described as a “base 2 digital system” because genes can be in one of two states: Off, and On, and indeed switching one gene Off can turn another one Off or On in a logical cascade in which certain inputs result in certain outputs.

    But Base 4 digital it ain’t.

    is intellectually dishonest.

    My point is that in terms of information generation, processing, and transfer, Life does not behave like a digital system in base 4, but a whole nested system of systems, some of which are digital, some of which have finite base numbers and some don’t, and some of which are not digital at all.

    Arguably, by that same metric, no computer system behaves like it’s in base 2, but a whole nested system of systems, some of which are even heuristic and non-determinitive, some of which are limited to numbers of 16-digits and some (like the compuation of pi) will carry on to millions of digits, and some (like analog integrators) are not even digital.

    And let me repeat once more, with feeling: it is not the state of a “position” that embodies the information but the ordering of the bases. This is what, in my view, makes it an alphabetic system, not a “base 4 digital” system, except, possibly, at the level of transcription, but certainly not at the really important level of how the information as to how to make a well-adapted functional organism got into the sequence in the first place.

    Two final points:

    You really, sincerely, should submit your viewpoints as papers. The review feedback will be illuminating.

    Don’t exect to have any crediblity in the future when you assert your understanding of digital systems and computer algorithms. I will link to this thread.

  84. Pardon a F/N re Dr Bot again, it is plain that no more needs be said beyond this. Kindly cf here ff. Note the direct implication of the quote plus directly following comment. Sad. KF

  85. Dr Liddle:

    Let’s try a text diagram:

    | * | * | * | . . .

    This is a string of concatenated cells, each cell being a digit. And, taking values for * based on the particular system.

    E.g: | 1 | 9 | 8 | 8 | = 1988

    We here have four ten-state digits in a string, a decimal digital string.

    All that is required for DNA is to see string sets, e.g.:

    |A|U|G|U|U|A|C|C|A|U|G|A| –> Start/Meth-Leuc-Prol-Stop

    The elements are 4-state, and they are formed into successive 3-letter words, which are in a string and are one word instructions.

    GEM of TKI

  86. Elizabeth Liddle:

    Have I denied that the system is “analogous to ‘content addressable memory’”?

    You kept insisting I hadn’t given you an example of something processed by “position” as opposed to sequence.

    Um, no, I didn’t. I kept on pressing you to tell me what had changed state in my examples.

    And I quite agree that we don’t have “64 state molecules”, and I didn’t say so. I said we have a 64 state reading frame, not a four state reading frame.

    You said:

    However, once we consider RNA, and the translation, we are no longer considering a one base reading frame but a three-base reading frame, i.e. “what is read” in an RNA strand (let’s denote it Y) can take one of 64 states, so we should call it “base 64 digital”. And again, lots of permutations of codons are possible.

    Yes, I know I did.

    You are in contradiction with your wiki cite.

    In mathematical numeral systems, the base or radix for the simplest case is the number of unique digits, including zero, that a positional numeral system uses to represent numbers.

    The operative terms there are “simplest” and “unique”, not complex and repetitive.

    You forgot “positional”.

    The simplest unique “states” in RNA are the 4 possible molecules forming the base pairs: adenine uracil guanine or cytosine, not the more complex frames in which they repeat.

    Yes, I know.

    Further, by redefining the base to be dependent on the scope of an arbitrary amount of information, you have no meaningful metric. If the scope of information includes as well the “state” frames, codons, or even chromosomes or genomes (or in extremes: populations, evironments, planetary alignment, cosmic microwave background radiation, etc.), beyond simply the unique possible molecules which implement DNA or RNA, then the number of “states” while arguably distinguishable, have no bearing on what consititutes the coded information (whether designed or not). The information, the code, is embodied in the sequences of base-pairs. That 4-state base-pairs form triplets, strands, … chromosomes, etc is no different than 2-state bits forming bytes, words, instructions, buffers, records, etc. To otherwise expand the scope of what constitutes the unit of state information is to move goal posts.

    I agree that they are like words. That’s why I said it was an alphabetic text system, in which what matters is the ordinal sequence, not absolute position.

    Further to argue that as a defense in light of your cite of wiki and your original denial, to wit:

    This is why DNA cannot be usefully described as a “base 4 digital” system – it has nothing in common with a “base 4 digital” system, although it has plenty in common with a 4 letter alphabetic system in which sequences of “letters” have “meaning”.

    It could also be usefully described as a “base 2 digital system” because genes can be in one of two states: Off, and On, and indeed switching one gene Off can turn another one Off or On in a logical cascade in which certain inputs result in certain outputs.

    But Base 4 digital it ain’t.

    is intellectually dishonest.

    No, it is not. It’s what I’ve been saying all along, that DNA is an alphabetic system. If you want to describe an alphabetic system as a Base N system, where N is the number of possible symbols, then sure. But that’s not what the wiki definition I cited does. Now, I have become aware, on this thread, that alphabetic systems are also described as “digital” and in the “base” of the number of possible symbols, and have readily conceded that as long as we are talking about the “state” of a “position” as defined, for example, by a reading frame, then it may be reasonable to describe at least some levels of the system as “base 4 digital” as long as we are clear that this is only when we consider the system as a Read Only system. As a system that is written to, that seems to me to be nonsense. It also seems to me that by the time we get to translation, we are no longer dealing with a “base 4″ system, because the original system has been highly edited into a sequence of discrete codons, read three at a time, so that the reading frame can take on one of 64 states. I guess you could consider them analogs of “bytes” but that would be a stretch, because only a small percentage of the genome is organised into codons, and these have to be carefully exised as integral units in the mRNA.

    My point is that in terms of information generation, processing, and transfer, Life does not behave like a digital system in base 4, but a whole nested system of systems, some of which are digital, some of which have finite base numbers and some don’t, and some of which are not digital at all.

    Arguably, by that same metric, no computer system behaves like it’s in base 2, but a whole nested system of systems, some of which are even heuristic and non-determinitive, some of which are limited to numbers of 16-digits and some (like the compuation of pi) will carry on to millions of digits, and some (like analog integrators) are not even digital.

    OK, that’s fine then. As I said, as long as everyone is happy to think of it as an alphabetic system with four letters, I don’t really mind what you call it, except that it’s really important to consider that when it comes to actually writing the code, “base 4 digital” is a potentially very misleading way of talking about it, because the information-bearing sequences are not a series of “positions” that can “change state” to produce “new information” but a sequence of “letters” that can be altered by deletion, insertion, duplication and recombination, as well as by substitution (the one “write” mechanism that could conceivably be called “digital”).

    And let me repeat once more, with feeling: it is not the state of a “position” that embodies the information but the ordering of the bases. This is what, in my view, makes it an alphabetic system, not a “base 4 digital” system, except, possibly, at the level of transcription, but certainly not at the really important level of how the information as to how to make a well-adapted functional organism got into the sequence in the first place.

    Two final points:

    You really, sincerely, should submit your viewpoints as papers. The review feedback will be illuminating.

    Don’t be silly. My initial point was that DNA is best thought of as an alphabetic system rather than what I will now call a numeric place value system to base 4. Everyone seems to agree with this – the only disagreement is whether we should call such systems “digital base N”. I’m happy to concede that when considered as a Read Only system, “digital base N” might be a reasonable way of describing certain parts of the information transfer process, as long as we don’t make the mistake of thinking that this means that anything other than the part of the sequence in the reading frame can take more than one state, and that we bear in mind that when the sequence is written it doesn’t behave “digitally” at all.

    Don’t exect to have any crediblity in the future when you assert your understanding of digital systems and computer algorithms. I will link to this thread.

    Feel free. I don’t “assert” anything – I make arguments, and I am always willing to concede any points if a persuasive rebuttal is made.

    Perhaps you would consider doing the same.

  87. Dr Liddle:

    Let’s try a text diagram:

    | * | * | * | . . .

    This is a string of concatenated cells, each cell being a digit. And, taking values for * based on the particular system.

    E.g: | 1 | 9 | 8 | 8 | = 1988

    We here have four ten-state digits in a string, a decimal digital string.

    All that is required for DNA is to see string sets, e.g.:

    |A|U|G|U|U|A|C|C|A|U|G|A| –> Start/Meth-Leuc-Prol-Stop

    The elements are 4-state, and they are formed into successive 3-letter words, which are in a string and are one word instructions.

    GEM of TKI

    Yes, I know, kf.

    And I will let you have your “digital” system as long as you are only talking about it from a Read Only point of view. I thank you for making the point that you were talking about DNA as a ROM system, rather than as a Write system.

    But it is when we consider it as a Write system that the big questions arise – how does the information get into the ROM?

    And the system that codes each new genotype does not only write new “states” to each “position” but inserts, deletes, duplicates and recombines entire sequences wholesale. So the idea that a particular “position” is recoded in the offspring by taking a different “state” breaks down, and to my mind the digital metaphor becomes highly misleading.

    Each new genotype, with its novel sequences, contains new information about how to build a new organism, and if that organism reproduces better than its fellows, that information is retained in more offspring, so that over time the information consists not simply of information about how to build any old organism, but of information about how to build an organism that will function well in the current environment.

    And I don’t think “digital base 4″ is a useful way of thinking about the generation and transfer of that information. Which is, perhaps, why ID proponents tend to mmiss it :)

  88. Elizabeth Liddle:

    I kept on pressing you to tell me what had changed state in my examples.

    I’ll concede the connection of content addressable memory to non-sequential processing is still lost on you.

    You forgot “positional”.

    No, it was in my quote and it remains the same concept whether in a base-2, base-4, base-10, or genuine base-64 numbering system. The fact that you argued your example was positional (as well as defining it as base-64 by virtue of frames), it remains complex and repetitive, which is the self-contradiction in your argument. You apparently failed to understand the meaning of the base definition you cited. That you persist in pretending you can apply wiki’s definition of base to complex and repetitive frames, simply because frames also exhibit position (as do all numbers), is again intellectually dishonest.

    I agree that they are like words. That’s why I said it was an alphabetic text system, in which what matters is the ordinal sequence, not absolute position.

    (sigh) not “words” in the literature or gramatical context but “words” in the unit of computer memory context: a word is 32 bits or 4 bytes. There are also double words, quad words and halfwords, quad, double, word and half word boundaries. A word of computer memory can contain bits or digits in a number (of base 2, 8, 10 or 16), or letters in a string, or execution instructions.

    No, it is not [intellectually dishonest]. It’s [Base 4 digital it ain’t.] what I’ve been saying all along, that DNA is an alphabetic system.

    In which each “letter” is encoded and implemented in 4-state molecular machinery (A, U, G or C). But you’ve already conceded that.

    My initial point was that DNA is best thought of as an alphabetic system rather than what I will now call a numeric place value system to base 4.

    In information theory, number systems, computer architecture, the term “base” has the same precise technical meaning and it isn’t “numeric place value system”. Your willingness to cite wiki when it suits you and abandon it when it suits you is precisely the intellectual dishonesty for which you are known.

  89. Pardon a F/N re Dr Bot again, it is plain that no more needs be said beyond this. Kindly cf here ff. Note the direct implication of the quote plus directly following comment.

    You have, I assume believing it to be some kind of evidence, linked to a comment I made where I did not accuse you of supporting genocide in any way. Just to remind the onlookers:

    accuse people falsely of support for genocide and child murder etc, refusing all correction

    That is the type of accusation you routinely make against ‘evolutionary materialists’ – you know, the one where you make claims about objective morality, destruction of society etc … and lay it all at the feet of people who disagree with you.

    Enough of your weasel words KF – the time to repent is upon you, apologize for the lie you told about me.

  90. Charles et al.
    The difference between an alphabetic system and a numeric one is sequence, and from that the effects of magnitude.

    Think about it this way – In a base 10 number system a change from 1 to 3 is a small positive change, and a change from 1 to 9 is another positive change of a larger size.

    How does this work for an alphabet system – Is a change from from C to F positive or negative? and what size is it?

    The alphabet system only has a sequence because of convention, but there are no rules defining direction or distance, whereas a number base is a sequence and is defined by rules (like for example what happens when you add 3 to 6 in base 10).

    If DNA is a base 4 numeric system then what are the rules for addition, subtraction, multiplication etc – i.e. what order are the four bases in, which is the lowest in value and which is the highest?

  91. Elizabeth Liddle:

    kept on pressing you to tell me what had changed state in my examples.

    I’ll concede the connection of content addressable memory to non-sequential processing is still lost on you.

    You forgot “positional”.

    No, it was in my quote and it remains the same concept whether in a base-2, base-4, base-10, or genuine base-64 numbering system. The fact that you argued your example was positional (as well as defining it as base-64 by virtue of frames), it remains complex and repetitive, which is the self-contradiction in your argument. You apparently failed to understand the meaning of the base definition you cited. That you persist in pretending you can apply wiki’s definition of base to complex and repetitive frames, simply because frames also exhibit position (as do all numbers), is again intellectually dishonest.

    Charles, there is a limit to the number of times I will tolerate being called dishonest. I am not dishonest, intellectually or otherwise, and I am “pretending” nothing. I am happy, as I’ve said, to accept a your definition of “base”.

    I agree that they are like words. That’s why I said it was an alphabetic text system, in which what matters is the ordinal sequence, not absolute position.

    (sigh) not “words” in the literature or gramatical context but “words” in the unit of computer memory context: a word is 32 bits or 4 bytes. There are also double words, quad words and halfwords, quad, double, word and half word boundaries. A word of computer memory can contain bits or digits in a number (of base 2, 8, 10 or 16), or letters in a string, or execution instructions.

    OK, but that doesn’t sound to me like a very good analogy for DNA. However, as I’ve said, perhaps if we regard DNA solely as a Read Only Memory system, it may work.

    No, it is not [intellectually dishonest]. It’s [Base 4 digital it ain’t.] what I’ve been saying all along, that DNA is an alphabetic system.

    In which each “letter” is encoded and implemented in 4-state molecular machinery (A, U, G or C). But you’ve already conceded that.

    Well, I meant that the “letters” are the four bases, and the “words” are the codons and the “sentences” whole genes, and the exons puntuation, I guess.

    My initial point was that DNA is best thought of as an alphabetic system rather than what I will now call a numeric place value system to base 4.

    In information theory, number systems, computer architecture, the term “base” has the same precise technical meaning and it isn’t “numeric place value system”. Your willingness to cite wiki when it suits you and abandon it when it suits you is precisely the intellectual dishonesty for which you are known.

    As I said, Charles, I have reached my limit with you regarding the number of times I will be accused of “dishonesty”. I am not dishonest. The issue of what “suits me” is irrelevant. I have no dog in the hunt. What I’m interested in is understanding how information transfer works in life systems. If the “base N” is used to refer to alphabetic systems in which N is the number of possible letters, then I am happy to accept that DNA is written in “base N”. Far from being “intellectually dishonest” I am more than happy to concede an argument if the point is made persuasively. You have made your point.

    It doesn’t actually alter my my model, because my original point was that the system was alphabetic. It seems we agree on that, and are only arguing about terminology, a point, as I said, I am happy to concede (being intellectually honest and all).

    However, the reason it is an issue at all, is when it comes to the question of how that memory is actually written, and it isn’t primarily written by changing the state of bits (or quots or whatever), but by deletion, insertion, duplication, and recombination. And thinking of it as a system in which new information is written as state changes seems to me to fail to capture how the information is generated, which is a pretty central issue in the ID case.

  92. And the other point about genetic information, is of course the “state” of each gene at any given time. This seems to me a much more clearly “digital” system in which each gene can take one of two states (Off or On), where the state of each affects the state of another. By this means each cell is “programmed” to output the right proteins at the right time, in the right place

    This is genuinely a “state change” system where it is clear what undergoes the state changes (the gene), and what those states are (Off and On).

    However, I am happy to stipulate that the “code” that allows each gene to be switched to either an “off” or “on” state consists of arrangements of the four nucleotide bases.

  93. “I challenge you to respond to the following: If we find what appears to be to some an ancient, abandoned alien space ship on an otherwise deserted and desolate planet, how would one go about establishing, as best explanation, that the object in question was probably designed and built by an intelligent alien species? Or are we committed by the definition of science to just keep tyring to find a natural explanation for the object?”

    Unless the space ship reproduces, evolution wouild be impossible and thus we might conclude design.

    But suppose we were walking across a heath and pitched our foot upon a rabbit, which is much more complicated than anything man has ever built and probably a lot more complicted than that space ship.

    Would we then say that the rabbit was put on the heath by a designer? Of course not, because we know where rabbits come from – other rabbits. Except that we also know that if you follow the chain of rabbits back in time, they start to look less and less like rabbits and then less and less like mammals and then less and less like … well, you get the drift.

    When it comes to living things, which is what ID is concerned with, we always know where they come from: other living things. We also know that as we go back in time, those living things get simpler and simpler until their trail is lost. Every step along the way is entirely natural.

    From there, it is an easy conjecture that the first living thing was very simple and also entirely natural.

  94. DM: Kindly look here on on the implications of the additional capacity of self-replication. GEM of TKI

  95. Dr Liddle:

    I must correct for record, so pardon an off topic onlookers.

    There are precisely zero, zilch, zip, nada, nil, NO responsible Christian leaders, thinkers and the like — including Dr Craig — who advocate or support genocide.

    Which professor Dawkins not only knows but has a duty to acknowledge.

    To willfully twist words out of context and falsely accuse of support for genocide, and so to falsely frame people as what they are not (potentially murderous criminals) in order to stir up hate against them — and that by a man who is now on video and document record as unable to find anything wrong with infanticide or Hitler’s genocide, like that is blood libel.

    Period.

    Please think again, seriously and soberly in light of the history of where that sort of willful false accusation that for whatever reason people are liable to take seriously, goes.

    Notice, the Internet poisoned talking point storm in recent days shows plainly that a lot of people, for reasons that must trace to a shocking bigotry, are quite prepared to believe what they should know is obviously slanderous nonsense coming from one who is on record as utterly amoral, and who set out to evade accounting for some pretty irresponsible fulminations by tossing out rhetorical red meat to stir up a poisonous fight.

    Good day.

    GEM of TKI

  96. F/N: Sigh, it seems Dr bot is incapable of seeing the direct — and utterly false — implication of what he has said: that he is accusing me that I am an advocate of genocide etc. I shake my head and leave the matter as it stands, as the issue should be quite plain.

  97. Dr Liddle:

    I have skimmed back above on the exchange over the past 24 hours ever since I mentioned a point in passing.

    I stand amazed at the sheer unwillingness to accept a basic, uncontroversial, standard definition: digital systems are defined by being discrete as opposed to continuous state.

    Period.

    GEM of TKI

  98. 1.2.2.2.58
    DrBotNovember 3, 2011 at 1:45 am
    Charles et al.
    The difference between an alphabetic system and a numeric one is sequence, and from that the effects of magnitude.

    Think about it this way – In a base 10 number system a change from 1 to 3 is a small positive change, and a change from 1 to 9 is another positive change of a larger size.

    How does this work for an alphabet system – Is a change from from C to F positive or negative? and what size is it?

    Alphebetic systems are potententially more tollerant of errors. Consider the frequency of typos and mispellings in posts abd their negligable effect on meaning. :)

    Digital systems can have error correcting mechanisms, but they only work to the extent that they actually correct the errors. Biological systems have editing and correcting mechanisms, but they also have mechanisms that compensate for errors without correcting them.

    This is one reason why there are so many living things, including people, carrying detrimental alleles. A related reason is that some detrimental alleles are useful in some environments.

    Evolvability requires the ability to tolerate error. It’s why living things often survive changes to the operating system, and computer programs generally can’t. It’s qualitative difference.

  99. ID advocates frequently cite the improbability of computer code evolving, because errors generally lead to fatal crashes.

    But the genetic code — in operation — is more like a language. Both living things and languages survive errors, and both are evolvable. In the case of language, we have numerous detailed histories of languages that have evolved. English is a prime example.

    The distinction between discrete and digital is unimportant. It’s how the words and sentences are interpreted that is important.

    The typical computer program is fragile and unable to recover from errors. The typical living population is not. It is the reader that makes the difference, not the medium.

  100. Petrushka,

    I believe I have made this comment in a different thread earlier but here it goes again. I believe, a human language is a bad example because language evolution involves intelligent agency. One can argue that error correction might have been built in the living systems essentially. Of course, it has limits and therefore we observe extinction (degeneration).

  101. The discrete nature of the genetic code is something darwin missed.

    Darwin was deeply troubled by not having a proper understanding of the inheritance mechanism, for it left him unable to rebut one of the most powerful objections to his overall theory. For a population to evolve by natural selection, the members of the population must vary—if all organisms are identical, no selection can occur. So for selection to gradually modify a population over a long period of time, in the manner suggested by Darwin, a continual supply of variation is needed. This was the basis for Fleeming Jenkins’ famous objection to Darwin, namely that the available variation would be used up too fast. Jenkins’ reasoning assumed a ‘blending’ theory of inheritance, i.e. that an offspring’s phenotypic traits are a ‘blend’ of those of its parents.
    http://plato.stanford.edu/entr.....-genetics/

    But a discrete code is not necessarily analogous to computer instructions. The difference is not in the storage medium, but in the way the code is interpreted and whether the reader is capable of compensating for errors.

    Systems that can evolve are necessarily robust with regard to errors. they must accept errors and pass them on.

  102. F/N: First, computer code is plainly linguistic [just as, discrete state is digital . . . ], so no wedge can properly be driven between the two.

    Similarly, there are computer programs that are designed to recover from a certain limited quantum of errors, did you study error correcting codes in college or see how a CD handles a scratch? But, beyond a limit, errors in the wrong place may well be fatal. And indeed there are many fatal genetic mutations, as well as those that are just plain deleterious.

    The second attempted wedge is also exposed as improper.

    Also, what is the focal issue is the claimed spontaneous origin of complex specified — esp. functionally specified — info by blind chance and/or mechanical necessity. 500 – 1,000 bits is the relevant threshold.

    There are many cases of FSCI being observed to originate by design, and nil of such by unintelligent cause. The usual claimed counterexample, GA’s, START in a designed, set target zone, and depend crucially for progress to peaks on nice helpful trends.

    We have excellent grounds to trust that based on what we know, such FSCI is an empirically tested, reliable sign of design. So, we have good reason to trust what it signifies in cases where we did not directly observe the cause.

    Which of course would highlight that the living cell, per reliable sign, is best explained as designed.

    That is the pivotal issue, and it is unanswered on the merits.

    GEM of TKI

  103. Kindly explain figures G.8a and G.9, with the mRNA tape in the ribosome.

  104. Are you arguing that the evolution of language is deliberate?

    It sounds to me like you are making the same error made by Soviet style economic planners (vs free markets and Adam Smith).

    Intelligence, design and planning are of little use if the future is inherently unforeseeable. There are of course, methods of coping with uncertainty, but they are limited in scope.

    Languages, nations, and corporations evolve and occasionally go extinct. they do this regardless of the desires and the intelligence levels of individuals.

    There is a whole sub-domain of evolution dealing with the evolution of evolvability. Thousands of papers have been written on the subject. Koonin and Shapiro have recent books on the subject.

    One can argue about whether this capability evolved or was designed, but the capability exists.

  105. Computers can have error correcting memory and error correcting storage systems, but computers in general do not evolve. In order to evolve, the system must be capable of tolerating errors and passing them on.

    This is the point at which the digital analogy fails.

    The storage medium is irrelevant. What is important is whether the system itself is evolvable.

  106. What is your point?

    I am not arguing that the medium isn’t discrete or digital. I’m saying that living systems, unlike most computer operating systems, are robust and tolerate errors and pass them on.

    This is the point on which the computer analogy fails.

  107. Seems to be a common problem with Design proponents like KF here. They just can’t understand that arguments by analogy only go so far, and that all analogies eventually break down. At some point they have to deal with reality, which seems to be a major stumbling block.

  108. Regarding the tolerance of errors, I understand that NASA built systems with several “discrete” systems running in parallel. The system was designed so that if one computer differed from the others, the majority vote would control the mission.

    There is no “intelligence” involved in the majority vote. there is no knowledge that requires the majority to be correct. It is simply a physical attribute of the system that enables the majority to rule.

    Living populations do this by the physical mechanism of fecundity and selection. It is a form of majority rule. The direction of the population is determined by which code produces the majority. There is no foresight involved or required.

  109. Dude,

    Your position can’t even muster an argument from analogy and that is why you and your ilk have to complain about the use of analogies.

    And that is beyond pathetic…

    And reality is definitely a stumbling block for your position.

  110. Except fecundity and selection never lead to the construction of new, useful and functional multi-part systems.

    Fecundity and selection leads only to a wobbling stability.

  111. Strict point mutation and selection might lead to wobbling stability, but when you add in known mechanisms of variation (described in detail by Shapiro and Koonin in their recent books) you have no restrictions on what can be produced.

    we have two recent descriptions, by Thornton and by Lenski, that describe how a neutral mutation can be carried in a population and eventually lead to a new function.

    Behe’s paper describes three instances of gain of function.

    There is also the accumulation of regulatory changes, which transformed jaw bones into inner ear bones.

    So your claim is factually wrong.

  112. 112

    Your example still assumes aliens built space ships the same way humans do and that we could recognize one just by looking at it.

    No, it does not; that’s part of what I’m challenging you to answer. I said someone suspects that it might be a ancient alien artifact, not that they recognize it as such. How could they “recognize” it as such, when to their knowledge they’ve never seen one before?

    The question I put to you is: if we suspect it might be an alien artifact, is there any rigorous or scientific way to validate that “alien design” is the best answer without knowing anything about the putative aliens in question?

    Secondly, if you say we can only reach such a finding if the design is sufficiently like “what humans produce” to “recognize” it, what is the metric or type of evidence that determines “how much like” human design is enough to warrant “recognition” of human-like intelligent design? In other words, what is the falsifying parameter that determines when something is recognizably like what humans design, and when something is just an anthropocentric mis-identification of a naturally-occurring feature?

    How about this: suppose we receive trustworthy information that somewhere in the tens of thousands of separate peaks in the Rocky Mountains is a peak that space aliens carved into a statue of their Great Leader. It has a designed function (a shrine) and it’s an exact copy so has lots of designed-in information (or CSI or dFSCI or whatever you want to call it). Unfortunately the space aliens all look a lot like craggy granite blocks. How would you go about determining which peak was designed?

    ID theory doesn’t claim to be able to discern all ID. Something designed to appear natural might not be detectable via the ID metric.

    How do you rigorously and objectively quantify what ‘similar enough’ is?

    That’s what I’m asking you in the alien artifact example. Do you have an answer? Or are we never going to be able to identify any alien artifacts as such unless we happen to know the aliens that produced them?

    Seems to me that’s always going to be a subjective call, which is what keeps tripping up IDers. Features that ‘look designed’ to them don’t look designed to the scientific community, those who know of non-designed processes that produce the same features.

    From this, I conclude your answer is that there is no way to ever conclude if an object found as in my example is better explained as the product of alien design, regardless of how similar to human design the parts of the object appear to be, and that we must limit ourselves to pursuing natural causes for any such object. Correct?

  113. Suppose the alien space ship looks exactly like a river pebble, and only becomes a space ship whe the correct words are spoken in the correct language?

    My point would be that our tendency to categorize theings as natural or designed has little to do do with any inherent attributes, and everything to do with out experience with observing various makers of artifacts.

    I know from personal experience that I cannot always tell the difference between a accumulation of twigs and an old, decaying bird’s nest. There have been numerous disagreements in anthropology regarding ambiguous artifacts.

    There is no metric for distinguishing design. It is a matter of judgement, except when we have clear evidence that something is made by a known kind of maker.

    But it is knowledge and observation of makers that weighs heaviest.

  114. If you are using that definition, kf, then I accept that DNA is a digital system. By the same token all molecular systems are digital, indeed the entire universe is digital as it consist of discrete quanta.

    The issue then becomes whether saying that DNA is a “digital system in base 4″ means anything different from saying that DNA is a polynucleotide consisting of four different nucleotides. And I concede that in a sense it does, because the sequence of nucleotides interacts with various RNA enzymes to produce an output that varies according to the sequence. However I think, as I keep saying, that we have to be very specific in how we apply that model. When we consider the transfer of information from DNA to ribosome, maybe we can consider it as “base 4 digital”, certainly at the transcription stage where the syntax essentially in which a given DNA base is matched to a corresponding RNA base. At the translation stage the system is different, and we have triplet nucleotides matched to amino acids holistically i.e. there are, in the cell, tRNA molecules that bind to specific amino acids at one end (not in “base 4″) and to specific mRNA codons at the other (which again you might call “base 4″ except that the thing that has a “state” now is the codon currently in the reading frame, not the nucleotide, the mRNA molecule having already been through an editing stage so that only the codon string reaches the ribosome. And the amino acids are also discrete (and therefore digital, by your definition) but not in “base 4″ but in “base 20″ to use the same nomenclature.

    And that is only one part of the information transfer chain.
    In fact many many molecules are involved, and they are all discrete (therefore digital in your definition) but not all in “base 4″ by any means.

    So if you are going to use computer metaphors, it’s important to specify what you are applying to what. Let’s stipulate that because it’s all discrete molecules (or ions), it’s all digital. But how many types of these discrete units are there in a cell? I have no idea, but it is way more than four. So is the whole cell the “computer”? Or are you just regarding the DNA as a “digital base 4″ ROM within a system that has some different base? And how do you modify the ROM in the next generation?

  115. William J Murray

    No, it does not; that’s part of what I’m challenging you to answer. I said someone suspects that it might be a ancient alien artifact, not that they recognize it as such. How could they “recognize” it as such, when to their knowledge they’ve never seen one before?

    That’s the problem I keep pointing out to you.

    The question I put to you is: if we suspect it might be an alien artifact, is there any rigorous or scientific way to validate that “alien design” is the best answer without knowing anything about the putative aliens in question?

    Not without knowing (or making assumptions about) lots of other information outside of the object – where it was found, what raw materials were available, what manufacturing processes were required to physically produce it, what natural physical processes that might have produced it are in the area, etc.

    That’s why I find the claim “ID is only about the designed object itself” so ludicrous.

    GB: “How about this: suppose we receive trustworthy information that somewhere in the tens of thousands of separate peaks in the Rocky Mountains is a peak that space aliens carved into a statue of their Great Leader. It has a designed function (a shrine) and it’s an exact copy so has lots of designed-in information (or CSI or dFSCI or whatever you want to call it). Unfortunately the space aliens all look a lot like craggy granite blocks. How would you go about determining which peak was designed?”

    ID theory doesn’t claim to be able to discern all ID. Something designed to appear natural might not be detectable via the ID metric.

    So dFSCI isn’t a reliable indicator of design. Interesting.

  116. “One can argue about whether this capability evolved or was designed, but the capability exists.”

    Oh yes, it does. The problem is to determine if it is really ubiquitous or its capabilities are limited. My view is that evolution has limitations. There are strict limits on the amount of information RV + NS can generate.

    I do not fully agree with your point about nations evolving because intelligence does make a difference, esp. human intelligence. Another example that springs to mind is that the law describing the great migrations of people is the same as the law of viscous liquid flow, so what? There are different levels at which we can study the same phenomenon. Physics and biology are fine, but they cannot comprehensively describe what humans are.

  117. Yes indeed, Eugene, and any metaphor has its problems. What we need to look at is precisely what information is being transferred when, and how.

    IMO.

  118. Dr Liddle:

    Atoms do exhibit discrete state properties per quantum physics, but that is utterly distinct from the discrete state information storage and 4related algorithmic processing in cells using DNA.

    GEM of TKI

  119. Petrushka: Have you even bothered to follow the link already given, on the issue of ADDITIONALITY of self-replication, and what it further suggests? As in, updated, the origin of the von Neumann self replicator found in life, which is both FSCI rich and irreducibly complex, is best explained on — design. GEM of TKI

  120. DrBot:

    The difference between an alphabetic system and a numeric one is sequence, and from that the effects of magnitude.

    The false premise in there, the mistake you and Elizabeth Liddle persist in, is thinking alphabetic and numeric data are different “systems” per se and are thus somehow different as regards to the base in which they are implemented. However, the interpretation of whether something is alphabetic or numeric or instruction (or even noise) is only relevant to the operation being performed on them, not the base in which they are implemented. The “system” is base-4, the DNA/RNA strings of “letters” are data and instructions within that base-4 system.

    How does this [change of magnitude or size] work for an alphabet system – Is a change from from C to F positive or negative? and what size is it?

    There is your false premise, that you expect to perform math operations on alphabetic data. There are legitimate examples e.g. error correction checking, hashing, encryption/decryption where math is done on alphabetic (i.e. alphanumeric) strings, however, more to your point, alphabetic data is usually operated on logically, not mathematically. But that distinction is irrelevant as regards the base in which alphabetic or numeric data is implemented.

    If DNA is a base 4 numeric system then what are the rules for addition, subtraction, multiplication etc – i.e. what order are the four bases in, which is the lowest in value and which is the highest?

    I stated earlier:

    Data processing systems employ logical operators (AND, OR, XOR, Compare, shift, copy, etc.) as well as mathematical. A base-four system merely does this with strings wherein each element (bit or digit) is in 1 of 4 possible states. That in RNA, strings are not found reflecting all possible permutations in no way changes the irrefutable fact that any position will never have anything other than either adenine uracil guanine or cytosine; regardless of the operation, the allowed values of each position will always be adenine uracil guanine or cytosine.

    There need not be a canonical or magnitude interpretation to data for logical operations. Two strings can be compared, altered, etc., for legitimate purposes without ever needing mathematical operations. Such strings can even be legitimate numbers operated on logically (such as comparing if they’re identical in value, length and sign) or bit-shifted to effectively multiply or divide them without using math instructions.

    Further, legitimate numbers can be treated as unordered strings such as invoice numbers, Serial numbers, error correction codes and hash codes.

    The point being, data need not be strictly numeric to be encoded/implemented in base-4. Strings of DNA “letters” are just as legitimately encoded in base-4 as could be numbers. For the most part DNA and RNA strings (in base-4) seem to be operated on logically, sometimes sequentially (letter by letter), sometimes in parallel (multiple letters simultaneously when “pattern matching”).

  121. Many computer and related systems have built in error recovery, and the error recovery capacity of life forms is also limited, as in fatal genetic defects limited.

  122. Ever heard of error correcting codes?

  123. Elizabeth Liddle:

    I am happy, as I’ve said, to accept a your definition of “base”.

    It isn’t my definition as if I conjured it up, rather it is the same definition you originally relied upon in your wiki cite. All I’ve done in this series of posts is elucidate to you the errors in your understanding of that definition.

    However, as I’ve said, perhaps if we regard DNA solely as a Read Only Memory system, it may work.

    As long as you understand the analogy is not perfect. There are occurrences of writing, when strands are copied, when mutations occur, but mostly, yes, it can be thought of as a base-4 program with data in ROM.

    Well, I meant that the “letters” are the four bases, and the “words” are the codons and the “sentences” whole genes, and the exons puntuation, I guess.

    I don’t care to drag this out further, but you really ought to stick with standard meanings of terms within their context and stop substituting alternate meanings.

    Far from being “intellectually dishonest” I am more than happy to concede an argument if the point is made persuasively. You have made your point.

    It doesn’t actually alter my my model, because my original point was that the system was alphabetic.

    Well it seems then I haven’t made my point, yet. See my above post to DrBot.

    And thinking of it as a system in which new information is written as state changes seems to me to fail to capture how the information is generated, which is a pretty central issue in the ID case.

    However the information is generated, it is generated in base-4, which was the point of this thread, or at least my interaction with you.

    As I said, Charles, I have reached my limit with you regarding the number of times I will be accused of “dishonesty”. I am not dishonest.

    I am not accusing you of theft, plagerism, or perjury, not that kind of dishonesty, but rather “intellectual dishonesty”, wherein to sustain your argument you conflate concepts, substitute meanings, obfuscate, spin and self-contradict. While we all make mistakes (and I have made my share of “stunningly asinine” assertions myself and tried to defend them and my ego), it is the obdurate repetition in the face of correction that lends the appearance of dishonesty in intellectual debate. Your underlying attitude and motivation may well be to purely seek the truth, but the external behaviour evident in the words you write belies that. Your most recent example is conceding I’ve made my point yet that doesn’t change your model because your original point was that the system was alphabetic. Many times you have posted self-contradictory statements concluding in a reassertion that you were right all along.

    The Greeks use to say that self-contradiction is the touchstone of error, and thus, its avoidance is the touchstone of truth.

  124. Red herring. The explanatory filter is designed to respond to observed signs that on strong observational basis, reliably point to design. Your hypothesis is unresponsive to what is actually on the table but distracts attention to erect and knock over a strawman.

  125. GB:

    Strawman.

    To apply signs of something, we must first observe the signs.

    Once present, per tests we have carried out, the signs are reliable. (As in, deer tracks point to deer.)

    What about when the signs are NOT present — as in no deer tracks are there, so deer tracks are not reliable signs of deer — is a strawman fallacy distraction.

    GEM of TKI

  126. Petrushka,

    BTW…

    If you are not from USSR/Russia, your ignorance about what free market ideology unleashed can achieve is justifiable. If you are, you might well know what Yeltsin and his clique advocating for free market did in economics. Under Gaidar, who was minding the business in Yeltsin’s time, everything was ruined to pieces. Salt was probably the only product to be found in shops in the 90′s. So even free market, a nice model it may be, fails without careful regulation from the state.

  127. F/N: The key issue in the design inference is that it enables us to use the logic and epistemology of empirically based inference to best explanation to infer cause from features of an object. In case you do not realise this, this is the general challenge that faces investigations of deep past origins. We see certain types of rock in a certain way of layering on the side of this mountain, what best explains? ANS: A PYROCLASTIC FLOW AND MUD FLOWS FROM AN EXPLOSIVE, ANDESITIC ISLAND ARC VOLCANO. Why? Because the signs we see point to the source and cause we did not see, in light of the dynamics at work in cases we do observe.

  128. F/N 2: if we were to make a trip to the far side of the Moon and find a pile of apparent machinery in a crater, we would be entitled to infer to the best explanation being the observed source of such machinery, intelligence. A side trip to one of the Apollo landing sites would provide a comparative case where we did see what happened. And, I am sure that, apart from being in a context where one is trying to object to design inferences, you would NEVER make a selectively hypersksptical argument like that. Why? Because it breaches the old Kolij rule no 1: A breach of common sense is a breach of the school rules.

  129. kairosfocus

    We see certain types of rock in a certain way of layering on the side of this mountain, what best explains? ANS: A PYROCLASTIC FLOW AND MUD FLOWS FROM AN EXPLOSIVE, ANDESITIC ISLAND ARC VOLCANO.

    Mt. Pinatubo in the Philippines is an andesitic island arc volcano. I suspect it may actually be a giant monument designed by space aliens.

    Can you please calculate its dFSCI so I can tell for sure if it was designed or not? Thanks!

  130. 130

    GinoB/Thornton,

    There isn’t an item in this that makes an ounce of sense. One indicates that you didn’t think at all before you typed.

    Not without knowing (or making assumptions about) lots of other information outside of the object – where it was found, what raw materials were available, what manufacturing processes were required to physically produce it, what natural physical processes that might have produced it are in the area, etc.

    You found it!!! How could you not know where it was found?

    It’s made of aluminum. The terrain is full of cryolite or aluminum oxide deposits. Or it is not. Explain how one or the other influences your determination.

    What manufacturing processes were required to produce it? Really? How would you determine how it was manufactured before deciding that it was manufactured?

    What natural processes might have produced it? Well, let’s start with the list of known natural processes that produce spaceships and go from there.

    Are you stopping for even a moment to think, or just objecting as fast as your fingers can type?

    Why should anyone respond to your arguments, hoping to be read and considered, when you clearly don’t give any consideration to your own? You’re trolling.

    ps – Thornton is your handle from another blog on which you troll and interact with some who also post or read here. I can easily demonstrate that, and it won’t be flattering.

  131. 131

    Petrushka said:

    There is no metric for distinguishing design. It is a matter of judgement, except when we have clear evidence that something is made by a known kind of maker.

    So if in one’s judgement the object is more likely explained as the product of a human-like (even if non-human) intelligence, they have warrant to investigate the object as if it is such? If so, would the research into the object under the “intelligently designed” premise be distinguishable in any way from research conducted as if it were a naturally-occurring object? Can both avenues of research be scientific?

    GinoB said:

    Not without knowing (or making assumptions about) lots of other information outside of the object – where it was found, what raw materials were available, what manufacturing processes were required to physically produce it, what natural physical processes that might have produced it are in the area, etc.

    Fair enough. Here’s another, more detailed hypothetical I’d like for you to look at:

    Sometime in the future we land on a barren desert & rock planet in some other solar system – the first time humans have left our solar system. There are no apparent signs of life of any sort. We were looking for some kind of element and follow our sensors to a cavern.

    Deep inside the cavern we find a very large, relatively smooth rock face with pigmented markings on it. The pigments appear to be naturally occurring materials found in the various rock, oxides and dust.

    The markings consist of aperiodic groupings of squares, circles, triangles, rectangles and lines. None of the markings form perfect geometric forms, but they are pretty accurate. Some of the lines are straight (though not perfectly), some are wavy (but always with three waves). Some circles have lines inside that go from edge to edge. The squares and rectangles are always around sets of the other markings and never by themselves.

    There are no machine markings or tool marks.

  132. 132

    The question is: is there enough information present to make a finding that the markings were probably the result of intelligent design?

  133. 133

    GinoB/Thornton,

    Mt. Pinatubo in the Philippines is an andesitic island arc volcano. I suspect it may actually be a giant monument designed by space aliens.

    That means that you are insane.

  134. Right, so please define “discrete state information storage”. Sorry to keep on about definitions but if we are going to apply models from computing to biological organisms, it’s really important to know how one set of systems maps on to the another.

  135. ScottAndrews2/Thornton

    Why should anyone respond to your arguments, hoping to be read and considered, when you clearly don’t give any consideration to your own? You’re trolling.

    LOL! Says the guy who has been doing nothing but presenting stupid Creationist PRATTs from AIG and CreationSafaris.

    How you coming with those details and the mechanisms for Special Creation?

    ps – Thornton is your handle from another blog on which you troll and interact with some who also post or read here. I can easily demonstrate that, and it won’t be flattering.

    LOL! If you say so Thornton.

  136. 136

    presenting stupid Creationist PRATTs from AIG and CreationSafaris.

    Never heard of them.

    As for your identity (I can’t believe I wasted time to do this.)

    Look at this post and this post from Thornton at darwins-god.blogspot.

    Does it make you feel better about yourself to keep repeating this lie? We show you detail after detail after detail, like the paper with evidence for avian lung evolutionary development, and all you can do is bawl NUH UH!

    T: “CH doesn’t ‘discuss’ science here. CH takes legitimate scientific research published in the primary literature, comes up with some goofy strawman version of what was actually done, then goes NUH UH!! at the top of his lungs.”

    And then, this one from this site:

    You’ve yet to address any of the technical details in the papers except to go “NUH UN!”

    You’re either Thornton or someone who finds his wit worthy of imitation. I’m not sure which is worse.

  137. LOL!

    So you think I’m someone else because I used the phrase “NUH UH” ????

    According to a quick Google search, that phrase can be found on some 1,270,000 different pages.

    I suppose because I used the phrase ‘common descent’ that makes me Charles Darwin too.

    You’re a bigger dolt that I ever could have imagined.

  138. There are different levels at which we can study the same phenomenon.

    I certainly agree. That is why analogies are aids to thought rather than than laws of nature. One must not engage in the king of reasoning that goes from the analogy with computer programs to the limitations of programs.

    I admire your defense of Soviet 5-year plans, but somehow the rest of the world seems to have iPods without central planning. I’m not an ideologue. I think central planning is necessary for disaster planning and for the care of the poor and less capable. But Adam Smith accurately describes the best approach to providing the non-essentials in the marketplace.

    As with evolution, it matters not whether the source of variation in products is planned by intelligent beings or planned by the inventors of pet rocks or rock music. The invisible hand decides what succeeds and what fails.

    With language it matters not whether new words are invented by Shakespeare or by people who can’t spell. The invisible hand decides which neologisms survive.

  139. It is of course interesting since all of his words/terms, expressions and idiotic smartassisms are identical to Thorton. I have no doubt that any number of local socks are created all over the Net when the Originals been banished before. Of course then there’s that mystic collective that plays games out there.

  140. 7.1.2.1
    PetrushkaNovember 3, 2011 at 6:22 am

    http://www.uncommondescent.com.....ent-407292

    The analogy with computes fails specifically because living systems tolerate and pass on errors, whereas computers generally do not.

    The problem with the computer code analogy is not in the pointless argument over discrete vs digital, but in what happens when there is an error in duplicating the code.

    Cells have editing functions that are similar to error correcting functions, but the editors do not prevent the errors from propagating. At some point the errors have an effect on phenotype, and this is subject to selection. Either it confers an advantage or disadvantage.

  141. 141

    I few more Thortonisms:

    Hey —–, why don’t you put down that donut and give us the ID explanation for ring species?

    LOL! That’s our boy —–, sharp as a bowling ball.

    Same old Creationist PRATT stupidity: “evolution says everything happened BY ACCIDENT!!!”

    The poor NTMO therefore had no thoughts of its own but could only mimic slimy dishonest Creationist leaders.

    PRATT? Slimy dishonest Creationists?

    Time to own up. For someone with such strong feelings about lying and hypocrisy you appear to be up to your neck in it.

    Personally I don’t know who you are or care. But you’ve already been a plague to one forum, shouting down attempts at polite, serious conversation. Now that it’s out in the open, at least admit to it.

  142. Well go for it. Let’s see an example of an explanatory filter in action for a specific object.

    How did it do for the infamous face on Mars? Actually there are dozens of websites devoted to designed or living objects on Mars.

    I would like to see the explanatory filter scoop mainstream science in some real situation where information about the origin of an object is incomplete.

  143. 143

    Petrushka,

    I would like to see the explanatory filter scoop mainstream science in some real situation where information about the origin of an object is incomplete.

    That’s exactly what is taking place right now. Trouble is, “mainstream science” doesn’t want to be scooped, even though science should always be open to it.

  144. ScottAndrews2

    That’s exactly what is taking place right now. Trouble is, “mainstream science” doesn’t want to be scooped, even though science should always be open to it.

    Let us know when it actually happens, K?

    We won’t be holding our breath.

  145. if we were to make a trip to the far side of the Moon and find a pile of apparent machinery in a crater…

    But something like this already happened with the Martian face, which illustrates the propensity of design inferences to return false positives.

    Obviously if we find something never seen as a result of a known natural process, we will infer it is made by something analogous to a human. But that is because we have extensive knowledge of things made by humans and things made by natural processes.

    When the object is ambiguous, as with the Martian face, the inference — either way — is based on ignorance of the object’s history and ignorance of the possible causes.

  146. Whoops. failed to close the quote tag.

  147. Petrushka

    Newton’s First Rule, parsimony and Occam’s razor all tell us that the EF is the methodology all investigations need to take if they are going to determine a root cause.

    As for stuff on mars, well we really need to see it in more detail to see if there are any signs of work.

  148. ScottAndrews2/Thornton

    PRATT? Slimy dishonest Creationists?

    ZOMG he used the term PRATT! No one else on the web has ever used it!

    “fourscore and seven years ago”

    Look everybody, I’m Abraham Lincoln!!

    Here’s a hint ScottAndrews2/Thornton: you should worry a lot more about the questions you’re ignoring and the fool you’re making of yourself here at UD, not in baseless speculation about postings at other unknown sites.

  149. Petrushka:

    There is no metric for distinguishing design. It is a matter of judgement, except when we have clear evidence that something is made by a known kind of maker.

    But it is knowledge and observation of makers that weighs heaviest.

    Yes, knowledge of cause and effect relationships help and we can extrapolate from there. But I strongly disagree that there isn’t any metric for distinguishing design, many venues rely on that very thing.

    If it is a judgement call then it would be safe to say that all of science is a “judgement” call until someone outright proves it- Einstein gravioty bends light- judgement call based on what he had- later confirmed during a total solar eclipse.

    And while there may be some ambiguities- it would matter on their importance on whether to sort it out- there are strong indicators nontheless:

    “Our ability to be confident of the design of the cilium or intracellular transport rests on the same principles to be confident of the design of anything: the ordering of separate components to achieve an identifiable function that depends sharply on the components.”- Dr Behe in “Darwins Black Box”

    And just because you can’t tell a mess of twigs from an old deteriorated bird’s nest that doesn’t mean no one could. Not everyone is cut out for this investigating stuff.

  150. Newtons first rule is:

    We are to admit no more causes of natural things than such as are both true and sufficient to explain their appearances.

    Let’s not forget the second, third and forth:

    We are to admit no more causes of natural things than such as are both true and sufficient to explain their appearances.

    The qualities of bodies, which admit neither intensification nor remission of degrees, and which are found to belong to all bodies within the reach of our experiments, are to be esteemed the universal qualities of all bodies whatsoever.

    In experimental philosophy we are to look upon propositions inferred by general induction from phenomena as accurately or very nearly true, notwithstanding any contrary hypotheses that may be imagined, till such time as other phenomena occur, by which they may either be made more accurate, or liable to exceptions.

    We have a mechanism for change and adaptation in living populations. It has been employed by plant and animal breeders for centuries and has been experimentally verified in the laboratory — “notwithstanding any contrary hypotheses that may be imagined.”

    Parsimony favors the demonstrated mechanism over the imagined one.

  151. Scott,

    it’s t-h-o-r-t-o-n only 1 n and it is at the end.

  152. 152

    GinoB,

    You are identified to fellow posters as Thorton, the troll that renders darwins-god.blogspot.com unusable for any serious discussion. (It’s tempest in a teapot. Who cares, I know.)

    Some interesting subjects came up on that blog, but it didn’t take long to observe that you and a few others were intent on drowning out discourse with childish name-calling, insults, and ignorant rhetoric.

    I don’t believe I need to say any more about it.

  153. Petrushka

    Have you taken time to look at the cluster of examples here, with what else they point to?

    (It looks like you are recirculating long since answered talking points.)

    GEM of TKI

  154. Non specified, so S = 0, so Chi_500 = – 500, negative limit. Well within reach of blind chance and necessity.

  155. Strawman, to dismiss something you are plainly uncomfortable with; for the sort of facial feature that would raise the question of design, you would be looking at mega bytes of info to get a sufficiently defined mesh of nodes and arcs to form a sufficiently definite face.

    The issue from the beginning was whether there was an artifact of image processing, confirmed by a later scan. There was no serious question of an inference to a designed feature on Mars on the evidence in hand.

    The earlier hand drawn canali, were designed: by the astronomers, to resemble what they THOUGHT they saw (the specification). Had their seeing been accurate, the network WOULD have indicated a Martian civilisation.

  156. Unfortunately the mechanism change and adaptation observed in living populations can only account for slight changes within a population.

    It’s “power” has been rendered useless by a realistic take on AVIDA:

    The effects of low-impact mutations in digital organisms

    Chase W. Nelson and John C. Sanford

    Theoretical Biology and Medical Modelling, 2011, 8:9 | doi:10.1186/1742-4682-8-9

    Abstract:

    Background: Avida is a computer program that performs evolution experiments with digital organisms. Previous work has used the program to study the evolutionary origin of complex features, namely logic operations, but has consistently used extremely large mutational fitness effects. The present study uses Avida to better understand the role of low-impact mutations in evolution.

    Results:

    When mutational fitness effects were approximately 0.075 or less, no new logic operations evolved, and those that had previously evolved were lost. When fitness effects were approximately 0.2, only half of the operations evolved, reflecting a threshold for selection breakdown. In contrast, when Avida’s default fitness effects were used, all operations routinely evolved to high frequencies and fitness increased by an average of 20 million in only 10,000 generations.

    Conclusions:

    Avidian organisms evolve new logic operations only when mutations producing them are assigned high-impact fitness effects. Furthermore, purifying selection cannot protect operations with low-impact benefits from mutational deterioration. These results suggest that selection breaks down for low-impact mutations below a certain fitness effect, the selection threshold. Experiments using biologically relevant parameter settings show the tendency for increasing genetic load to lead to loss of biological functionality. An understanding of such genetic deterioration is relevant to human disease, and may be applicable to the control of pathogens by use of lethal mutagenesis.

    Also it is clear by using examples of artificial selection that tehre are limits to the amount of phenotypic plasticity allowed.

  157. kairosfocus

    Non specified, so S = 0, so Chi_500 = – 500, negative limit. Well within reach of blind chance and necessity.

    Where is your evidence that it is not specified? If was designed and built then is certainly had a specification.

  158. ScottAndrews2/Thornton

    You are identified to fellow posters as Thorton, the troll that renders darwins-god.blogspot.com unusable for any serious discussion. (It’s tempest in a teapot. Who cares, I know.)

    BIG LOL!

    No, I’m really Jack the Ripper! No, I’m really Pol Pot! :)

    You’re making quite the spectacle of yourself here Scott/Thornton, acting like a butt-hurt teen age girl. I guess since you are too incompetent to discuss any scientific topics, trying to fling mud is all you have left.

    Apparently someone made you look like a fool when you posted your Creationist stupidity on another board, so now anyone who points out your Creationist stupidity must be the same person!

    No one ever lost money underestimating the intelligence of a Creationist.

  159. Dr. Bot, you can please yourself re British libel law, but you are no longer with us. As a general rule, anyone who threatens to sue is off the board.

  160. GB:

    Remember, we are here dealing with inference to best explanation, which I have asked you and Fossfur to take a careful look at.

    It is strictly logically possible that every post in this thread is an act of lucky noise on the Internet that somehow reconstructed and issued the posts we typed up and tried to send. But, for a great many reasons, that is not the best and most reasonable explanation. (And notice, intuitively, you recognise the functionally specific, complex information present in the thread as strong and reliable signs of intelligent cause. Think, very hard about why you do that, bearing in mind the issue of the additional capacity of self-replicating for a watch that was put on the table 200 years ago, cf here as was already pointed out and linked.)

    You may also profit from an examination of the explanatory filter discussed on a per aspect basis, here. The filter deliberately is heavily biased to make default rulings on mechanical necessity in low contingency cases, and chance in high contingency cases. It is only when it is not plausible for chance and/or necessity on the gamut of our solar system [500 bits] or observed cosmos [1,000 bits] to give rise to a particular outcome, that an inference to design is even on the table — which is why we do not need particular evidence to infer non-specificity, but rather good reason to infer specificity.

    To clarify specificity, consider that an observed event E comes from a narrow and independently definable zone T in the field of possible configs W. That is, we are looking for a special outcome maximally unlikely to arise by blind statistical events.

    (This is quite similar to the way that a common approach to hypothesis testing works. The most likely place to find a sample in a distribution is in its bulk, not in a far tail. If we have two overlapping possible distributions, and E would be in the tail of H0 or else would be in the bulk of H1, it is best to explain E as belonging to H1.)

    In the most relevant case, we are talking about observing complex, functional, digital code that fits into a system, and allows it to do some particular thing.

    It is logically possible for noise filtered by blind trial and error to give rise to such functional code, but utterly implausible relative to the alternative, intelligence. And, when we factor in the relevant scope of atomic resources and time, we see that on the gamut of our solar system [our practical universe], the 10^57 atoms, for 10^17 s, would have some 10^102 Planck time quantum states. That’s about 1 in 10^48 of the number of possibilities for just 500 bits.

    A useful comparison is that if the number of configs is viewed as a 1-straw sample, taken blindly from a cubical hay bale 3 1/2 light days across, even if a whole solar system were in that bale, by overwhelming likelihood the sample will pick up the bulk, not the atypical zones, i.e would be reliably a straw.

    The notion of starting from an initial functional config and then incrementally improving by incremental trial and reward of incremental performance improvement may explain adaptations of a functional body plan, but it does not explain origin of body plans, starting with the first and going on to the many dozens of further plans we see.

  161. A thousand useless words and you didn’t answer the question:

    Where is your evidence that the volcano is not specified?

  162. Dr Liddle:

    The question you asked was why we regard DNA as digital, and when we pointed to the 4-state discrete state system, you then spoke of read/write issues. I pointed to the fact that a ROM is read only but that does not change it suddenly into not being a digital system.

    ROMs can be factory programmed, electrically programmed, UV erased, etc etc, but that has no ability to change that the information in them is discrete state.

    The simple matter to be kept in focus is that: DNA is based on a 4-state digit, string data structure. Simple, and directly observable.

    After that first fact is seen and understood, we can then address how the info got there, immediately and originally, given its role in the cell.

    How the body of biofuncitonal info got into a cell based ortganism is important, and ti raises the issue that we are looking at 100 – 1,000 k bits for the first DNA based cells, and 10 – 100 mn bits increments for body plans, a material part of which must be functional for a viable organism to exist.

    While this is of course unwelcome, the only credible source ont eh gamut of our observed cosmos for that much info, is intelligence.

    GEM of TKI

    F/N: A bit off topic but important. I am saddened to see the ultimate playout with Dr Bot. I tried to point out to him, across two threads, that he had gone too far, making a statement on a clip that implied — and that of course is quite different from what he may have deliberately intended — that I have falsely accused others of advocacy of genocide etc. He seems to have refused to either explain himself or apologise, and instead went on to further accuse me and finally to threaten legal action. I am highly confident that such action would be futile as it would be patent to a solicitor that I am identifiable as the target of a false implication and (quite reasonably) pointed that out and requested explanation and apology. It is not irrelevant to note that on the root matter, one may easily see here that Dr Craig, a leading Evangelical Theologian and Philosopher, is also not an advocate of genocide or the like, i.e. the accusations made against him — and which by the nature of scandals would spread like a cloud of suspicion over all evangelical Christians, in many minds — are based on a caricature of his views (as I have pointed out from the very beginning of the poisonous rhetorical storm that has brewed up based on a recognisable distractive rhetorical stratagem: tossing out red meat to stir up a nasty fight).

  163. Dr Liddle

    Pardon, but this is now going in circles, where adequate answers have been repeatedly given.

    It is an uncontroversial standard of the relevant technology, that digital systems are defined by being discrete not continuous state, and that this has to do with the use of different states to carry out informational functions, such as logic, computation/calculation, storage, processing etc.

    It is further uncontroversial, that digital systems come in various bases, binary being two-state, decimal 10-state per digit, duodecimal being 12 states per digit, hexadecimal 16, and sexagesimal 60. Etc.

    In this context, it is generally acknowledged that DNA uses 4-state digits in string structures, commonly represented by AGCT for values. Yes the underlying materials and forces happen to be chemical and spatial rather than electrical, but that does not change the basic point.

    Further to this, there are protein coding regions in DNA, which have an identified 3-digit per word, code known as the genetic code.

    None of this should even be a matter for controversy.

    GEM of TKI

  164. 164

    KF, you mentioned (RW) vs (ROM), I just got to this part in the Shaprio book where he says:

    So all genome action is subject to the inputs and information-processing networks we know to operate in living cells. Part II describes how the new conceptual landscape leads us to think about a read-write (RW) genome, replacing the traditional evolutionist read-only memory (ROM) device subject to change by accidents and errors.

    Apparently idea of (ROM) is itself being questioned.

    Evolution: A View from the 21st Century
    *Table 1.1 Changing views of Intracellular Molecular Information Transfer

  165. GB, that discrete state systems are digital systems is not an analogy. That genetic code is a code is not an analogy. And so on. Worse, reasoning based on analogy happens to be close to the heart of inductive reasoning, so please be careful of sawing off the branch on which science sits. (And notice the legitimate analogy used there.) GEM of TKI

  166. 166

    some computer viruses can evolve in some sense via polymorphic code:

    http://en.wikipedia.org/wiki/Polymorphic_code

    http://en.wikipedia.org/wiki/Metamorphic_code

  167. kairosfocus

    GB, that discrete state systems are digital systems is not an analogy.

    KF: All digital systems are discrete state systems, but not all discrete systems are digital. A jigsaw puzzle is a discrete system but it certainty isn’t digital.

    Pretty significant error on your part.

  168. GB: You are simply wrong. Discrete state is the standard definition of digital. KF

  169. F/N: You pick the example of a jigsaw puzzle. This has a collection of related, interlocking, well matched parts. Between parts there are no valid parts. Discrete. Well-matched, interlocking, only one config that involves all parts is correct, i.e. irreducibly complex. A 500 piece puzzle has a vast number of possible configs [though on gamut of the solar system, less than 10^102], only one of which is valid. If you were to find such a puzzle in that state, what would best explain it: chance and necessity are logically and physically possible but maximally implausible. In other words the jigsaw puzzle is yet another unintended example of the inference to best explanation for FSCI being design. GEM of TKI

  170. Research error correcting codes, which will show you a reason for built in redundancy in info systems. For mechanisms, NASA found the easiest way is to build in parallel mechanisms, similar to the triple repeat, majority vote code.

  171. P:

    Act5ually a live case on teh real-world use of the explanatory filter and how it did its job right.

    Mars face 1976, a relatively low resolution [800 ft details] photo on low angle light casts a face like pattern, but right from the beginning the inference was this is consistent with our known tendency to spot face-like patterns, and the artefacts cast out by low resolution imagery.

    Solution: enhance details — i.e go for a test on complexity and detailed specification, to see if the pattern holds up under closer details. If there was a face like at Giza, then that would credibly be an artifact.

    As of the Euro 3-D scan recently, this is what the feature looks like, on details resolved to maybe 10 ft. There are hills that under low angle light could cast a suggestive pattern of shadows, bu there is no sculptural face.

    EF verdict: effect of low res image under low angle light.

    EF vindicated again, and seen to be actually intuitively used on the ground (it is glorified common sense after all) in a real situation.

    GEM of TKI

  172. OUCH on typos.

  173. GB, you are resorting to dismissive selective hyperskepticism. I have pointed out the underlying methodological issues, which you choose to brush aside. That tells me you are not seriously engaging issues on the merits, just looking to make rhetorical talking points. I have already highlighted that on inference to best explanation Pinatubo etc are well explained by the two defaults of the EF, chance and necessity; so the EF is perfectly willing to be wrong in assigning it to that, in order to maximise the likelihood of being correct when it does point to something that is not credibly C + N, but is per reliable sign best explained on inductive empirical evidence based warrant as designed. Which is using the foundational approach of science. G’day. GEM of TKI

  174. F/N: Metric,

    Chi_500 = I*S – 500, bits beyond the solar system threshold, where I is an applicable information metric related to Hartley’s suggested I = – log p

    . . . with real world cases that are suggestive onwards. And FYI, GB, a dummy variable like S to fit situations that can be assessed on a scorecard basis as being in this or that mode, are common in modelling. In this case the metric is part of a process captured by the explanatory filter and S captures the cases where the defaults apply. GEM of TKI

  175. F/N: Notice, nothing is said about the pigments being in a paint or in ink, or whether there are things consistent with paint-brush or pen or even marker strokes. The word “on” is suggestive of the application of such strokes. Staining by being next to say rusty bits of metal, is also possible in which case the marks are like natural castings or footprints, but would be IN the stones. The suggestion is that key details that would be easily observable and would be material to identifying nodes in the explanatory filter have been held back.

  176. Self-replication is not something added on, it’s the distinguishing characteristic of first life. Everything else you see in an organism is added on.

    So what do you say about that rabbit? Do you deny that if you follow the ancestors of that rabbit farther and farther into the past, they will eventually no longer be rabbits?

  177. F/N 2: Recall, the basic distinction in comms theory between signal and noise depends on objective, recognisable differences, which are in principle quantifiable. Usually thought the obviousness is a baseline for dealing practically, e.g. closing the eye with relatively high frequency noise in an eye diagram display or grass growing on a scope trace etc.

  178. 178

    Whenever I challenge anti-ID advocates with this hypothetical line of questioning, they quickly bail on the debate. I designed it to reveal the ridiculous nature of their various ID denialisms, such as “you have to know something about the designers or the manufacturing process” or “there’s no way to tell if it’s designed”.

    If they set aside their ridiculous denials and agree that we could tell if such artifacts were best explained as product of non-human, but human-like ID, then I ask them what was their valid method for making that determination?

    It’s either by a rigorous, scientific metric, which would mean they have agreed that ID detection is scientifically sound by rigorous method (whether we currently have that method or not), or they agree that intuitive recognition is usually enough to warrant such a finding – which, by that token, should be enough for ID theorists in regards to biological mechanisms.

    Then, the question is if one’s research after such a finding is scientifically valid (of course it is), and if it is the same as if we have no reason to suspect it is naturally occurring (in many respects, it is an entirely different line of investigation).

    Generally, what we do after we make a finding of ID is try and understand the object’s function or purpose – which is what we do with biological features.

    Interesting that we don’t try to find the purpose or function that an avalanche serves, is it not?

    The history of biology is one of assuming ID and applying the ID heuristic, and then in more recent years trying to hide that fact (as per the attempts to wash design-implicating language from biological research).

    It’s sort of like how atheistic determinists/materialists use the language of free will, and talk and argue and think and act as if they have free will, but then try to deny it; evolutionary biologists cannot help but talk and write and proceed as if there is design in biological features, even while attempting to deny it.

  179. I’m familiar with error correction. I’ve coded CRC checks.

    You have entirely missed the point that living things tolerate and pass on errors. This has to do with reproduction, not with translation. Your graphic on translation has nothing to do with variation and selection or with population genetics.

    The fact that living things are robust enough to survive copy errors is a key difference from computer systems. It is where the analogy fails.

  180. How do you know they are errors?

    True according to the current theory they are all errors, but how was that determined?

  181. WJM: Food for thought. This summary on a metric may be useful — note, there are specific cases where it is immediately applied to biology using the Durston et al work. G

  182. Summary, here (with real world biological cases).

  183. Lots more meaningless verbiage, but still no justification in declaring the volcano to be non-specified.

    Why should your default value of S=0 apply? Just because it gives the answer you want it to?

    Another major error, lack of scientific rigor on your part.

  184. kairosfocus

    GB: You are simply wrong. Discrete state is the standard definition of digital. KF

    LOL! If don’t understand the difference between two of the most basic terms it’s no wonder you can’t put together a cohesive argument.

  185. GinoB,

    I see that you are still confused- YOU need POSITIVE evidence that a volcano is specified.

    Yet your entire p[osition lacks positive evidence so stop talking about science as if it is something you know about.

  186. Joseph

    I see that you are still confused- YOU need POSITIVE evidence that a volcano is specified.

    No, I don’t. I can admit that the specification value S is unknown without additional outside evidence, i.e. the blueprint of the construction from the space aliens’ shop. That renders KF’s calculations meaningless if I have to guess at a value for S like he did.

    Where is ID’s POSITIVE evidence that a segment of a genome is specified? How do you objectively calculate the S value for any object?

  187. 187

    I understand the FSCO/I metric and that as a metric it is both historically and rigorously applicable, but the alien artifact scenario is something I use just to point out the absurd forms of ID denialism. Do we need to know the identity of the designers, their manufacturing techniques, or their mechanisms for application before we reach a finding that a phenomena is best explained by some kind of human-like ID?

    Of course not. Indeed, why would one be looking for tool & machine markings, or trying to find designers, production techniques or application processes before one even determines that the object is a good candidate for ID?

    The whole idea that product of non-human ID cannot be determined is, of course, nothing but a denialist ruse. That ID exists and leaves telltale signs is a fact as demonstrated by human ID. To claim that we cannot tell any other kind of ID by only looking at human ID is like saying we cannot tell any non-terrestrial products of erosion by only looking at terrestrial examples. Of course we can – it is inference to best explanation.

  188. 188

    GinoB,

    You seem to deliberately miss the point. There are things that have the appearance of design, but for which no external evidence is available, and the origins if which are not immediately known. To determine cases in which design is the best explanation is the purpose of ID.

    If you have blueprints of an alien spaceship, you don’t need ID. It’s like using fingerprint matching to catch a criminal when a dozen people saw him do it and someone got it on video.

    However, given the design inferences you’ve already rejected, there’s no reason to think that you’d accept design if you saw a spaceship and the blueprints. You would reject design and require a natural explanation because you’ve never observed aliens drawing blueprints or building spaceships.

    That’s what ID is solving for. But it will never be sufficient for you. You apparently think that design is a miraculous phenomenon that must be seen to be believed, while the natural origin of anything at all is a reasonable default explanation. You have no way out of that position. Trapped by your own arbitrary rules, you can never believe that anything was designed, ever, unless you’ve seen it designed and manufactured yourself.

    What it boils down to is that you believe only what you see, and cannot permit any inference to reach beyond it. That’s a very limited view of the world, but you must at least apply it consistently. If you only apply that limitation only to design, or only to biology, or apply it to everything except for instances of unexplained chemical abiogenesis or evolutionary change, then it becomes merely a capricious bias, not the result of true reason.

  189. ScottAndrews2

    GinoB,

    You seem to deliberately miss the point

    Not at all. The point is that IDers decided their Christian God created life, and feel the need to somehow scientifically justify their pre-conceived conclusion. So they spin real scientific research, cherry pick results, ignore the 99% that refutes them, create their own meaningless metrics like dFSCI. This is just so they can get their religious beliefs forced into public science classes.

  190. 190

    GinoB,

    I didn’t just say that you missed the point. I explained why, in detail. If you disagree, explain why. When you fall back to the IDers do this, that, etc., arguments, it indicates that either you did not read my post, did not understand it, or are unable to refute it.

    It’s foolish of me, but I’m helping you. I’m showing you how to discuss a subject reasonably. Or I am demonstrating to onlookers that you are unable or unwilling to. You decide.

  191. GinoB:

    Where is ID’s POSITIVE evidence that a segment of a genome is specified?

    Functionality- just as we have said for many years.

    Where is your position’s positive evidence for anything?

  192. Please be so kind as to reference any peer-reviewed science that refutes anything IDists have claimed.

    Or admit that you are just a confused bloviater.

    Oh and please present one mathematically rigorous metric that your position uses.

    That way we can compare and see who is bluffing coward and who has the data.

  193. ScottAndrews2

    I didn’t just say that you missed the point. I explained why, in detail.

    No, you didn’t. You just regurgitated the same hackneyed, already addressed 100x ID talking points Creationists have been using for years.

    When you can finally think for yourself and come up with something original, let us know.

  194. 194

    yawn

  195. GB:

    Sorry, FAIL.

    The decision of value on S is justified by objective criteria, namely an independent description that confines acceptable set members E to a narrow zone T in the set of abstractly possible configs, W. W must be at least big enough to swamp the Planck time Quantum state resources of the 10^57 atoms of our solar system across 10^17 s, or if we go up to the 1,000 bit threshold, the observable cosmos; creating a situation where the config space is so large that tit cannot be sufficiently sampled that any isolated,atypical zones are likely to be picked up by sampling based on blind chance and mechanical necessity.

    For instance, in the cases here, (i) an apparently random coin toss is assumed non specific, but a string of coins with ASCII code in English is specified, and (ii) biofunctional protein sequences from families, where such are known to be deeply isolated in AA sequence space, are again S = 1.

    If you CANNOT so specify on objective grounds of warrant, the default is S = 0. That means if you take a million coins in a string and toss them so they settle H/T at random, S will be zero. but if the coins are arranged in accordance with the ASCII code for a coherent work in English, we have every right to see this as a specified outcome, and to infer that Chi_500 will be much more than 1, so the outcome is best explained on the only empirically known causal force that can make that outcome reasonably likely on the gamut of our solar system: design. [Just as, would be the reasonable conclusion if you came across a coherent text in English online that required 143,000 or so ASCII characters, or about 25,000 words.]

    Why is that so hard for you to understand?

    Or, is that really: accept?

    And BTW, can you kindly show us, specifically — i.e. WARRANT your claim, just why the metric derived and explained and applied here, is “meaningless”?

    Namely:

    Chi_500 = I*S – 500, bits beyond the solar system threshold

    (Otherwise, it looks a lot like “meaningless” from you means I disagree with where it points, and cannot warrant my claims, but love to drum out a closed-mindedly dismissive mantra as though empty repetition creates reality. Do I need to quote my old grade school teachers on empty barrels and making noise?)

    I see as well some turnabout tactic projections on your part.

    I find it a bit rich for an advocate of a priori imposition of evolutionary materialism, which is now being indoctrinated in schools based on question-begging imposition [cf the four cases here on], to be making a false accusation about design thinkers that we wish to impose a doctrine in science education. But then, turnabout rhetoric is a commonplace these days on the part of evolutionary materialism advocates.

    FYI, the Discovery Institute CSC, nearest thing to any ID institution, is on public record, easily accessible, that ID is NOT to be taught in schools. Not that you seem to care to be fair or truthful about those you oppose, on track record here and elsewhere.

    I hardly need to bother to point out that the Creationists, are very aware that ID is quite different from their approach, and often have reservations or objections. But then, having poisoned he Creationist well through some very nasty tactics already, it is oh so rhetorically convenient to say “Creationism in a cheap tuxedo.”

    Then, when it comes to career-busting and the like, all I will say is that this year there were some pretty serious settlements on that, that went against the a priori materialists: Gaskell and Sewell.

    What is reasonable to be taught in schools is that scientific methods have strengths and limitations, set by the underlying issues in epistemology and logic, which are philosophical matters relevant to science education. This is a bit updated from but not materially different from what that fundy dummy creationist redneck yahoo, Newton, said in Opticks, Query 31, 300 years ago. A root- source discussion for what is usually called the scientific method in schools.

    if you ignore the issue of degree of warrant, you turn the science classroom into a propaganda exercise, for which there will be a huge bill to pay one of these days.

    GEM of TKI

    PS: And if you look at the draft course I have suggested, it defiantly is about INDEPENDENT (what that I is about) and free to access community based education, on the principle that ideologised monopolies in education are inherently dangerous.

  196. 196

    yawn

  197. 197

    Oops

    yawn

    Point taken. It takes two people to drag this out.

  198. kairosfocus

    The decision of value on S is justified by objective criteria, namely an independent description that confines acceptable set members E to a narrow zone T in the set of abstractly possible configs,

    Then show me this objective criteria and independent description that makes Mt. Pinatubo S = 0.

    You’re always rattling on about how you can objectively calculate these values for real world objects, but when called on it you can never actually do it.

  199. GB:

    You are playing selective hyperskepticism.

    Default S = 0 is saying in effect that we by default explain on chance and necessity (mechanical forces following lawlike necessity and/or stochastic processes) save where something else can be warranted.

    Which is YOUR side’s position, save that we do not beg the question and assume/impose a priori that this ALWAYS holds or MUST hold.

    This has been pointed out to you, repeatedly.

    But ignored.

    Can you justify the claim that S = 0 in all cases? If so, how, apart from quesiton-begging Lewontinian a prioris.

    Next problem.

    GEM of TKI

  200. I’ll repost here, since I never received an answer from you:

    Let us start here: give me an example of 500-100 bits of information arising at once, and the calculation.

    Otherwise, design has never been observed.

    And don’t say life. My genome contains a lot of information, but not greater than the universal probability bond MORE than that of my parents.

    KF: “to overturn, all that would have to be done is to provide reliable counter-examples.”

    Every time I provide such, you conclude either it is a designed experiment, or the result of design in nature. ID is unfalsifiable, because it is a self-defining inference and not a mechanism. If I produce an example of X amount of information arising naturally, you can (and have) conclude it is design in action because of the inference.

    Do you not get that it is impossible to rule out design?

  201. I see. You said you have an objective criteria and independent description for determining S, but you really don’t.

    You arbitrarily set S=0 not from any objective criteria but merely because it gave you the answer you wanted.

    On the plus side, your track record of blustering but failing to provide the calculations you claim you can do is still perfect.

  202. 202

    GinoB,

    S=0 means it’s a volcano! What the heck is it supposed to specify? Are you for real, or just pretending not to understand that?

  203. Clearly you knew by now that any common ground understanding was never the purpose of it’s original presence and appearance here on this board in the first place. In actual fact, common ground to an atheist means that you accept and believe every word that spews out of their mouth.

  204. Neither KF nor you has shown the claimed objective method for calculating the specificity value S.

    If you are trying to determine design, but arbitrarily set S=0 (meaning non design) as KF did here, your results are guaranteed to be worthless.

    I can easily believe you’re too slow to understand that.

  205. Scott,

    The question at 9.1.1.1 was: “Mt. Pinatubo in the Philippines is an andesitic island arc volcano. I suspect it may actually be a giant monument designed by space aliens.”

    Using the best calculation of ID, kairosfocus determined Mt. Pinatubo was a volcano by stating S=0 (“means it’s a volcano!”). So KF determined it was a volcano and not a monument by deciding it was a volcano.

    Really trivial example, but the hilarious circularity in the logic is exposed here!

    Now, anyone want to provide me an actual example of intelligent design, say 500-100 bits of information arising at once, and the calculation?

  206. 206

    “I’ll repost here, since I never received an answer from you”

    Dr Rec, you left a conversation with me where you didn’t respond to my answer to your question. Here is a link.

  207. Onlookers:

    It should by now be plain what is really going on.

    Five or six months ago, there was an orchestrated attempt to try to publicly discredit the central ID concepts, using the MathGRRL sock-puppet, and a wave of supporters. (This by the way is where the “CSI/FSCI/ Chi metric is meaningless” talking point comes from.)

    This failed, indeed, what it ended up doing is leading to the simplification and summary of CSI as measured by the log reduction of Dembski’s Chi expression:

    Chi_500 = I*S – 500, bits beyond the solar system threshold.

    Now, the further attempt is made to try to discredit the simplified expression.

    The talking point is that S is a question-begging subjective value that gives the result we “want.”

    This is being insisted on in the teeth of obvious and repeated correction:

    1 –> The first thing is why is S = 0 the default? ANS: Simple, that is the value that says we have no good warrant, no good objective reason, to infer that it is a serious candidate that anything more than chance and necessity acting on matter in space across time is at work.

    2 –> In the case of Pinatubo, that is tantamount to saying that however complex the volcano edifice may be, its history can be explained on it being a giant sized, aperiodic relaxation oscillator that tends to go in cycles of eruption from quiescent to explosive eruption depending on charging up, breaking through erupting, discharging and reblocking. In turn, driven by underlying plate tectonics. As SA just said: S=0 means it’s a volcano!

    3 –> In short, we are looking at an exercise in doing science, per the issue of scientific warrant on empirically based inference to best explanation that was put on the table for GB et al to deal with, and which they have studiously avoided addressing.

    4 –> Why that avoidance? ANS: because they are plainly deathly afraid that there may be matters that on good observational warrant are not explicable on chance plus necessity alone. That is, they want to get away with begging major questions by imposing Lewontinian a priori materialism, disguised as the “scientific” principle that scientific explanations must only be based on inference to naturalistic mechanisms, those of chance and necessity.

    5 –> but as was repeatedly laid out with examples, there is another class of known causal factors capable of explaining highly contingent outcomes that we do not have a good reason to expect on blind chance and mechanical necessity, thanks to the issue of the needle in the haystack.

    6 –> Namely, the cause as familiar as that which best explains the complex, specified information — significant quantities of contextually responsive text in English coded on the ASCII scheme — in this thread. Intelligence, working by knowledge and skill, and leaving characteristic signs of art behind.

    7 –> Notice, how we come to this: we see complexity, measured by the scope of possible configurations, and we see objectively, independently definable specificity, indicated by descriptors that lock down the set of possible or observed events E, to a narrow zone T within the large config space W, such that a blind search process based on chance plus necessity will only sample so small a fraction that it is maximally implausible for it to hit on a zone like T. indeed, per the needle in the haystack of infinite monkeys type analysis, it is credibly unobservable.

    8 –> Under those circumstances, once we see that we are credibly in a zone T, by observing an E that fits in a T, the best explanation is the known, routinely observed cause of such events, intelligence acting by choice contingency, AKA design.

    9 –> In terms of the Chi_500 expression that GB et al consistently fail to examine and explain as to why they say they find it meaningless:

    a: I is a measure of the size of config space, e.g. 1 bit corresponds to two possibilities, 2 bits to 4, and n bits to 2^n so that 500 bits corresponds to 3 * 10^150 possibilities and 1,000 to 1.07*10^301.

    b: 500 is a threshold, whereby the 10^57 atoms of our solar system could in 10^17 s carry out 10^102 Planck time quantum states, giving an upper limit to the scope of search, where the fastest chemical reactions take up about 10^30 PTQs’s.

    c: In familiar terms, 10^102 possibilities from 10^150 is 1 in 10^48, or about a one-straw sample of a cubical haystack about 3 1/2 light days across. An entire solar system could lurk in it as “atypical” but that whole solar system would be so isolated that — per well known and utterly uncontroversial sampling theory results — it is utterly implausible that any blind sample of that scope would pick up anything but straw; straw being the overwhelming bulk of the distribution.

    d: In short not even a solar system in the haystack would be credibly findable on blind chance plus mechanical necessity.

    e: But, routinely, we find many things that are like that, e.g. posts in this thread. What explains these is that the “search” in these cases is NOT blind, it is intelligent.

    f: S gives the criterion that allows us to see that we are in this needle in the haystack type situation, on whatever reasonable grounds can be presented for a particular case, noting again that the default is that S = 0, i.e. unless we have positive reason to infer needle in haystack challenge, we default to explicable on chance plus necessity.

    g: What gives us the objective ability to set S = 1? ANS: Several possibilities, but the most relevant one is that we see a case of functional specificity as a means of giving an independent, narrowing description of the set t of possible Es.

    h: Functional specificity is particularly easy to see, as when something is specific in order to function, it is similar to the key that fits the lock and opens it. That is, specific function is contextual, integrative and tightly restricted. Not any key would do to open a given lock, and if fairly small perturbations happen, the key will be useless.

    i: The same obtains for parts for say a car, or even strings of characters in a post in this thread, or notoriously, computer code. (There is an infamous case where NASA had to destroy a rocket on launch because a coding error put I think it was a comma not a semicolon.)

    j: In short, the sort of reason why S = 1 in a given case is not hard to see, save if you have an a priori commitment that makes it hard for you to accept this obvious, easily observed and quite testable — just see what perturbing the functional state enough to overwhelm error correcting redundancies or tolerances would do — fact of life. This is actually a commonplace.

    k: So, we can now pull together the force of teh Chi_500 expression:

    i] If we find ourselves in a practical cosmos of 10^57 atoms — our solar system . . . check,

    ii] where also, we see that something has an index of being highly contingent I, a measure of information-storing or carrying capacity,

    iii] where we may provide a reasonable value for this in bits,

    iv] and as well, we can identify that the observed outcome is from a narrow, independently describable scope T within a much larger configuration space set by I, i.e. W.

    v] then we may infer that E is or is not best explained on design according as I is greater or less than the scope 500 bits.

    10 –> So, we have a metric that is reasonable and is rooted in the same sort of considerations that ground the statistical form of the second law of thermodynamics.

    11 –> Accordingly, we have god reason to see that claimed violations will consistently have the fate of perpetual motion machines: they may be plausible to the uninstructed, but predictably will consistently fail to deliver the claimed goods.

    12 –> For instance, Genetic Algorithms consistently START from within a zone (“island”) of function T, where the so-called fitness function then allows for incremental improvements along a nice trend to some peak.

    13 –> Similarly, something like the canali on Mars, had they been accurately portrayed, would indeed have been a demonstration of design. However, these were not actual pictures of the surface of Mars but drawings of what observers THOUGHT they saw. they were indeed designed, but they were an artifact of erroneous observations.

    14 –> Latterly, the so-called Mars face, from the outset, was suspected to be best explained as an artifact of a low-resolution imaging system, and so a high resolution test was carried out, several times. The consistent result, is that the image is indeed an artifact. [Notice, since it was explicable on chance plus necessity, S was defaulted to 0.]

    15 –> Mt Pinatubo is indeed complex, and one could do a sophisticated lidar mapping and radar sounding and seismic sounding to produce the sort of 3-D models routinely used here with our volcano, but the structured model of a mesh of nodes and arcs, is entirely within the reach of chance plus necessity, the default. There is no good reason to infer that we should move away from the default.

    16 –> If there were good evidence on observation that chance and necessity on the gamut of our solar system could explain origin of the 10 – 100 million bits of info required to account for major body plans, dozens of times over, there would be no design theory movement. (Creationism would still exist, but that is because it works on different grounds.)

    17 –> If there were good evidence on observation that chance and necessity on the gamut of our observed cosmos could account for the functionally specific complex organisation and associated information could credibly account for the origin of cell based life, there would be no design theory movement. (Creationism would still exist, but that is because it works on different grounds.)

    18 –> But instead, we have excellent, empirically based reason to infer that the best explanation for the FSCO/I in body plans, including the first, is design.

    19 –> Fair comment: the reason for the controversy is not that there is overturning empirical observation based evidence [the evidence is actually strongly supportive], but that the design theory movement cuts across institutionally dominant evolutionary materialism, which is resisting the loss of its control over science and science education.

    20 –> The old guard dies hard, but in the end a revolutionary new paradigm prevails one retirement, and one funeral at a time. That’s why it takes a generation or two.

    GEM of TKI

  208. To bat the spin-bowling just above for four, cf here, onlookers. And, BTW, any case of an ASCII coded text in excess of 72 characters where we are looking at coherent text in English, is beyond the FSCI threshold and is a case where S is 1. This example has been presented over and over and over, but has been insistently ignored by objectors desperate to find an occasion to dismiss what is staring them in the face.

  209. Let me rephrase,

    “Now, anyone want to provide me an actual example of biological intelligent design, say 500-100 bits of biological information arising at once, and the calculation?”

    That humans can create information isn’t what is being debated here, kairosfocus.

  210. Pinatubo is adequately explained on chance and necessity, so it is. The posts in this thread are not. Neither is the digital code in the living cell. A key feature of both has one empirically observed cause: intelligence.

  211. That the only known cause of FSCI is intelligence is. And, I think you need to look at the work of Venter and co as adequate proof of concept of the intelligent design of life.

  212. That doesn’t answer my question.

    Venter copied a genome, and inserted some phrases. The phrases are biologically functionless, so they are not biological information. Just human language on a new template.

    Can you provide me an actual example of biological intelligent design, say 500-100 bits of biological information arising at once, and the calculation?

  213. Onlookers, notice how GB has had links to calculations and results but still denies that the exist and then uses that as a basis for willfully false accusation.

    Cf here for a handy summary, notice the cases for protein families.

    Next time GB makes a similar snide dismissal, do recall this.

    GEM of TKI

    PS: Dr Rec makes a claim that suggests my ducking out. Unfortunately, until UD gets back a chrono tracking feature it is just not possible to follow complex threads with any reliability, and due to the pace of new threads, old ones are v hard to keep track of.

  214. Also it is clear by using examples of artificial selection that tehre are limits to the amount of phenotypic plasticity allowed.

    Artificial selection made American corn (maize) out of a wild grass. Maize cannot even reproduce itself without human intervention.

    Toy and miniature dogs are entirely the product of artificial selection, and the phenotypic differences are far greater than the differences between fossil species. If we did not have DNA evidence to confirm that dogs and wolves are subspecies of each other, we would asssume they are different species.

    Many fossil lineages are linked by morphological similarities exceeding that of dog breeds.

    There is a series of fossils demonstrating the incremental transformation of jawbones into inner ear bones.

    Please feel free to quantify exactly what morphological changes are unreachable by incremental changes in gene regulation.

  215. Venter, by choice, assembled a genome of considerable length, at 2 bits per base. You may want to do a redundancy estimate but the result is plain and plainly proof of concept; save to those determined not to see it on whatever excuse. GEM of TKI

  216. KF, the simple fact is you defined the genomes of life forms as containing your meaningless metric dFSCI, just like you defined the specificity of a volcano to be S=0. Then you claim the thing your defined into existence as evidence for design.

    Completely circular, completely useless, completely typical for an incompetent bumbler trying his best to fool himself.

  217. Venter did NOT design a genome. He copied it. If I copy and paste your post above, did I generate more information?

    And maybe I’ll rephrase again:

    1) Outside of human design, can you provide me an actual example of biological intelligent design, say 500-100 bits of biological information arising at once?
    2) Provide the calculation.

  218. 218

    DrREC,

    Using the best calculation of ID, kairosfocus determined Mt. Pinatubo was a volcano by stating S=0 (“means it’s a volcano!”). So KF determined it was a volcano and not a monument by deciding it was a volcano.

    Really trivial example, but the hilarious circularity in the logic is exposed here!

    S = 0 because there is no reason to suspect specification. It is not circular. Rather, it errs on the side of caution, away from a false positive. Do you see any way that the logic could circularly infer design? That would be cause for concern.

    Is it absurd and comical? Yes. We are negotiating logic to help us determine which is designed, Mount Pinatubo or a perfect 1/1000 scale replica of it, a watch, a molecular self-replicator which contains blueprints of both itself and every other component in the system of which it is part, or a machine that constructs and monitors orbital spiderwebs.

    This is where I see the failure of ID. If anyone lacks or deliberately tunes out the simple human intuition that makes such determinations, then it is unlikely that they could acquire the same knowledge through logic, as the former is a possession of most children and the latter requires far more effort. It’s reason to assist those who have already rejected reason. It does not descend into absurdity. It begins there.

  219. kairosfocus

    Pinatubo is adequately explained on chance and necessity, so it is.

    The demonstrate it. Show your objective calculations fir its specificity.

  220. But you just reinforce my point. The design inference is subject to false positives. One never has the perfect scan, and without knowing the history of an object, and without having similar objects whose history is known, the inference is dubious.

    One trouble with applying the design inference to living things is the assumption that the current state of a population is specified.

    No mainstream biologist thinks genomes are specified. There is no observational evidence that variation has foresight or that there is any goal intended.

    There are countless examples of populations that went extinct because natural selection was unable to provide an adaptive change in time.

  221. ScottAndrews2

    S = 0 because there is no reason to suspect specification

    That is a completely subjective judgement on your part. KF claims to be able to have an objective method for determining S.

    We’re right back to “it looks designed to me”, which has zero validity or usefulness.

    Do you see any way that the logic could circularly infer design? That would be cause for concern.

    I see a very easy way. You define the arrangement of nucleotides in a genome as having “FSCI”, then say the fact that it has FSCI indicates design.

    It’s not only a cause for concern, it’s one of the many reasons the whole stupid “FSCI” argument got rightly rejected by mainstream science.

  222. Demonstrate that nature, operating freely, can produce a volcano?

    Get back on your medication…

  223. 223

    GinoB,

    ID infers design, leaving a wide margin of error. You are demanding that KF demonstrate that a volcano was not designed.

    Let me say that again. The statement is so irrational that it gives the mind pause.

    You are demanding that KF demonstrate that a volcano was not designed.

    Clearly you do not believe that the volcano was designed. If, for reason, KF irrationally yielded to your demand and attempted to show that it was designed, you would also find fault.

    Having determined that you shall pester KF indefinitely for not demonstrating that the volcano was designed, and knowing you would certainly object to the statement that it was, what is KF to do? You have made plain that no answer, rational, irrational, or otherwise, will end your interminable, insatiable need to argue for the sake of arguing.

    Such is the behavior of a troll. There’s no nicer way to say it. I could think of a few worse. The position you have taken demonstrates beyond a doubt that you have no purpose other than to argue and harass.

  224. Right he synthesized it from a computer record but he added “water marks”, right?

    1) Outside of human design, can you provide me an actual example of biological intelligent design, say 500-100 bits of biological information arising at once?

    Besides the origin of life?

    2) Provide the calculation.

    If it is by design then there wouldn’t be any calculation.

  225. No, the evidence says genomes of living organisms contain fsci. And the only thing known to account for it is designing agencies.

  226. Do we need to know the identity of the designers, their manufacturing techniques, or their mechanisms for application before we reach a finding that a phenomena is best explained by some kind of human-like ID?

    Of course not.

    Assuming the object is sufficiently similar to objects made by humans. But no one has responded with a general metric for determining the origin objects that are ambiguous, nor has anyone really tackled the problem of false positives.

    The real problem is that we know the mechanism for the inheritance of variation in living things, and there is no designer in sight, nor is there the slightest trace of evidence that variation exhibits foresight.

  227. For example, explain how the explanatory filter would deal with this:

    http://www.environmentalgraffi.....review.jpg

  228. 13.1.1.1.2 Joseph

    “Right he synthesized it from a computer record but he added “water marks”, right?”

    Right, and those water marks don’t do anything biological. No new biological information.

    REC 1) “Outside of human design, can you provide me an actual example of biological intelligent design, say 500-100 bits of biological information arising at once?

    JoeG: “Besides the origin of life?”

    The origin of life is now empirical? Did you observe it? Did it proceed from proto-life with a spontaneous gain of more that 500 bits of information?

    REC 2) Provide the calculation.

    JoeG: If it is by design then there wouldn’t be any calculation.

    Almost identical to what KF says. Once you know it is designed, it is designed.

  229. 229

    Petrushka,

    The real problem is that we know the mechanism for the inheritance of variation in living things, and there is no designer in sight, nor is there the slightest trace of evidence that variation exhibits foresight.

    Of course we know the mechanism for the inheritance of variation.

    Presumably you mean diversity in its present state.

    If you know of a mechanism that can produce anything in biology that gives even the eyeballed appearance of having been designed, then explain the origin of such a thing in terms of that mechanism. If that mechanism deals in specifics, then be specific.

    I have issued that simple challenge ad infinitum to no response. In fewer words, if you can explain origins, then explain an origin.

  230. ScottAndrews2

    ID infers design, leaving a wide margin of error. You are demanding that KF demonstrate that a volcano was not designed.

    No, I am demanding that he demonstrate the objective methodology he claims exists for determining design from non-design. Mt. Pinatubo was just an example I picked at random.

    He obviously can’t do it, and you can’t do it either.

    You constant defense of him with meaningless sidebars and accusations is the behavior of a troll. There’s no nicer way to say it. I could think of a few worse. The position you have taken demonstrates beyond a doubt that you have no purpose other than to argue and harass.

  231. Only because you defined the genomes of living organisms to have FSCI.

    Completely circular, completely worthless.

  232. Our ability to be confident of the design of the cilium or intracellular transport rests on the same principles to be confident of the design of anything:

    All you have done is restate the fact that an assembly of parts does something. You have said nothing about the history of the assembly.

    We know that there is an incremental path from jawbones to inner ear bones, because we have preserved specimens of the incremental steps. We don’t have proof that the increments were undirected, but we have independent observation of equivalent changes in morphology brought about by the selective breeding of wolves to dogs and foxes to tame foxes and wild grass to corn.

    Behe argues in the realm of making novel proteins, but there are no novel proteins required to produce the spectrum of vertebrates. Nearly all the differences separation one vertebrate from another are in regulatory genes.

    So the fact that new protein domains are rare is not a particularly strong argument against the common descent of vertebrates (which is probably why Behe accepts the common descent of vertebrates).

  233. Both Lenski and Thornton have demonstrated three step creations of new functions involving an intermediate neutral (non-selected) step. Neutral drift has been a part of population genetic theory for half a century and has now been experimentally demonstrated.

  234. OK, outside of human design no one has witnessed 500-100 bits of BI arising at once.

    And probabilities only apply to chance and necessity. Otherwise it is like calculating the probability of Stonehenge or calculating the odds of s designer designing something he/ she/ it can design.

    Once we know it is designed we study in that light so we can understand it.

  235. Wrong again, as usual.

    The OBSERVATION is that living organisms contain fsci.

    The ISSUE is how to explain it.

    YOU think chance and necessity can produce whereas we say all observations point to intelligent agencies as the only source.

    WE can support our end and are waiting on YOU to support yours.

  236. GinoB,

    Given the correct geological conditions volcanos form.

    Now if a volcano formed in the absence of those conditions then we may have a reason to investigate and may find an alien craft.

  237. Petrushka:

    For example, explain how the explanatory filter would deal with this:

    http://www.environmentalgraffi…..review.jpg

    It would say it is a picture. Most likely taken by an agency we call “human”.

    As for what’s in the picture, well we would have to go there, investigate and put ALL the data into the EF.

  238. 238

    DrREC,

    You reject the inference that living things were designed, because every instance of design from which we draw the inference is human, and no human design which would qualify as ID is biological. (None that I know of, anyway.) Point taken. Fair enough.

    And yet the separation between what is observed and what is inferred is always the reason for inference. Once you observe a thing, it is no longer an inference. Do you reject the concept of inference altogether?

    I am sure that you do not. So how do you formulate your line between what is a valid inference and what is not? It has the appearance of being arbitrary. You reject it because you don’t like it. If that is not the case, what is your basis?

    Regardless, the origin of life and of diversity is unobserved. If you reject the inference of design drawn from comparison to known design, then from what do you infer the belief that the components of life can spring from chemicals, lacking consciousness and yet endlessly driven to improve themselves? Let’s say that the design inference is weak. Is the evidence supporting your conclusion stronger or weaker?

    When you reject one premise on the bounds that the evidence is weak and embrace another for which there is none whatsoever along with mountains of reason for doubt, how can one not conclude that it is simply your preference? There’s nothing wrong with it. Why not just accept it?

  239. As for what’s in the picture, well we would have to go there, investigate and put ALL the data into the EF.

    Feel free to do it as a hypothetical exercise. What kind of data would be relevant? what instruments would you want to have? What would you measure and why?

  240. Thank you for your honesty JoeG.

    “outside of human design no one has witnessed 500-100 bits of BI arising at once.”

    Which renders ID a theory in search of an observation. In other-words, a pitiful pile of nothing.

    Anyone care to prove me wrong on this assessment. ID has never been observed.

  241. “every instance of design from which we draw the inference is human, and no human design which would qualify as ID is biological. (None that I know of, anyway.) Point taken. Fair enough.:

    Thanks. I agree.

    The point taken is that the ‘inference’ overreaches. Pathetically and dramatically.

  242. Joseph

    The OBSERVATION is that living organisms contain fsci.

    The ISSUE is how to explain it.

    It’s easy to explain. FIRST came the observation that genomes were complicated, and involved in complex chemical reactions to create proteins.

    THEN came you guys who said “Gee, let’s give that observed complexity a fancy, sciency sounding name – FSCI”

    THEN you make the completely circular claim “It has FSCI, it must be designed!”

    Why don’t you show us where FSCI was a recognized scientific metric before you ID guys came up with it and used it in your circular argument. A link will do.

    You lose again Joseph. Stick to your YEC baraminology.

  243. ScottAndrews2

    If you know of a mechanism that can produce anything in biology that gives even the eyeballed appearance of having been designed, then explain the origin of such a thing in terms of that mechanism. If that mechanism deals in specifics, then be specific.

    I have issued that simple challenge ad infinitum to no response. In fewer words, if you can explain origins, then explain an origin.

    You’re a flat out liar. You’ve had that challenge answered numerous times, had scientific papers with that exact thing placed under your nose repeatedly. but still you lie about it.

    Here’s yet another one for you to lie about and say doesn’t exist

    Body plan innovation in treehoppers through the evolution of an extra wing-like appendage

    Abstract: Body plans, which characterize the anatomical organization of animal groups of high taxonomic rank, often evolve by the reduction or loss of appendages (limbs in vertebrates and legs and wings in insects, for example). In contrast, the addition of new features is extremely rare and is thought to be heavily constrained, although the nature of the constraints remains elusive. Here we show that the treehopper (Membracidae) ‘helmet’ is actually an appendage, a wing serial homologue on the first thoracic segment. This innovation in the insect body plan is an unprecedented situation in 250?Myr of insect evolution. We provide evidence suggesting that the helmet arose by escaping the ancestral repression of wing formation imparted by a member of the Hox gene family, which sculpts the number and pattern of appendages along the body axis. Moreover, we propose that the exceptional morphological diversification of the helmet was possible because, in contrast to the wings, it escaped the stringent functional requirements imposed by flight. This example illustrates how complex morphological structures can arise by the expression of ancestral developmental potentials and fuel the morphological diversification of an evolutionary lineage.

    There you go troll – a reconstruction of the evolution of the treehopper’s helmet (including genetic pathways involving Dll and hth genes, and nubbin protein) showing it is a modified T1 dorsal appendage with a bilateral origin. The primary use (and selection force) of the helmet is predator defense through mimicry, which is covered in other papers.

    Go on troll, make yourself look like a fool again and tell us ” but they’re still BUGS!”

    It’s obvious you’re just a Creationist troll not interested in any scientific discussion. Go crawl back under your bridge you lying troll.

  244. DrREC:

    I don’t understand: why should the 500 bits “arise at once”?

    ID (in the sense of intelligent design, the process of design) is constantly observed, in human design.

    ID, in the sense of ID theory, cannot be observed, because theories are not facts.

    As usual, darwinists abuse epistemology for their propaganda.

  245. GB:

    False, FAIL again.

    Work your way, step by step through the discussion above, and show us the circle you assert.

    Actually, you cannot; which is why you ave resorted to drumbeat repetition of already falsified and irresponsible assertions.

    In addition, complexity exists, high contingency exists, and information exists, info that may actually function in ways that crucially depend on the specific configuration of elements.

    Posts in ASCII text as are all over this thread demonstrate such functionally specific complex information as an empirical reality. The underlying computer programs that enable this blog to work and your PC to work, especially down at machine code level, demonstrate that algorithmically functionally specific, complex digital information is an empirical reality.

    These are observable facts, not assumptions.

    Now, you show your incivility by resorting to repeating the mantra, meaningless [and I note resorting to namecalling] in the teeth of step by step presentation of the meaning above, instead of (per specific request) SHOWING what is “meaningless” in that if you could. And FYI, even if I were in error, that would not imply meaninglessness.

    And, I am not in error, just you have a handy drumbeat dismissive word handed down to you by the sockpuppet MG — if you are not simply another manifestation of the same sockpuppet.

    In short, your rhetorical tactic is to repeat the assertion and demand demonstration of the opposite, while trying to drag the discussion down into the gutter of namecalling. (This aspect, I formally warn you to cease and desist from henceforward.)

    Sorry, FAIL.

    You have claimed not mere error but meaninglessness.

    You therefore need to show, per duties of care, that the FSCI concept is something like a square circle, i.e inherently impossible by reason of self-contradiction.

    THAT, YOU HAVE FAILED TO DO, BUT HAVE RESORTED TO THE NOW FAMILIAR TACTIC OF TRYING TO CREATE PERCEIVED CREDIBILITY BY DRUMBEAT REPETITION.

    That in itself tells us a lot about where the balance of credibility and warrant lie.

    Going on, for the sake of the onlooker, let’s pause to note that FSCI is simply a descriptive term, a sub-set of complex, specified information where the specification is based on observed function that is dependent on key-lock fitting of the right components. Car parts are like that, keys and locks are like that, software is often like that. (I gave the example of the most expensive comma in history, the one that blew up a rocket that went off course.)

    This is patently not self-contradictory.

    That which is empirically observable is possible, and that which is possible is by direct demonstration of existence, not impossible.

    Let’s hear OOL researchers Orgel and Wicken on this, in the 1970′s as they wonder at the functionally specific and complex wiring diagram — have you ever build a complex electronic or mechanical system from parts, step by step according to a layout and wiring diagram? — organisation and associated information of the living cell. This is of course from the same IOSE introduction page you have clearly not bothered to read despite invitation:

    orgel, 1973: . . . In brief, living organisms are distinguished by their specified complexity. [--> Which specification is in the context of requisites and organisation of biological function] Crystals are usually taken as the prototypes of simple well-specified structures, because they consist of a very large number of identical molecules packed together in a uniform way. Lumps of granite or random mixtures of polymers are examples of structures that are complex but not specified. The crystals fail to qualify as living because they lack complexity; the mixtures of polymers fail to qualify because they lack specificity. [[The Origins of Life (John Wiley, 1973), p. 189.]

    Wicken, 1979: ‘Organized’ systems are to be carefully distinguished from ‘ordered’ systems. Neither kind of system is ‘random,’ but whereas ordered systems are generated according to simple algorithms [[i.e. “simple” force laws acting on objects starting from arbitrary and common- place initial conditions] and therefore lack complexity, organized systems must be assembled element by element according to an [[originally . . . ] external ‘wiring diagram’ with a high information content . . . Organization, then, is functional complexity and carries information. [--> See the roots of the descriptive summary: functionally specific, complex organisation and associated information?] It is non-random by design or by selection, rather than by the a priori necessity of crystallographic ‘order.’ [[“The Generation of Complexity in Evolution: A Thermodynamic and Information-Theoretical Discussion,” Journal of Theoretical Biology, 77 (April 1979): p. 353, of pp. 349-65.]

    Those fundy dummy creationist origin of life researchers! how dare they speak of specified complexity and functional complex organisation on wiring diagrams! How dare they mention design and selection!

    (Onlookers, an excellent definition of intelligent design is purposefully directed choice contingency and resulting configuration. The intent of Wicken of course was to hope to warrant that “natural” selection has the requisite capacity, this has failed across 30 years since.)

    Now, too, blatantly, the well-known info capacity metric I = – log p is not only not contradictory, it is a key component of the basis for modern information theory.

    However we need more than that, as this Hartley-Shannon metric peaks for a flat random meaningless sequence. Real, functional information invariably embeds redundancy so its use of symbols constrained by meaningful rules is not going to be on a flat random statistical distribution. That’s why we can easily tell (a) meaningful phrases in English ASCII text, from (b) ewghegbweab, meaningless random text strings.

    That is where a metric that brings to bear the observationally warranted inference that functional or similar specificity is at work, is useful, by employing a well-known technique, the dummy variable that records a judgement justified on objective grounds.

    In short, as already explained: if an object can be accounted for on processes of blind chance and necessity acting on matter and energy in plausible initial conditions, then S defaults to zero. (The metric is used in the context of the explanatory filter approach to empirical investigation of credible causal explanations, per aspect of an object, system, process or phenomenon etc.)

    It is when that cannot reasonably be done that S = 1, especially if we can show the key-lock fit to function pattern by the effects of perturbing or randomly varying parts or similar process.

    Since information carrying capacity as measured in bits, say, n bits, immediately implies a space of possible configs, 2^n, it is then useful to assign a threshold for sufficiently complex that functionally specific, narrow clusters, T, are deeply isolated to a degree that available material resources and blind search possibilities cannot reasonably find such deeply isolated zones.

    The gamut of choice is in the first instance, our observed solar system of some 10^57 atoms.

    Across 10^17 s, a typical estimate of the order of magnitude of the possible age, we have 10^102 Planck time quantum states as the upper limit of change for the atoms. In addition, as an empirical fact, it takes ~ 10^30 PTQS’s to carry out the fastest, ionic chemical reactions. So, we have a threshold of 500 bits which is 48 orders of magnitude beyond the limit of what the solar system — our practical cosmos for chemical interactions — can do.

    Onlookers will observe that the scope of search vs scope of possibilities challenge was explained, in terms of a solar system [not even a needle] in a haystack search. Converting to those familiar terms, we are looking at taking a blind one-straw sample from a cubical haystack three light days across. Sampling theory very firmly tells us that such a sample will reliably pick a case from the overwhelming bulk of the distribution of possibilities, not from deeply isolated atypical zones. Such deeply isolated zones, AKA islands of function, are practically unobservable on the scope of a blind search using the resources of our solar system.

    If you step up to 1,000 bits, this would isolate a search on the scope of the 10^80 or so atoms to more than 150 orders of magnitude.

    So, it is sensible to test for whether we are beyond a reasonable scope of search. That is what the 500 bit threshold is doing; which is of course not meaningless.

    Moreover, none of the elements in the expression:

    Chi_500 = I*S – 500, bits beyond the solar system threshold

    . . . is a denial of any of the other terms, nor is subtraction an operation that imposes contradictions.

    Further to this, the 500 is a threshold in bits, and once the information metric is measured in bits, bits are being subtracted from bits, the dummy variable parameter having no units.

    We may then directly read the equation:

    Chi_500 = I*S – 500

    1: Chi_500 is a metric that takes the following value, based on certain mathematical operations and is also rooted in associated empirical investigations, observations and measurements that are required to apply it in a real world case.

    2: Where I is a measure of information-carrying capacity arrived at by standard means for an object of interest, in bits, and

    3: Where also, the object is empirically and/or analytically warranted to show functional specificity,

    4: Also, where we are beyond a 500-bit threshold set based on the atomic state capacity of the solar system’s 10^57 atoms,

    5: then we may assign a value to Chi_500 of bits beyond the relevant threshold.

    6: Where also, the utility of that value, once it is positive, is that we have a quantitative criterion for identifying that the best explanation of a given aspect of a given object of interest in view, is best explained on design, not blind chance and mechanical necessity.

    7: Which is directly subject to empirical test based on objects of known causal provenance that can be measured, the ASCII text of web pages being a particularly convenient case that underscores the empirical reliability of this metric and the inference based on it.

    In short the expression is exactly not meaningless, and is subject to empirical test. The Internet is a standing demonstration of its empirical reliability in cases where we know the causal story.

  246. KF:

    GinoB is obviously here to disturb, not to discuss. But he is a good example of the irrational propaganda of the worst darwinists, so I would not complain after all.

  247. Dr REC:

    This is beginning to sound like the recent objection that an inconveniently discrete state complex system is not digital.

    Sorry, direct observation of design, and of techniques that show design of life forms, is proof of concept that intelligences can plainly design life forms.

    That Venter was able to snip out and embed genome segments and watermarks shows the relevant technology at work. yes, they need to get to a Genome compiler at some point, but that is a matter of detail, not the fundamental capacity to manipulate molecular components to assemble a living cell.

    Which, actually is a case of proving by inspection that engineers can engineer.

    This should net even be a issue.

    As to, can engineers produce a system of complexity beyond 500 – 1,000 bits, that is obvious, by direct inspection.

    This sounds like objecting for the sake of objecting, in a sort of scorched earth, bitter retreat strategy.

    All it does in the end is it demonstrates and unreasonable attitude.

    Let’s do a bit of logical skeletonising:

    1: Engineers and others routinely produce artifacts with 500 – 1,000 or more bits of functionally specific complex information.

    2: Engineers routinely produce such objects with features in the nanometre to micrometre range, and indeed a nanomachine technology is emergent

    3: Engineers and chemists routinely synthesise complex, biofunctional, highly specific organic compounds, often termed drugs.

    4: Genetic engineering is a reality, and indeed an industry.

    5: Venter has applied these and related techniques to assemble a novel genome, snipping, splicing, adding watermarks etc.

    6: This has been shown to work in the context of the living cell.
    _______________________________

    7: It is possible, with future development for these technologies to be brought together to create artificial life forms through intelligence.

    8: That is Venter et al have provided proof of concept of the ability of intelligent designers to implement artificial life forms, by intelligent design.

    9: At least, to the reasonable mind.

    (BTW: Have you any proofs that the only possible intelligences are human, given say what beavers do, as in it seems that beaver dams manifest complex specified functional organisation adapted to particular circumstances? And, given the fine tuning of the observed cosmos, and its credible beginning — i.e its radical contingency, do you have any proof that an extra cosmic, necessary being that is intelligent, purposeful and powerful enough to build a cosmos, is an impossibility?)

    Thanks for letting us know your attitude.

    GEM of TKI

  248. P:

    More sadly revealing scorched earth bitter retreat tactics.

    We have relevant technologies, and can design and develop more if necessary. We have relevant analytical techniques.

    (I suggest you take a pause and read here on and here too. You are not dealing with ignoramuses that do not know how to carry out a scientific investigation. People who object to the imposed a priori evolutionary materialism are not ipso facto ignorant, stupid, insane or unduly wicked.)

    The above discussion on what goes into the Chi_500 equation and its link to the empirical investigatory context shows what would be required.

    Scientific investigations are after all artifacts of design.

    GEM of TKI

  249. PS, I would laugh if it were not so sad. S = 0 is the default, namely, it is the default that blind chance and mechanical necessity are able to create phenomena. It is only in cases where we can warrant that this is not plausible that design is a serious candidate on signs of design. Of course, what GB et al do not want to admit is that they really want to lock out that possibility that S = 1, by imposing a censoring a priori materialist redefinition of science, such as we can see here on. Anyway, what is needed to be justified is on a case by case basis why it is inferred that S = 1. That is shown above. A reasonable person would address that instead of trying to fixate on the default that is his own position, save for refusing to lock out the possibility that S = 1. Imagine, trying to justify that, in a context where we do empirically know — Paricutin [sp] in Mexico — that volcanoes form naturally, the best explanation of a volcano is just that which has been observed to produce them.

  250. PS: A beach form, again, is like Pinatubo: generally best explained on natural forces, though we may have the case of artificial beaches, which MAY in some cases show features that show origin in art rather than chance and necessity. For instance, groynes, artificial reefs, etc. Those are abundantly amenable to empirical investigation, and in most cases, as a light tackle surf fisherman, require no more sophisticated equipment than eyeball mark 1. (BTW, dumped sand beaches tend to not have a natural distribution of sand particles, after all sand was displaced form where it naturally goes. hence the messing up of water clarity on beaches in Florida.) Remember, we investigate per aspect on empirically tested reliable signs and compose the overall causal account from that.

  251. PPS: Bow beach is a shingle beach at the foot of a cliff in Cornwall, UK. The Google maps overhead shot looks typical of beach forms, the obvious artificial feature is the road back of the cliff. Of course, it is possible to engineer an object to look natural, but the design explanatory filter was deliberately not designed to detect this, it is looking for features that flag the un-natural, or artificial, not for features that mimic the natural successfully. but, often art imitating life will be imperfect on close inspection and will be revealed by those features that flag art not nature.

  252. This is beginning to sound like the recent objection that an inconveniently discrete state complex system is not digital.

    And there you go again, kf, as soon as my back is turned.

    What on earth is “inconveniently discrete”? You seem determined to construct this straw man that I and others deny ID because we deny that the information in life is “discrete” or “digital”. I have denied neither, although I did object, and still do, to the characterisation that information transfer in life is “digital base 4″, but as I’ve said over and over again, indeed it is why I joined this conversation, that objection has got nothing to do with the problems I see with ID as is completely evident from the fact that I am perfectly willing, nay enthusiastic, about the concept that regulatory gene networks work in digital manner.

    So will you, now, please, retract your repeated straw man insinuation that the idea that information transfer in life is “inconveniently” digital has anything to do with the argument that ID is fallacious.

    It doesn’t. In fact it wouldn’t even matter if the information transfer in life were analog (as some of it is) – the fact is that no-one, certainly not me, denies that information transfer occurs in life, that cells contain information, and that that information is, inter alia, stored as sequences of discrete molecular units, and information transfer processes can be considered digital.

    You are very keen, kf, to object when someone else, in your view, misrepresents your argument. You also, repeatedly, misrepresent other people’s, and, moreoever, ascribe to them arguments they simply have not made.

    You have accused those people, in hysterical terms, of “BLOOD LIBEL!” And yet, when one of those people, who did not even take part in the conversation, jokingly (complete with wink smiley) makes a comment about “British libel laws” – he’s banned.

    This is hypocrisy, kf, and you are doing it again.

    Let me repeat, in case you are still unclear:

    There is nothing “inconvenient” to evolutionary theory about the observed fact that information transfer processes in living things and systems is involves arrangements of discrete entities, nor is there anything “inconvenient” about the fact that what we might call “digital switching” is involved. And if the term “digital base N” is used to describe alphabetic information storage systems with N possible elements, then “digital base 4″ is a reasonable way to describe polynucleotides.

    None of that is the least “inconvenient” for evolutionary theory, indeed it underlies the principles of genetics.

    I look forward to your retraction.

  253. It’s not like Elizabeth needs defending but….

    Richard Dawkins: River out of Eden – 1995

    Chapter One: The Digital River.

    ….just sayin’

  254. Elizabeth:

    I am happy that you agree on those fundamental points. I will not enter your personal discussion with KF, but I believe that we can agree on many things, although I have to remind you that other darwinists here have many times denied even those basic concepts.

    So, let’s see where we agree. You can confirm or not.

    no-one, certainly not me, denies that information transfer occurs in life

    That’s fine. I will limit the discussion, for the moment, to protein coding gene information. So I suppose you agree:

    a) That in protein coding genes there is information about the corresponding protein sequence (some deny even that)

    b) That such information is symbolic, in the sense that it is coded by a symbolic code, called the genetic code

    c) That the genetic code is a digital base 4 code, organized in three charatcter “words”, for a total of 64 word values, corresponding in a redundant “many-to-one” mapping to the 20 AAs and to the stop command

    d) That there is no known biochemical law that connects the symbolic values in the codons to the corresponding AAs

    e) That the physical connection between the gene and the protein if made only by the transcription and translation apparatus

    f) That specific information about the genetic code is independently embedded in the structure of the 20 aminoacyl tRNA synthetases, and that such specific information is the key to decoding the information in the protein coding genes. IOWs, we find the information about the genetic code independently in two dofferent parts of the cell: the protein coding genes (written according to the genetic code) and the 20 aminoacyl tRNA synthetases (structured so that they can correctly decode the coded information)

    g) That the information in protein coding genes is exclusively about primary sequence, and therefore the search space for that information in any random system acting on the genes is the sequence search space

    h) That the relation between sequence, structure and function in proteins is very complex, and, while being essentially a necessity relationship (depending on biochemical laws), it is at present mostly beyond the calculation abilities of us humans

    Well, I would like to verify with you these points. None of them is essentially an ID argument, but they are obviously important points for the ID theory.

    I am afraid that, if you disagree with any of them, discussion will always be chaotic. So, if you disagree, please try to explain clearly where and why.

    If, instead, you agree, I would appreciate if you could simply tell us at least some simple and basic points about “the problems you see with ID”, and I will be happy to comment on those problems, trying to use a common language.

  255. Dr Liddle:

    Please.

    It seems a painful but necessary, fairly frank, comment is in order.

    I have summarised an exchange that took place in public, and it seems accurately. That is certainly not going behind your back.

    Let’s focus: that digital means discrete state as opposed to continuous state is an easily ascertained standard and utterly uncontroversial usage, dominant in the relevant field of technology. (This reminds me of objections in recent months to the use that Information is frequently measured by I = – log p; which was somehow suddenly objectionable and questionable to the point of revealing ignorance, never mind its established usage and 80 year history in information theory.)

    And yet, no sooner had I mentioned this in passing somewhere above several days ago now, than you went into full debate mode, sharply challenging the legitimacy of describing a certain four-state per digit, discrete state system as digital. There was at one point even a suggestion by IIRC Dr Bot, that this was to somehow associate the idea of digital technology with something that this is not a proper association for.

    Let me again cite Wikipedia as a basic source speaking from your side of the fence, though in fact on this matter I have a perfect right to claim some basis of knowledge to speak:

    A digital system[1] is a data technology that uses discrete (discontinuous) values. By contrast, analog (non-digital) systems use a continuous range of values to represent information. Although digital representations are discrete, they can be used to carry either discrete information, such as numbers, letters or other individual symbols, or approximations of continuous information, such as sounds, images, and other measurements of continuous systems.

    The word digital comes from the same source as the word digit and digitus (the Latin word for finger), as fingers are used for discrete counting. It is most commonly used in computing and electronics, especially where real-world information is converted to a digital format as in digital audio and digital photography.

    My usual first example to my students has been to contrast a ladder’s rungs to climbing up a rope. One may hang on to a rope at any point, but between neighbouring rungs, there is no third rung. That absence of a valid state between neighbouring state is the essence of discrete state systems, and it is what marks a digital system as digital.

    It is a commonplace, that DNA is linear polymer molecule, used to store biological information based on a four state per digit system (as in: digit-al), in a string data structure. Further, the DNA code for proteins, and the algorithmic (step by step, finite, goal directed) processing in the ribosome to create protein chains, based on the three-letter codons in mRNA as transcribed from DNA and perhaps edited for eukaryotes, is also easily accessible and non-controversial.

    While I am at it, I need to re-affirm based on an exchange above, that the alphabet is also discrete state, e.g. between neighbouring letters A and B, there is no valid third letter, etc. (Above, you tried to drive a wedge between alphabetical and digital systems; this is incorrect.)

    So, we come to the question, why such a strident and sustained objection in the teeth of easily learned, commonplace facts and terms of digital technology and the easily shown relevance to what happens in the living cell?

    The best explanation answer to that so far, on the body of evidence, despite your assertions that it has nothing to do with it, is that the analysis in terms of digital information processing using codes, is an analysis in terms of an information technology and algorithms, and codes. That is, technologies that are only plausibly explained on intelligence. Indeed, use of language — including to construct the symbol-mapping systems used, which code is a manifestation of, is a strong sign of the presence of active intelligence. IIRC, Dr Bot above actually explicitly said something pretty much in accord with this.

    Now, you strongly object that I have made a strawman mischracterisation of your argument and view.

    Perhaps you do have an unusual view, that happens to align practically with the sort of objection in effect but comes from a different motivation. I would certainly like to hear why you have so strongly objected to an uncontroversial definition, one rooted in how digital and analogue information are processed technologically.

    In your complaint, I have yet to see a cogent explanation of that unusual motivation. Neither did I find such an explanation above during the exchange, nor on other occasions when the objection you have made has come up — an objection that frankly I find astonishingly ill-informed, even wrong-headed. Kindly provide it, and I will be prepared to accept a reasonable account.

    But it should be clear to anyone looking on why I have hitherto had good reason to infer that the reason for the objection to digital information processing being in the living cell, is the obvious one.

    At minimum, if that inference is incorrect, it would not be any sort of deliberate misrepresentation, nor is it hypocritical.

    And, from my point of view, while I am obviously not a perfect human being [something I could not dare claim, if I am to seriously be one of my faith], far too much of the personalities deployed against me in recent weeks and months smack of well-known turnabout accusation tactics, and even shoot the messenger who bears unwelcome tidings.

    I will footnote on these matters, as they are not on the main point.

    As a final main point, I note you have suggested that I am ever so eager to find myself misrepresented by objectors and call them out as using strawman tactics etc.

    Not so.

    What has happened is that the PATTERN of objections to design theory that we commonly see is based on misrepresentation of its key concepts, and conflation with a very different movement, creationism. This is then led into ad hominems, and too often vituperation or career busting, though it seems on recent decisions/settlements that the courts are beginning to catch on.

    If you doubt me on his, let me contrast two online encyclopedias on their ID articles,in the introductions:

    NWE: Intelligent design (ID) is the view that it is possible to infer from empirical evidence that “certain features of the universe and of living things are best explained by an intelligent cause, not an undirected process such as natural selection” [1] Intelligent design cannot be inferred from complexity alone, since complex patterns often happen by chance. ID focuses on just those sorts of complex patterns that in human experience are produced by a mind that conceives and executes a plan. According to adherents, intelligent design can be detected in the natural laws and structure of the cosmos; it also can be detected in at least some features of living things.

    Greater clarity on the topic may be gained from a discussion of what ID is not considered to be by its leading theorists. Intelligent design generally is not defined the same as creationism, with proponents maintaining that ID relies on scientific evidence rather than on Scripture or religious doctrines. ID makes no claims about biblical chronology, and technically a person does not have to believe in God to infer intelligent design in nature. As a theory, ID also does not specify the identity or nature of the designer, so it is not the same as natural theology, which reasons from nature to the existence and attributes of God. ID does not claim that all species of living things were created in their present forms, and it does not claim to provide a complete account of the history of the universe or of living things.

    ID also is not considered by its theorists to be an “argument from ignorance”; that is, intelligent design is not to be inferred simply on the basis that the cause of something is unknown (any more than a person accused of willful intent can be convicted without evidence). According to various adherents, ID does not claim that design must be optimal; something may be intelligently designed even if it is flawed (as are many objects made by humans).

    ID may be considered to consist only of the minimal assertion that it is possible to infer from empirical evidence that some features of the natural world are best explained by an intelligent agent. It conflicts with views claiming that there is no real design in the cosmos (e.g., materialistic philosophy) or in living things (e.g., Darwinian evolution) or that design, though real, is undetectable (e.g., some forms of theistic evolution). Because of such conflicts, ID has generated considerable controversy.

    Wikipedia: Intelligent design (ID) is the proposition that “certain features of the universe and of living things are best explained by an intelligent cause, not an undirected process such as natural selection.”[1][2] It is a form of creationism and a contemporary adaptation of the traditional teleological argument for the existence of God, presented by its advocates as “an evidence-based scientific theory about life’s origins” rather than “a religious-based idea”. It avoids specifying that the hypothesized intelligent designer is God.[3] Its leading proponents are associated with the Discovery Institute, a politically conservative think tank,[n 1][4] and believe the designer to be the Christian God.[n 2][n 3]

    ID seeks to redefine science in a fundamental way that would invoke supernatural explanations, a viewpoint known as theistic science. It puts forward a number of arguments, the most prominent of which are irreducible complexity and specified complexity, in support of the existence of a designer.[5] The scientific community rejects the extension of science to include supernatural explanations in favor of continued acceptance of methodological naturalism,[n 4][n 5][6][7] and has rejected both irreducible complexity and specified complexity for a wide range of conceptual and factual flaws.[8][9][10][11][12][13]

    Intelligent design was developed by a group of American creationists who revised their argument in the creation–evolution controversy to circumvent court rulings such as the United States Supreme Court Edwards v. Aguillard ruling, which barred the teaching of “Creation Science” in public schools as breaching the separation of church and state.[14][n 6][15] The first significant published use of intelligent design was in Of Pandas and People, a 1989 textbook intended for high-school biology classes.[16] From the mid-1990s, intelligent design proponents were supported by the Discovery Institute, which, together with its Center for Science and Culture, planned and funded the “intelligent design movement”.[17][n 1] They advocated inclusion of intelligent design in public school curricula, leading to the 2005 Kitzmiller v. Dover Area School District trial, where U.S. District Judge John E. Jones III ruled that intelligent design is not science, that it “cannot uncouple itself from its creationist, and thus religious, antecedents”, and that the school district’s promotion of it therefore violated the Establishment Clause of the First Amendment to the U.S. Constitution.[18]

    [ . . . ]

  256. It is quite easy to ascertain that on this, NWE is far more correct, and that Wikipedia is in effect a mouthpiece for objections to design thought. Wiki’s loaded description and tendentious assertions are based precisely on the misrepresentations noted; sustained in the teeth of responsibility to be fair and accurate.

    In particular, I find that Wikipedia seriously and irresponsibly distorts the nature of science in that summary, ideologically loading science with implicit materialism in the teeth of easily ascertained historical facts, phil of sci concerns and related issues on epistemology and inductive logic.

    As a glance at he IOSE introduction page will show, I have highlighted these areas of concern. But it is also quite clear on abundant experience, here at UD and elsewhere, that if one seeks to correct such an entrenched ideology, the standard resort has become distractive red herrings, led away to strawman distortions, soaked in ad hominem smears and set alight through vituperative rhetoric or more subtly through snide inferences and insinuations or invidious associations. These tactics seem to be increasingly dominant in ideologically tinged matters, and clearly trace to the destructive influence of Saul Alinsky.

    Notice, that in my case this has reached the level of threats against innocent and uninvolved members of my family. These threats are in the context of people who are evidently associated with porn and atheism movements.

    (Do you want to see what they had to say in response to my exposing the destructive impacts and alarming spread of porn, in my personal blog through a table of shocking statistics? [Cf, here for my post that they stridently objected to, with particular ire directed at Christian churches as "houses of hate." -- i.e. we see here the psychology of projection.] Let’s just say there is a linear connexion from those statements to the sort of blood libels that have come up through professor Dawkins’ toss out the poisonous red meat assertions. So much so that anti-religious motivation would be an aggravating factor in a case.)

    GEM of TKI

    PS: FYI, I had not actually noticed his threat to go to barrister until after I learned that Dr Bot was banned for it. And, I have not merely “accused” people of blood libel without good reason, I have described what they did in the terms of what that sort of irresponsible false accusation of alleged support for murder did and does yet, a point that usually escapes those caught up in such smears. Do you remember my remarks about the “auntie” murdered in 1980 on a poisonous smear against shop-keepers, and how the leader of the group that spread the smear then smoothly denied moral responsibility on radio? I have never ever forgotten that moment of horror on just how destructive smears can be, just how much of an out of control fire a smear can set. So, I repeat: there are ZERO responsible Christian leaders, Dr Craig included, who support genocide. This is easily ascertained, and so those who take up professor Dawkins’ poisonous talking point have some serious explaining to do, indeed if you are of a certain level of education and maturity, to recklessly discuss the matter is to enable the smear. And, I have taken time to point out why, cf here and here, with here. Kindly note the added links to media clips. Let me put this matter this way: if you think that being described as smearing people is something that outrages you, think about what it is like to be falsely accused of and/or put under the cloud of suspicion of support for mass murder, with overtones of racism as motive. Then, look back at what has been going on, in that light.

  257. Actually, this has the opposite effect, as Dr Liddle wanted to classify DNA as being alphabetic not digital.

  258. F/N: IOSE on the issue of methodological naturalism and the issue of natural vs supernatural vs nature vs art, here.

  259. Thanks for your intervention.

  260. F/n 2: IOSE on the nature and practice of science in an education context, here.

  261. LOL! KF, you’re absolutely the last person on this blog who should be lecturing about how blind repetition of already refuted nonsense somehow make it reality.

  262. Predictable Strawman: One is able to identify reliable signs that point to design as causal process, and on the basis of such indiuctive evidence, infer ha the sign speaks true when we see it. That is how science works. And, on the debates on the value of S, the DEFAULT is that S = 0, i.e the assumption default is that blind chance and necessity — per sampling theory and the issue of what is plausible to pick up in a sample — can explain something. It is when one has good reason to see that an event E comes form a specific, narrow and unrepresentative zone T that is unlikely to come up on a sample of the relevant scope, that one sets S = 1; specifically, one can give an independent description (one that does not simply quote E like announcing the wining number for a lottery). This is of course closely related to the common approach to hypothesis testing, as was pointed out and as usual ignored.

  263. I am finding that on occasion comments come up at strange points in the thread, we do need the chronological view.

  264. 264

    DrREC,

    What about inference’s cousin, extrapolation? Does your skepticism apply when multicolored cichlid fishes, finches beaks, and the varying sizes of lizard heads are extrapolated to explain the origin of the creatures and features that are varying?

    Apparently your skepticism is dialed back a few notches when it suits you.

    And you failed to address the natural origin of life which is neither inferred nor extrapolated, merely taken as an article of faith.

    So when you say that a particular inference overreaches, one must consider the source. In other words, it doesn’t mean much coming from you.

  265. 265

    I will not enter your personal discussion with KF

    I hope that’s not a bad thing because I do it all the time. I figure it’s a comment board, not a private discussion.

    That being said, I’m happy to conform if it’s an accepted rule of etiquette and if I can determine which discussions are personal.

  266. “This is beginning to sound like the recent objection that an inconveniently discrete state complex system is not digital.”

    Actually not at all the point I’m making. Thanks for changing the subject.

    My request was quite specific- an example of genetic biological fcsio of greater than 500 bits arising at once.

    Otherwise, biological ID has never been observed.

  267. gpuccio,

    It is empirically demonstrable that smaller amounts of fcsi can arise without design. KF’s reference on fits puts whole enzymes and protein domains under the universal probability bound. Since these can arise, and be retained by selection, an additive process where small amounts of fsci accumulating over time is the evolutionary model.

  268. 268

    DrREC,

    Cite any observed origin of 500 bits or more – at once or otherwise. You cannot.

    Therefore, you are again applying your logic selectively.

    How many bits of information have you observed arising by natural means? Are you prepared to refute that explanation using the very same logic?

    Logic is only logic when you apply it consistently. Otherwise it’s only justification, an excuse.

  269. Dr Rec

    This would be amusing if it were not so sad.

    Venter et al have demonstrated proof of concept for intelligent design of living forms, period.

    We see in living forms, a clear manifestation of a known, empirically tested and reliable sign of design, complex specified informational in this case cashed out as function based on a digital information system.

    No one was present to observe the remote past origin of life, but on the uniformity principle commonly used in science, it is a reasonable inference to best empirically anchored explanation that systems manifesting the characteristic were designed.

    The point is that DNA in life is not sui generis, it is an instance of a well known type of entity, a digital code based information system, and it is of a degree of complexity that the possibility of blind chance and necessity successfully implementing a trial and error approach is sufficiently minimal to be effectively zero. but we do have a well known causal factor that is fully capable of causing such an information system, namely intelligent design.

    Designers are routinely observed producing discrete state information system entities of many kinds, that greatly exceed a threshold of 500 – 1,000 bits, which blind chance and mechanical necessity has never been observed to do.

    In addition, Venter et al show that it is feasible for engineers to manipulate the required entities and even to synthesise them, e.g. his watermark.

    So, the objection you are making is plainly selectively hyperskeptical.

    You are demanding an example you know does not yet exist as the technology is emergent, but refuse to attend to a cluster of evidence that points to the grounds for inferring that design is the best explanation of FSCI, while your side is demanding that we blindly accept that something NEVER shown to produce that sort of scope of specifically functional information, is to be taken as practically certain as the source of the FSCI in life, which is many orders of magnitude beyond the threshold.

    Sorry, but your reasoning simply does not add up.

    GEM of TKI

  270. SA: the matter is definitely not personal. GEM of TKI

  271. SA and KF:

    I only meant that I did not want to intrude in some aspects of that discussion that could be better clarified between Elizabeth and KF personally. I just took some more general aspects, trying to express my view. In no way I wanted to suggest any general rule. :)

  272. KF:

    Absolutely! For me it has become, almost always, a truly random search. I open threads in the hope, rarely satisfied, that some darwinian luck will help me to find the comments I would like to read…

  273. Darwinian search is not a random search ;)

  274. Elizabeth:

    Well, sometimes I select some posts if they contain smiles :)

    And yes, I know, darwinian search is a search with special luck… and maibe NS (except for neutralists, I suppose) :)

    (In case you haven’t noticed, I am doing my best to have this post selected).

  275. Elizabeth:

    I am happy that you agree on those fundamental points. I will not enter your personal discussion with KF, but I believe that we can agree on many things, although I have to remind you that other darwinists here have many times denied even those basic concepts.

    Not that I’m aware of, gpuccio, but terminology can be difficult. Sometimes the disagreement is more apparent than real, as will also be apparent below!

    There is no point in arguing about what “the dictionary definition” of a term is, because dictionaries record usage, they do not prescribe it. What matters is what people mean when they use a term. I’m happy to use “Digital base N” to mean an alphabetic information transfer system with N “letters”, as long as we are clear that that is all it means. It is important not to then extrapolate to other usages. But as long as no-one is doing that, fine.

    So, let’s see where we agree. You can confirm or not.

    no-one, certainly not me, denies that information transfer occurs in life

    That’s fine. I will limit the discussion, for the moment, to protein coding gene information.

    Are you including the mechanisms by which that “protein coding” gene information is coded? I’ll assume yes.

    So I suppose you agree:

    a) That in protein coding genes there is information about the corresponding protein sequence (some deny even that)

    No-one denies that (to my knowledge), but as usual a lot depends on exactly what you mean by “information”. If you mean, as per Merriam Webster’s definition 2b:

    the attribute inherent in and communicated by one of two or more alternative sequences or arrangements of something (as nucleotides in DNA or binary digits in a computer program) that produce specific effects

    Yes.

    b) That such information is symbolic, in the sense that it is coded by a symbolic code, called the genetic code

    Let’s try Merriam Webster again:

    Symbol

    1
    : an authoritative summary of faith or doctrine : creed
    2
    : something that stands for or suggests something else by reason of relationship, association, convention, or accidental resemblance; especially : a visible sign of something invisible
    3
    : an arbitrary or conventional sign used in writing or printing relating to a particular field to represent operations, quantities, elements, relations, or qualities
    4
    : an object or act representing something in the unconscious mind that has been repressed
    5
    : an act, sound, or object having cultural significance and the capacity to excite or objectify a response

    No, none of the above definitions describe the mapping of nucleotide triplet to amino acid, IMO. 3 is the closest, but it the genetic code fails to meet the criterion on a number of counts.

    c) That the genetic code is a digital base 4 code, organized in three charatcter “words”, for a total of 64 word values, corresponding in a redundant “many-to-one” mapping to the 20 AAs and to the stop command

    Well, as long as we stipulate that “digital base 4″ does not refer to numeric values or arithmetical computations, yes, I accept that, as long as we are only talking about mRNA after editing. At that point, the mapping is one-to-one-or-more, and all units are triplets. I’d have called that “base 64″, as the units are more naturally (IMO) viewed as molecular subunits of three nucleotides (so the unite with multiple states is the triplet, not the nucleotide), but as long as we are careful not to overapply the metaphor, I’m happy to call it “base 4″.

    d) That there is no known biochemical law that connects the symbolic values in the codons to the corresponding AAs

    Of course there’s a “chemical law”. Or rather, there are perfectly comprehensible chemical processes. I would readily agree that the mapping is arbitrary, in the sense that another set of tRNA molecules would do the job as well, as long as it consisted of only not more than one tRNA molecule for each triplet, but given that in most life forms (not all) the tRNA molecules coded are the specific sete that gives us the well-known “genetic code”, the the mapping obeys straightforward chemical laws. The “laws” that govern the selection of the set are IMO, likely to be the laws that govern natural selection in general – it’s a set that maximised reproductive success, in this case, via reproductive fidelity, and maximising use of the available amino acids.

    The law in question being: that when things reproduce with heritable variance in reproductive success, those variants that reproduce most successfully will become the most prevalent.

    It would be interesting to simulate the evolution of triplet-amino acid mapping. I might try it some time.

    e) That the physical connection between the gene and the protein if made only by the transcription and translation apparatus

    Of course.

    f) That specific information about the genetic code is independently embedded in the structure of the 20 aminoacyl tRNA synthetases, and that such specific information is the key to decoding the information in the protein coding genes.

    Yes, exactly. A different set would give a different mapping. Only those sets with one-to-one or more mappings will result in reproductive fidelity.

    IOWs, we find the information about the genetic code independently in two dofferent parts of the cell: the protein coding genes (written according to the genetic code) and the 20 aminoacyl tRNA synthetases (structured so that they can correctly decode the coded information)

    Well, not “independently”. The set of 20 tRNA molecules will give you the mapping, but you couldn’t derive the mapping without access to that set. An alien, given only the genome, would be hard pressed to derive the mapping, unless they could figure out where in the genome the tRNA molecule templates would be found.

    g) That the information in protein coding genes is exclusively about primary sequence, and therefore the search space for that information in any random system acting on the genes is the sequence search space

    I don’t understand what you are saying here. Could you clarify?

    h) That the relation between sequence, structure and function in proteins is very complex, and, while being essentially a necessity relationship (depending on biochemical laws), it is at present mostly beyond the calculation abilities of us humans

    Yes.

    Well, I would like to verify with you these points. None of them is essentially an ID argument, but they are obviously important points for the ID theory.

    And for any evolutionary theory :)

    I am afraid that, if you disagree with any of them, discussion will always be chaotic. So, if you disagree, please try to explain clearly where and why.

    I hope I have done so, and where I found your point unclear.

    If, instead, you agree, I would appreciate if you could simply tell us at least some simple and basic points about “the problems you see with ID”, and I will be happy to comment on those problems, trying to use a common language.

    In brief, problems I see with ID are these:

    1. That despite protestations, it is essentially an argument from ignorance. By this I mean that ID is inferred from lack of an alternative explanation from the observed pattern. When an alternative explanation is offered, the response is usually “but you can’t explain x, y, z” or “x, y, z have never been observed”. ID despite claims is not a “positive” hypothesis and provides no (or few) differential predictions. Dembski’s Filter (in new or old form) “rejects the null” without specifying that null, or, at best, mis-specifying it.

    2. The argument that design can be inferred because biological things resemble human designs, and we know human designs were designed is fallacious for two reasons: one is simply that it commits the fallacy of the excluded middle (Intelligent agents design complex things; this is an complex thing; this thing was designed by intelligence), and the second, much more serious, is that the very thing that distinguishes most human artefacts from all biological organisms is that organisms reproduce themselves. This is the response to the old chestnut about “how do we know the watch on the heath was designed?” We know it was designed because it’s fairly complex, and it doesn’t reproduce itself, and the only things we know of that are this complex are either self-replicators, or designed by self-replicators. So it is probably designed by a self-replicator (Alternatively by some other iterative feedback process such as crystalisation. Snowflakes tendn to look designed).

    3. Many ID arguments hinge on the assertion that information (of some type, or quantity) cannot be generated except by intelligent agents. Given a simple-self-replicator, I would argue that we can observe the self-generation of information, as defined by most criteria that seem to me to be relevant to the kind of information we see in living things.

    4. The arguments that micro-evolution is fine, but there is an “edge” or “barrier” that means that Darwinian processes are not capable of “macro-evolution” seems to me based on flawed understand of evolutionary processes.

    The only sound-ish argument I see for ID is the argument that the simplest possible Darwinian-capable self-replicator is itself too complex to have arisen spontaneously from a pool of non-self-replicators. Once you have that simplest possible Darwinian-capable self-replication, I see no barrier to the evolution of complex life.

    And that itself still suffers from Flaw 1. It is true that we do not yet have a good complete theory for how Darwinian-capable self-replicators emerged from non-self-replicators (or non-Darwinian capable self-replicators, not quite the same thing), but there are already highly promising leads. Inferring ID from the lack of a complete alternative theory is not sound scientific reasoning IMO. Only if ID could come up with a better alternative theory (because a negative inference is not an “alternative” theory in science), such as “front-loading”, that makes differential predictions, would we be justified in drawing an ID inference.

    Front-loading should be fairly easy to test, BTW, but I don’t think it has much in the way of legs.

    Finally, I’ll say that the idea that “Darwinists” claim to have “disproven” or “falsified” ID is simply wrong (or, if the claim is made, it is unjustified – it’s possible that some ignorant “Darwinists” may have claimed it). Darwinian theory does not falsify ID. Actually, nothing could falsify ID, which is one of the problems with ID.

    Darwinian theory (or rather modern evolutionary theory, based on Darwin’s basic idea), rather, provides a coherent account as to how life, in all its variety and complexity, could have evolved from simple organic self-replicators, and OOL theories, which do incorporate Darwinian mechanisms, in fact, provide a less well-worked out set of hypotheses about those early organic self-replicators, and which, so far, have limited evidential support. Neither set of theories accounts for every single lineage, every single observation, every single information-transfer mechanism, but nor do they suggest that there are any insuperable problems, rather the reverse.

    I hope that helps :)

  276. :) :) :)

    No, it’s not a “search with special luck” either, gpuccio :)

    It’s search of connected space. Some of those connections can be along ridges, or even via the odd ravine.

    :D

  277. 277

    Ok. I just tend to jump all over the place randomly and wanted to make sure it wasn’t inappropriate.

  278. “How many bits of information have you observed arising by natural means? Are you prepared to refute that explanation using the very same logic?”

    I’ve observed small changes over many generations-incremental increased, less than the universal probability bond, not requiring inference of a designer.

    So where is this increase in biological fcsi, outside of human design, that warrents inference of a designer? Or is ID a theory explaining a non-observation?

  279. kairosfocus,

    This is a funny little dance you’re doing. ID is the notion that design in nature, exceeding a value you’ve set, must be the product of a designer, by inference to human design.

    I ask what design in nature has shown a spontaneous increase in biological fsci exceeding the value you set, and you refer me back to a human design (which actually produced no new biological fcsi, in my opinion-see below).

    Putting aside that you don’t actually have the demonstrated ability to calculate fCSI in biology*, it looks like you have a theory in search of an observation!

    *(though you reference papers, where fits are estimated based on number of sequences performing the same function. This places enzymes, and domains well below the universal probability bound. Since we know evolution hasn’t searched all sequence space, this is probably an overestimate. Actually taking the sequence space of a moderate sized protein and testing for function would quickly exceed the resources of a laboratory).

    “Venter et al have demonstrated proof of concept for intelligent design of living forms, period.”

    False. False. False. Venter did NOT design a genome. He copied a genome, added non-biologically relevant watermarks, and inserted it into a cell.

    ““They rebuilt a natural sequence and they put in some poetry,” said University of California at San Francisco synthetic biologist Chris Voigt. “They recreated some quotes in the genome sequence as watermarks.”

    It’s an impressive trick, no doubt, but replicating a natural genome with a little panache is also the limit of our present design capabilities.”

    http://www.wired.com/wiredscie.....etic-life/

    Perhaps you could calculate the gain in biological fcsi in this experiment?

    I’d say it is zero-no new biological functionality.

  280. 280

    DrREC,

    I’ve observed small changes over many generations-incremental increased, less than the universal probability bond, not requiring inference of a designer.

    So where is this increase in biological fcsi, outside of human design, that warrents inference of a designer?

    I agree that the changes you have observed do not require a designer. That’s actually the point. You have not observed such a degree of biological change with or without a designer. And yet you reject one inference and accept another extrapolation. I’m trying to determine what the difference is, except that you like the extrapolation and don’t like the inference. That appears to be the bottom of it.

    So where is this increase in biological fcsi that makes advanced biological diversity attributable to evolution?

    You reject because it is not observed, and allow the other which is also not observed.

    I can’t explain to my wife why tomatoes are bad, and she can’t explain why she hates rats. Those are preferences. They cannot be explained rationally because they are not rational.

    Can you explain why you reject the unobserved because it is unobserved while embracing the unobserved, or is it also an irrational preference? (I’m not using “irrational” in a negative way. I’m referring to that which cannot be derived from reason.)

  281. 281

    Dr Rec at 14.2.2.1.1

    So where is this increase in biological fcsi, outside of human design, that warrents inference of a designer? Or is ID a theory explaining a non-observation?

    Yes there is such an inference. And it not negated by the ability of an organism to sustain change to its information, but instead is based on what that information is – physically is.

    I remind you once again that you bounced out of the conversation where this was being explained to you. It was also explained here.

  282. Upright, your response is non-pertinent.

    Thanks for explaining how a music box works for me, but unless you have a single observed instance of calculated biological fcsi exceeding the universal probability bound (and thus requiring a designer by inference) then ID has no merit.

  283. 14.2.2.1.2 ScottAndrews

    “I agree that the changes you have observed do not require a designer.”

    Excellent. These changes are evolutionary-small changes over time. And from KFs reference, enzymes and domains have fits that fail to exceed the universal probability bound.

    Therefore, no inference to a designer is needed for them.

    We observe new steroid receptor binding, ruminant digestion of bacteria, body plan changes-with only a few amino acid changed.

    So we observe evolution, but ID is an inference without even an observation. There simply isn’t an example of design-of fsci exceeding 500 bits.

  284. 284

    DrREC,

    Please elaborate on how you decide in which medium fcsi may exist and be considered a possible product of design. Because it really looks like you’re just making it up.

    If you find an elaborate code spelled out with thumbtacks, will you reject ID because you’ve never seen another observed instance of thumbtack fsci?

    It appears that you just draw this demarcation wherever it suits you. The obvious purpose of both inference and extrapolation is to reason beyond what we observe. I asked you before – do you therefore reject inference and extrapolation altogether, or only in this case? What is the difference?

    And how can you rationalize that logic with accepting the wildly hopeful, speculative, and improbable extrapolation of all life from incremental variations? It’s like turning turning Mickey Rourke away from your night club because he’s not good-looking enough and then inviting in the Elephant Man. One must conclude that you either hate Mickey Rourke, love the Elephant Man, or both. But either way your claim to be measuring by an objective standard is up in smoke.

  285. 285

    chuckle, chuckle

    I love it when a materialist says that material observations don’t matter.

  286. 286

    DrREC,

    body plan changes-with only a few amino acid changed.

    You’re equivocating. What is the greatest evolution of a ‘body plan change’ observed? Is it greater than the difference between a chihuahua and great dane?

    It’s one thing to change a body plan – shorten, lengthen, etc. It’s another to come up with a new one. If you can attribute that to evolution then please share.

    You’re name-dropping without naming names. I’m close friends with lots of famous movie stars. There’s the one guy. And the other. And the woman from that film. Right.

  287. ScottAndrews2

    It’s one thing to change a body plan – shorten, lengthen, etc. It’s another to come up with a new one. If you can attribute that to evolution then please share.

    When you’re done trolling and chasing people around the board to harass them, there’s a paper above on the evolution of treehoppers waiting for you to explain. Or will you just lie again and say no one ever presented any evidence to you?

  288. “Chuckle, chuckle

    I love it when a materialist says that material observations don’t matter.”

    Who said that? I’m the one demanding a material observation of design-something you seem unable to dig up.

  289. You’ve changed the subject. Google hox genes if you are really interested.

    Where is the your example of design >500 bits changing body plan?

  290. “Please elaborate on how you decide in which medium fcsi may exist”

    I’m talking about biology, so lets go with the genome.

    ” and be considered a possible product of design”

    ID and Kairosfocus have described the qualifications for inferring design. I’m simply saying there is no empirical observation of a gain in biological fsci > 500 bits, therefore there is no need to infer a designer.

    “It appears that you just draw this demarcation wherever it suits you.”

    I chose Kairosfocus demarcation for convenience. His references describe numerous proteins with fits less than 500.

    Your last paragraph is simply an argument from personal distate. No point in responding.

  291. For the lurkers, here’s an interesting recent paper on the evolution of body plans through changes to Hox and other regulatory genes.

    Origins of the other metazoan body plans: the evolution of larval forms

    Abstract: Bilaterian animal body plan origins are not solely about adult forms. Most animals have larvae with body plans, ontogenies and ecologies distinct from adults. There are two primary hypotheses for larval origins. The first hypothesis suggests that the first animals were small pelagic forms similar to modern larvae, with adult bilaterian body plans evolved subsequently. The second hypothesis suggests that adult bilaterian body plans evolved first and that larval body plans arose by interpolation of features into direct-developing ontogenies. The two hypotheses have different consequences for understanding parsimony in evolution of larvae and of developmental genetic mechanisms. If primitive metazoans were like modern larvae and distinct adult forms evolved independently, there should be little commonality of patterning genes among adult body plans. However, sharing of patterning genes is observed. If larvae arose by co-option of adult bilaterian-expressed genes into independently evolved larval forms, larvae may show morphological convergence, but with distinct patterning genes, and this is observed. Thus, comparative studies of gene expression support independent origins of larval features. Precambrian and Cambrian embryonic fossils are also consistent with direct development of the adult as being primitive, with planktonic larvae arising during the Cambrian. Larvae have continued to co-opt genes and evolve new features, allowing study of developmental evolution.

    ScottAndrew2 won’t read it of course, he’ll just claim it doesn’t exist, but at least those interested in learning will see it.

  292. Umm your position doesn’t have any explanation for HOX genes other than- “look at those!”

    But anyway HOX genes do not determine the body plan only influence its development.

  293. And, I have not merely “accused” people of blood libel without good reason

    Well, yes, you most certainly have, IMO, kairosfocus.

    But to clear this up, please answer the following questions:

    1) Does William Lane Craig claim that God ordered the Israelite (“Israeli”) soldiers to slaugher the Canaanites?

    2) Does William Lane subscribe to “divine command theory”, which he defines as “On divine command theory, then, God has the right to command an act, which, in the absence of a divine command, would have been sin, but which is now morally obligatory in virtue of that command.”?

    3) If the answer to both the above is yes, in what sense is Craig NOT saying that genocide is a moral virtue if commanded by God? If the answer to either of the above is no, how have we misunderstood Craig?

  294. Dude,

    Your position doesn’t have any explanation for HOX genes, nor any regulatory genes. And HOX genes only influence development and do not determine it.

  295. Joseph, please tell us more about your evidence for Noah’s Flood, baraminology, and Adam & Eve. That always makes for entertaining reading.

  296. Dr Liddle:

    Can you kindly confirm to us that you accept that there are NO responsible Christian thinkers and leaders who support genocide, specifically including Dr Craig? [Documentation already provided and linked.]

    That, thanks to the poisonous rhetoric of professor Dawkins, is the very first item on the agenda.

    Unless this is clearly accepted, no reasonable, positive discussion can be held.

    And, that false accusation or insinuation of support for genocide which keeps on coming up, is exactly the blood libel I have pointed out as needing to be addressed.

    Good evening

    GEM of TKI

    PS: I have repeatedly linked where I have addressed the range of issues you attempt to raise again, so I simply point you upthread at this point.

  297. Thank you for this post, kf.

    blockquote>I have summarised an exchange that took place in public, and it seems accurately. That is certainly not going behind your back.

    No, it is not accurate, kf, and I’m not sure how often I have to say this: I do not deny that information, digital or analog, is stored, generated and transferred in biological systems; far from denying it, I have explicitly stipulated that it is. So please stop implying that I, or anyone else, finds this concept “inconvenient”. We don’t.

    However, I agree that you have made this point in public – at the time I was just a bit peeved that having hung around the thread repeatedly asking you to retract this implication, while you were logged on, once I’d logged off back it came. But I accept that this was unreasonable on my part (after all, we live in different time zones) and I do apologise for that remark.

    For the last time (I hope):

    Yes, there is “digital information” in biological systems. No this fact is not “inconvenient” for any argument I have made, and my arguments over exactly how we describe information transfer at various levels in biological systems has nothing to do with whether or not ID is true or false. Far from it: I’ve repeatedly drawn attention to the fact that gene regulatory systems are digital in nature. So, in some senses, are brains.

    Let’s focus: that digital means discrete state as opposed to continuous state is an easily ascertained standard and utterly uncontroversial usage, dominant in the relevant field of technology.

    Fine. As I’ve said several times, now, I accept this usage.

    (This reminds me of objections in recent months to the use that Information is frequently measured by I = – log p; which was somehow suddenly objectionable and questionable to the point of revealing ignorance, never mind its established usage and 80 year history in information theory.)

    I don’t know who has found this “objectionable”. Not me.

    And yet, no sooner had I mentioned this in passing somewhere above several days ago now, than you went into full debate mode, sharply challenging the legitimacy of describing a certain four-state per digit, discrete state system as digital. There was at one point even a suggestion by IIRC Dr Bot, that this was to somehow associate the idea of digital technology with something that this is not a proper association for.

    Yes, I did, for three reasons, the main one being is that yet again you had implied that my motivation for objecting to that description had something to do with wanting to deny ID. The second was secondary, in that I was regarding “digital base N” as referring to a numeric positional system, not an alphabetic system with N element types. Which is why right from the beginning, I said that DNA was more like an alphabetic system than a digital (i.e. numeric) system (and which you found “astonishingly ill-informed). However, I now accept that this usage is applicable to alphabetic systems, and, with that proviso, am happy to accept the terminology. However I still disagree that information transfer systems in the cell are in “digital base 4″. Some may be – some are in other bases, if the number of bases is taken to be the number of molecules or molecular sequences used for information transfer. I certainly don’t think that “digital base 4″ is a good general description of biological information systems, and is certainly not, IMO, a good way of describing how the DNA molecule is written.

    Which seems to me rather important.

    Let me again cite Wikipedia as a basic source speaking from your side of the fence, though in fact on this matter I have a perfect right to claim some basis of knowledge to speak:

    Yes, I know the difference between an analog and a digital signal. I don’t think it has the slightest relevance this discussion.

    It is a commonplace, that DNA is linear polymer molecule, used to store biological information based on a four state per digit system (as in: digit-al), in a string data structure. Further, the DNA code for proteins, and the algorithmic (step by step, finite, goal directed) processing in the ribosome to create protein chains, based on the three-letter codons in mRNA as transcribed from DNA and perhaps edited for eukaryotes, is also easily accessible and non-controversial.

    It may be “a commonplace” kf, but your description begs a great many questions. Yes, DNA stores information, but “is used to store” brings in unwarranted agency language. It stores information, I agree. As for “goal directed” – again this begs the question at issue. The ribosome translation system serves to perpetuate both the organism and the lineage. Calling this a “goal” is to assume your consequent.

    While I am at it, I need to re-affirm based on an exchange above, that the alphabet is also discrete state, e.g. between neighbouring letters A and B, there is no valid third letter, etc. (Above, you tried to drive a wedge between alphabetical and digital systems; this is incorrect.)

    I assume we agree that alphabetic and numerical systems are different? That is the only point I wish to make.

    So, we come to the question, why such a strident and sustained objection in the teeth of easily learned, commonplace facts and terms of digital technology and the easily shown relevance to what happens in the living cell?

    Because your model leaves out huge and relevant sections of the information generation, transfer and storage processes found in biological systems. “Base 4″ may indeed apply to parts of the system (if “base N” is used to describe alphabetic systems with N element types) but there are far far more discrete element types than 4 used in information transfer in living things, and when it comes to “writing” the DNA sequence, the “digital base 4″ model seems to me to be seriously misleading. As a “read only” system, I accept that the reading frame can take one of four states. As a “write” system, the analogy simply doesn’t work. Or not that in a way that I can see, and I suspect this is why ID proponents have such difficulty with the question: “how does the information get into the genome?”

    The best explanation answer to that so far, on the body of evidence, despite your assertions that it has nothing to do with it, is that the analysis in terms of digital information processing using codes, is an analysis in terms of an information technology and algorithms, and codes. That is, technologies that are only plausibly explained on intelligence.

    Well, no, it isn’t, kf, and I am glad at least that you have recognised that I am indeed making “assertions that it has nothing to do with it”. Perhaps now you will take in the argument I am making, or, at least note (as I have pointed out on many previous occasions now) that your hypothesis about my motivation doesn’t actually accord with the facts in evidence: if I were worried about the implications of a “digital information processing using codes” in the cell, why on earth would I be repeatedly pointing out that gene regulatory networks are a “digital information processing system” with inputs handled by algorithms to produce appropriate outputs?

    Indeed, use of language — including to construct the symbol-mapping systems used, which code is a manifestation of, is a strong sign of the presence of active intelligence. IIRC, Dr Bot above actually explicitly said something pretty much in accord with this.

    Well, no, he didn’t, but as he’s been banned for no conceivably justified reason that I can see (apparently for objecting to having something untrue said about him and trying to put the record straight) he can’t very well put the record straight, can he? But I have myself said (and I think DrBot agreed) that DNA is rather more like grammatical logic than digital computer logic. Again, why would either of us make that point if we thought that it was a problem for our view point?

    Now, you strongly object that I have made a strawman mischracterisation of your argument and view.

    Yes. You keep saying that I am arguing that biological systems aren’t digital because I don’t like the implications that has for ID. Clearly that characterisation is wrong, because I have repeatedly described cell information transfer systems as digital.

    Perhaps you do have an unusual view, that happens to align practically with the sort of objection in effect but comes from a different motivation.

    Yes! Thank you, kairosfocus!

    I would certainly like to hear why you have so strongly objected to an uncontroversial definition, one rooted in how digital and analogue information are processed technologically.

    In your complaint, I have yet to see a cogent explanation of that unusual motivation. Neither did I find such an explanation above during the exchange, nor on other occasions when the objection you have made has come up

    Well, I’ve tried to be as clear as possible, but I will try again:

    There are many levels and stages at which information is generated, stored, and transferred in biological systems, which include populations and habitats as well as individual organisms and individual cells, and they are all inter-related. One of these, and only one, is the process by which information stored (digitally, if you like, and in base 4 if you like, as long as we agree it is not numeric, and is “read only”) in DNA is utilized to build and maintain a) a cell and b) a multicellular organism. This process involves far far more than the translation of protein coding parts of DNA into actual proteins, and includes the template-like production of RNA molecules of various kinds, including enzymes (such as ribosomes), mRNA and tRNA, and of course the discrete amino acids themselves. Then we have the gene-regulatory networks by which genes are switched off and on according to chemical inputs from beyond the cell, including the local and external environment, and resulting in tissue differentiation and the development of body plans, as will of course as healing, and actual bodily functions, including brain activity, in which protein coding genes are constantly being turned on and off.

    Then we have the information transfer from parent to offspring, so that the offspring genome contains information from its parents (and in sexually reproducing species, recombined from all four grandparents) that enables a novel organism to be built, complete with novel information that doesn’t come from any of its ancestors.

    Then we have the information transfer from environment to population, by which those phenotypes that reproduce better in that environment leave more of their alleles in the gene pool than phenotypes that reproduce rather worse, so that the population gene pool stores, and transmits to each succeeding generation, information about what worked in that environment as well as some “legacy” information about what worked in previous environments.

    Some of this is better thought of as analog, rather than digital IMO (length of limb; depth of beak), and much of it concerns both gene-gene interactions and gene-environment interactions.

    — an objection that frankly I find astonishingly ill-informed, even wrong-headed. Kindly provide it, and I will be prepared to accept a reasonable account.

    I have attempted to do so above :)

    But it should be clear to anyone looking on why I have hitherto had good reason to infer that the reason for the objection to digital information processing being in the living cell, is the obvious one.

    Well, no, because you have consistently ignored my insistence that there is digital information processing in the living cell! Why would I have done such a thing had I had some principled objection to digital information processing in the living cell”

    At minimum, if that inference is incorrect, it would not be any sort of deliberate misrepresentation, nor is it hypocritical.

    Well, on the whole, as you know, kf, my default assumption is that other people are posting in good faith. It’s why I get so cross when you, and others, do not make that assumption (indeed assume the opposite) in others. But as I had not only repeatedly agreed that there are digital information processing systems in the cell, but also repeatedly pointed out that I could scarcely have an objection to their being digital information processing systems in the cell if I was repeatedly pointing out that there were, your repeated insistence that I was denying such a thing for ideological reasons was starting to look, well, deliberate!

    But I am happy to accept your word that it was a misunderstanding. I hope my view is now clear, namely that far from denying digital information processing in the cell, or information processing at all, I am trying to point out just how many levels and types of information generation, storage and transfer processes take place in biological systems!!! Much of which can be well-described as digital IMO.

    And, from my point of view, while I am obviously not a perfect human being [something I could not dare claim, if I am to seriously be one of my faith], far too much of the personalities deployed against me in recent weeks and months smack of well-known turnabout accusation tactics, and even shoot the messenger who bears unwelcome tidings.

    Well, I have to say, kf, that I think that you are seeing attacks where none are intended. That’s understandable when arguments get heated, and in the ID vs Darwinist argument, fear from both sides of the other taints debates. Paranoia is understandable (on both sides, I would say) but not helpful. That’s why my own principle is: assume the other person is posting in good faith.

    Not for especially virtuous reasons (though I think it’s a good principle) but because we are far more likely to understand where the other person is coming from that way. In my experience, most people don’t lie, and most people believe what they do because they think their arguments and conclusions make sense. Good people can differ profoundly :)

    We will continue to disagree, kf, but thank you for your post, and I hope at least, the nature of our disagreement has been somewhat clarified.

    I’m off to bed – I wish you a good night :)

  298. 298

    DrREC,

    I say “new body plans” because it’s better than saying “significant changes” which is a bit vague. I could use specific examples, but I’m actually trying to be generous and not demand an explanation for any one specific change. I’ll take whatever you have. (I’m trying to discuss this reasonably in manner that provokes thought rather than frustration. I’ll be the first to admit that sometimes I cross the line.)

    I’m not moving the goalposts. OOL and “significant” evolution* are all that interest me in this context. Why would I be talking about anything else? That is where the controversy is.

    Where are my 500 bits? I seem to have misplaced them. Perhaps they are right next to your 500 bits. Where did you leave those?

    Please do not beg the question and claim that all biological information is your example of evolutionary accumulation. Then I would be entitled to do likewise and assert that the same example demonstrates design.

    The origin of biological diversity is unobserved. I have no observation of design creating 500 bits of biological fsci. If I have not already openly conceded that, I am now.

    You have no observation of the processes of variation, selection, drift, and what have you producing that same fcsi. There can be no honest discussion that does not begin from that point.

    It’s your extrapolation vs. my inference. Both, by definition, involve reaching beyond what we observe. The question is which has to reach farther.

    *A few examples that come to mind are the development of legs in legless creatures, the transition from ground-dwelling spiders to those spinning orbital webs. Or the appearance of distinct organs such as lungs or stomachs. In each case not only the physical change but the behavioral must be accounted for. Countless advanced behaviors (birds taking turns guarding a nest) are also of interest.

    Those cross my mind. Propose your own. I’m attempting to negotiate what would constitute “significant change” so that I can use such a phrase without being vague or suspected of moving goalposts. Perhaps someone has already done so. But it would certainly assist in discussions such as this so that no one would bring up pointless distractions like colored cichlid fish.

  299. 299

    Oh yes, excuse me.

    Any material observation coming from an opponent must first conform to one’s whim, or whatever observable impact it has on the issue cannot be considered legitimate.

    That’s much better. The clear air of empiricism is beginning to return.

  300. ScottAndrews2

    You have no observation of the processes of variation, selection, drift, and what have you producing that same fcsi. There can be no honest discussion that does not begin from that point.

    Apparently there can be no honest discussion from you on the topic, period. I have already posted eight scientific studies with evidence for those very things, two papers of which are on this very page.

    How do you live with yourself when you feel the need to lie with almost every post you make here?

  301. Just in case you didn’t see my previous message:

    My response to your earlier post is here:

    http://theskepticalzone.com/wp/?p=212

    Feel free to respond either at TSZ, or, if you prefer, here, and perhaps leave a link at TSZ (you don’t need to register to post).

    Cheers

    Lizzie

  302. ” I have no observation of design creating 500 bits of biological fsci. If I have not already openly conceded that, I am now.”

    Thanks. So there is no empirical observation of an increase in biological fsci that would warrant a design inference. In other words, ID is a pointless theory that describes no observation.

    Realize ID is based on the inference that this large increase in information warrants a designer. Evolutionary hypotheses require NO SUCH OBSERVATION. Indeed, evolutionary biology predicts and observes small, probable increases in information.

    “You have no observation of the processes of variation, selection, drift, and what have you producing that same fcsi. There can be no honest discussion that does not begin from that point.”

    Is just false. We have many observations of those processed producing small increases in fcsi. I can and have provided references. Others have on this thread also.

    You bring up the unobserved past. Admittedly, much prior to LUCA is hard to infer. But-what is more reasonable-that an observed process operated in the past, or a process with NO empirical support?

    And anyway, evolution isn’t about abiogenesis. I guess if ID wants to be a theory without observation, it is welcome to be.

  303. 303

    GinoB,

    I have again permitted you to waste my time by reading yet another of your irrelevant research papers. This one starts from the stated assumption that animals with larval forms evolved, and asks which of two hypotheses seems more likely.

    That’s the sleight of hand that many readers will miss. That both hypotheses may be false is never considered. What GinoB thinks the paper demonstrates is actually what is assumed at the outset.

    The paper simply asks, starting from the assumption that one evolutionary narrative or the other must be true, which one wins. It never addresses the basis for that assumption.

    As usual GinoB, you produce research which isn’t so much wrong as it just doesn’t say what you think it does. It doesn’t even claim to. Any specific details mentioned in the paper are intended to support one hypothesis over the other. The paper does not attempt to provide evidence that evolution explains the origins of any larval or adult forms. That is not its purpose.

    How many times have you done this? Six? Seven? You post links to papers that don’t even claim to be about what you think they are. Then you throw a childish fit (“NUH-UH” – I didn’t even know adults said that) when someone explains what the papers really say, or you accuse us of pretending they don’t exist. They all exist. There are thousands more where that came from. Who cares?

    If I want to pretend that something doesn’t exist I’ll start with you. At the very least, I won’t follow another link until you pass a simple test by summarizing in your own words what you think it says and why it is relevant. Because I don’t think you even read this stuff. Good grief, you bolded the whole abstract! You have no idea which phrases or sentences if any are relevant.

    Fail again, unless your goal was to elicit a response. Most people who crave attention prefer the positive kind. I feel sorry for you if this is what you want.

  304. 304

    DrREC,

    Realize ID is based on the inference that this large increase in information warrants a designer. Evolutionary hypotheses require NO SUCH OBSERVATION. Indeed, evolutionary biology predicts and observes small, probable increases in information.

    Then I’ve misunderstood. I thought the idea was that over time reptiles had evolved into mammals and birds, and so on. If you’re not claiming that evolution is the primary cause of such biological diversification, but rather tinkers with finch beaks and lizard heads and makes cichlid fish change colors, then we are in agreement, and we can leave it there.

    You have yet to explain on what basis you make the distinction between observing an increase in fsci and an increase in biological fsci. That appears to be your primary objection, and you have yet to explain on what basis you make that distinction.

    I’ll repeat: Inference and extrapolation enable us to explain beyond what we observe. In this case they are all we have. You apply an ad-hoc rule to arbitrarily rule out the inference, and seem to think that your extrapolation is now the last man standing. That looks an awful lot like a shortcut to arriving at the conclusion you prefer.

    Explain why the origins of biological fsci cannot be inferred from the origins of non-biological fsci. Don’t beg the question by claiming to have an alternative explanation. Explain the basis for the line that you have drawn. I think you just made it up.

  305. ScottAndrews2

    I have again permitted you to waste my time by reading yet another of your irrelevant research papers.

    Sorry, but given your history of prevarication I don’t believe you. You didn’t read any of the others I posted. You didn’t do anything but skim the abstracts and couldn’t tell me anything about them in your own words. It was hilarious though when I was asking for your explanation of one paper and you ended up quote-mining a passage from a completely different paper. You couldn’t even follow the conversation going on.

    Sorry Scotty, you’ll always be the ugly, ignorant Creationist. Scientific evidence scares the poo out of you You have no answer for it so you run away and hide every time it is produced.

    Fear not little man. I won’t ask you any more embarrassing questions about your stupid claims. I’ll just point out your falsehoods and keep posting the scientific evidence you say doesn’t exist.

  306. 306

    GinoB,

    Reading the abstracts of papers is a good idea. Why don’t you start with that. If you had read and understood the abstracts to even one of those papers then you never would have linked to them. Your evidence all exists. It just doesn’t evidence anything you want it to.

    Why do you call me “ugly?” That’s the kind of word choice that reveals more about the one who chose it.

    Time for me to go. I’ve given you enough attention. My beautiful wife and near-perfect son are home. I think we’ll go to the park and enjoy the nature God created for our enjoyment.

  307. ScottAndrews2

    Reading the abstracts of papers is a good idea. Why don’t you start with that. If you had read and understood the abstracts to even one of those papers then you never would have linked to them.

    I read the whole papers which is why I posted them. I keep offering to discuss them but you keep running away. You still think you’re so smart you can tell what’s in a paper without reading it. Here’s a hint smart guy – the abstract won’t tell you everything.

    Your evidence all exists. It just doesn’t evidence anything you want it to.

    Those papers provide everything you asked for, everything you claim doesn’t exist – mechanisms and evidence for speciation down to the genome level, evidence and detailed genetic steps for the evolution of new body parts. The fact is, *nothing* will ever satisfy your requirements because you change to a new demand every time one is met. You move the goalposts so far and fast you’ll break the sound barrier. You’re not interested in learning, you’re here to proselytize.

    Why do you call me “ugly?” That’s the kind of word choice that reveals more about the one who chose it.

    Willful ignorance like you embrace is ugly. Blustering arrogance coupled with willful ignorance is downright hideous.

  308. it is possible to engineer an object to look natural, but the design explanatory filter was deliberately not designed to detect this

    I was kind of hoping you could demonstrate some method of detecting design that did not rely on knowledge of designers or of natural processes. Something that is inherent in the object itself.

  309. 309

    GB, every materialist I’ve ever known has simply and willfully ignored pertinent evidence, and yes, they have often (but not always) ignored it in a blustering fashion.

    Do you consider anyone (regardless of their position) who ignores evidence to be lacking rigor; attached to ignorance?

  310. Elizabeth:

    :) :) :) :) :)

    Connected space)

    Connected by what?

    :) :)

  311. Dr REC:

    Pardon, but, again, you have distorted what you are facing.

    Let me interleave responses:

    ______________

    >> This is a funny little dance you’re doing. ID is the notion that design in nature, exceeding a value you’ve set, must be the product of a designer, by inference to human design.

    1 –> We observe and experience ourselves as designers, and we observe other creatures such as beavers — you were invited to observe here on this, notice the varieties of dams — doing fairly similar things, sufficient to see that design is a manifestation of intelligence, not humanity.

    2 –> We also see that causal factors for aspects of objects, phenomena, processes, etc trace to mechanical necessity, chance, and design, which often leave recognisable or even characteristic traces.

    3 –> By doing an analysis of atomic resources available in our solar system or cosmos, we have a reasonable estimate of the upper limit of the number of possible configurations the atoms in question can have had across 10^17 s, a reasonable estimate for time available.

    4 –> We then apply a very well known bit of math, sampling theory, which tells us that isolated and unusual configs in a space of possibilities do not plausibly appear on a blind sample, unless the sample is a sufficiently large fraction of the possibilities to pass a limit of plausibility. For decades, such has been a key plank of hypothesis testing. At an extreme, it is also the foundation of the second law of thermodynamics — as the infinite monkeys type analysis underscores.

    5 –> We then construct a metric that uses a common class of information metrics as an index of complexity, here, number of configs. As you know, n bits has 2^n possible configs, from 000 . . . 0 to 111 . . . 1. So, we have a reasonable way to estimate search space, based on commonplace results.

    6 –> We then compare. For our solar system, 10^57 atoms for 10^17 seconds would have at most 10^102 Planck time quantum states. But 500 bits has 3*10^150 possibilities [and even the fastest chem rxns require 10^30 PTQS's], which is 48 orders of magnitude beyond, as in 1 straw to a cubical hay bale 3 1/2 light days across, about 10 times the size of our solar system out to Pluto.

    7 –> Even if a solar system were lurking in such a bale, a sample at that relative size, so long as it is blind, would with maximal probability, only come up with straw, the BULK of the distribution.

    8 –> So, we proceed, using 500 bits as a threshold of sufficient complexity to be relevant.

    9 –> We then modify the complexity metric I, with a dummy variable (per an objective warrant) that shows if or if not we are warranted to infer that the relevant observed complex and putatively specific outcome E comes from a definable narrow, unrepresentative zone T in the space of possibilities W; such zones of course being relevant to the sort of purposefulness we know that intelligences are capable of:

    Chi_500 = I*S – 500, bits beyond the solar system threshold

    10 –> The resulting metric as just shown works by then comparing complex enough specific outcomes E to the threshold. If beyond the threshold, the best, most plausible, empirically warranted inference is that E is an artifact of design.

    11 –> For instance, if you say 1,000 coins in a line with H/T in no particular order, I would be high, but S zero, Chi_500 = – 500. We would be warranted to infer that this happened by chance and/or mechanical necessity.

    12 –> But if the same string of coins encoded ASCII text for a passage in English of about 143 words, we would be well warranted to infer design, and the same would obtain if we were able to see that this was the bit pattern of a machine language program that worked in a known controller to carry out a task.

    13 –> If we were dealing with say 100 coins, it would be unusual to see ASCII text, or to see machine code, but the pattern would be within reach of the chance and necessity resources of our solar system, so we would default to chance and necessity. S would be 1, but I would be too low.

    14 –> Now, onlookers, please note: all of this has in effect been repeatedly laid out above, and there has been no cogent reply on the merits, just a brush aside. That is telling on the balance on the merits.

    I ask what design in nature has shown a spontaneous increase in biological fsci exceeding the value you set, and you refer me back to a human design (which actually produced no new biological fcsi, in my opinion-see below).

    15 –> Mischaracterisation and red herring. The evidence we have in hand, as previously presented, shows — at least to the unbiased, reasonable minded — that Venter et al have demonstrated the technology to create nanomolecular designs and integrate them into living forms, showing proof of concept that design is a feasible means of creating novel biological information and forms.

    Putting aside that you don’t actually have the demonstrated ability to calculate fCSI in biology*,

    16 –> Willful misrepresentation and falsehood in the teeth of actually presented (by link) analysis and facts. What was done (months ago) was to use the results from Durston et al in the literature to present several examples on H-functional state, for protein families, e.g.:

    we have some reason to suggest that if something, E, is based on specific information describable in a way that does not just quote E and requires at least 500 specific bits to store the specific information, then the most reasonable explanation for the cause of E is that it was designed. The metric may be directly applied to biological cases:

    Using Durston’s Fits values — functionally specific bits — from his Table 1, to quantify I, so also accepting functionality on specific sequences as showing specificity giving S = 1, we may apply the simplified Chi_500 metric of bits beyond the threshold:

    RecA: 242 AA, 832 fits, Chi: 332 bits beyond
    SecY: 342 AA, 688 fits, Chi: 188 bits beyond
    Corona S2: 445 AA, 1285 fits, Chi: 785 bits beyond

    17 –> In addition, the issue is not FSCI in biology, but that biology has FSCI in an information system, working as machine language in an algorithmic system that produces proteins. So, the issue then is what is the known source and empirically credible source of such FSCI. Ans: intelligence.

    18 –> In short, this is switcheroo, to try to reverse the real issue.

    it looks like you have a theory in search of an observation!

    19 –> Willful falsehood, in the teeth of presented evidence on the table for months.

    *(though you reference papers, where fits are estimated based on number of sequences performing the same function. This places enzymes, and domains well below the universal probability bound. Since we know evolution hasn’t searched all sequence space, this is probably an overestimate. Actually taking the sequence space of a moderate sized protein and testing for function would quickly exceed the resources of a laboratory).

    20 –> Misrepresentation and distortion that begs the question of what degree of darwinian type evolution has happened and is capable of on its mechanisms of chance variation [the putative source of any novel information] and culling on differential reproductive success [i.e so called natural selection, a SUBTRACTER, not a source, of information].

    “Venter et al have demonstrated proof of concept for intelligent design of living forms, period.”

    False. False. False. Venter did NOT design a genome. He copied a genome, added non-biologically relevant watermarks, and inserted it into a cell.

    21 –> Blanket denial in the face of highly relevant reality. Venter has shown that genetic engineers can manipulate the relevant molecules, can assemble/synthesise, can insert and can get such organisms to start up and reproduce.

    22 –> So, we see that intelligent designers are CAPABLE of creating novel organisms based on similar technologies, That is we have empirical proof of concept. Wiki:

    Proof of concept

    A proof of concept or a proof of principle is realization of a certain method or idea(s) to demonstrate its feasibility,[1] or a demonstration in principle, whose purpose is to verify that some concept or theory is probably capable of being useful. A proof-of-concept may or may not be complete, and is usually small and incomplete.

    A proof of concept of an idea is usually considered a milestone on the way to a fully functioning prototype . . .

    ““They rebuilt a natural sequence and they put in some poetry,” said University of California at San Francisco synthetic biologist Chris Voigt. “They recreated some quotes in the genome sequence as watermarks.”

    22 –> Red herring pulling away to a strawman

    It’s an impressive trick, no doubt, but replicating a natural genome with a little panache is also the limit of our present design capabilities.”

    23 –> Red herring –> strawman

    http://www.wired.com/wiredscie…..etic-life/

    Perhaps you could calculate the gain in biological fcsi in this experiment?

    I’d say it is zero-no new biological functionality.

    24 –> Tada, the strawman, duly knocked over.

    25 –> Tap tap tap, the real opponent is here, till standing.

    26 –> I have specifically highlighted proof of concept as the issue for the Venter case, consistently and for a long time. This has been just as consistently ignored in the rush to try to dismiss the significance of our having a demonstration that the sort of techniques a more advanced molecular nanotech lab would need to create cell based life are plainly feasible.

    27 –> Going beyond, the real issue on the table is that the discovery of FSCI-rich systems and techniques in the living cell opened a bridge from biology to information theory and related technologies so that the concepts, findings and issues in those fields are now directly relevant to biology and must be answered cogently. Which is what design theory sets out to do.

    28 –> And as the simplified, log reduced Chi metric shows, the answer, very strongly, is that the best explanatory causal factor for what we are seeing in biological systems, is design. machine code for complex integrated operations, starting at about 100,000 bits and d=ranging up to the billions.

    29 –> We have found the coins in a line, over 100,000 of them, and they are in machine code that works in a known algorithmic system.

    30 –> What best explains that, why, in light of the infinite monkeys challenge, starting from OOL and going on up through origin of major body plans, including our own? ANS: on what we know and can analyse, intelligence.

    31 –> So strong is this inference that those who reject it, are resorting to question-begging redefinitions of science that would cripple it from being able to be . . .

    an unfettered (but ethically and intellectually responsible) search for the truth about our world based on empircal evidence, observation, reasoned analysis and uncensored (but mutually respectful) discussion among the informed. [cf. here]

    32 –> That documented resort to worldview level question begging imposed by raw power to control major institutions of science and science education, is absolutely telling. >>
    ______________

    Cho, man, do betta dan dat!

    GEM of TKI

  312. OOPS: 143 ASCII characters, or about 20 – 25 words.

  313. Can you kindly confirm to us that you accept that there are NO responsible Christian thinkers and leaders who support genocide, specifically including Dr Craig?

    No, I cannot confirm that, kf, because as I read his article, Craig specifically states that under “divine command theory”, “God has the right to command an act, which, in the absence of a divine command, would have been sin, but which is now morally obligatory in virtue of that command.” This apparently includes genocide.

    I can see no other way of interpreting this except as saying that otherwise sinful acts, specifically including genocide, can be “morally obligatory” (aka “condoned”) if commanded by God.

    How else could you interpret it?

  314. P:

    Strawman, and setting an incoherent challenge.

    Design is an issue at all because we know design as designers, in a world where we see other designers (like beavers).

    The very point of the process of science is that we examine our world and the causal patterns and processes that seem to be at work in it. Mechanical necessity is one, chance is another, design is a third, in relevant contexts.

    If we are undertaking a scientific project, should we not work based on what we can observe about our world? Why then do you want to demand:

    . . . some method of detecting design that did not rely on knowledge of designers or of natural processes

    Similarly, is not the discovery of traces in an object that per investigation reliably point to root causal process, not an examination of something in the object itself that points to its credible origin?

    Does this not seem rather strange indeed, that you want something in the object that tells its roots but do not want to bring to bear the empirical investigations and empirically reliable findings that identify signs that point to causal factors that best explain certain features?

    It seems the real problem is the signs in question strongly point where you would not go, and you are willing to be selectively hyperskeptical in approach to science to lock that out. This is ideology, not sound science.

    GEM of TKI

  315. F/N: The design inference is inference to best explanation based on comparison of known causal processes and patterns, and the characteristic signs they often leave behind.

    This is precisely not an appeal to ignorance, save that when we deal with cases where we did not directly observe the deep past of actual origin, we must infer any explanation we attempt.

    To try to cast the general challenge faced by any origins science investigation as though it were a particular objection to design theory is blatantly selectively hyperskeptical.

    GEM of TKI

  316. F?N: Of course, Dr REC neatly fails to identify that

    (a) there are many protein families that DO cross the FSCI threshold, and

    (b) collectively — there are many proteins in a cell needed for the functions of life to happen –

    . . . so that in aggregate the living cell is WELL beyond the threshold where the import of the design inference is DESIGN.

    GEM of TKI

  317. Connected by ridges of equal (or at least not hugely unequal) phenotypic fitness.

    To stick with the metaphor (and remember fitness space is high-dimensioned), fitness space (i.e. sets of parameter values affect phenotypic fitness) consists of lots of low places (unfit parameter combos), and far fewer high places (fit parameter combos).

    If the the fitness landscape is such that the height of one spot in the landscape bears no correlation with the height of neighbouring spots, then Darwinian search algorithms will be no more effective at finding the high spots that random search. And if those high spots are rare, then the probability of any search algorithm finding any of the high spots will be low.

    However, if there is a correlation between the height of one spot and the height of neighbouring spots (spatial autocorrelation) then Darwinian search algorithms will tend to find the high spots in regions of fitness space where the spatial autocorrelation is high. It won’t find (won’t get near) those islands of fitness in which the spatial autocorrelation is low.

    So the question is: what is the nature of the biological fitness landscape? Does it include a network of spatially autocorrelated fitness?

    The answer appears to be yes.

    To abandon the metaphor (because they can get in the way):

    Breeding populations (goes the theory), over time, will tend to exhibit greatest prevalence of genes, or alleles of genes that tend to maximise the probability of reproductive success within the current environment. New alleles, and sometimes new genes, are constantly being generated by means of substitution, insertion, deletion, duplication and recombination during the reproductive process, most of which are near-neutral in effect. This means that the gene pool in a population is continually fed by near-neutral novelty, giving populations of substantial size the capacity to absorb environmental change, which includes changes to allele prevalences in the population itself.

    It also includes changes to the “genetic environment” – in other words new alleles or genes are generated in an existing genetic context, and at least in sexually reproducting populations, this opens the door to potentially beneficial gene x gene interactions.

    And because of these feedback loops between changes in allele freqency and phenotypic fitness, we would expect (as in any feedback system) to see non-linear rates of change in phenotypic characteristics (e.g. “punk eek”).

  318. Onlookers:

    In a parallel thread, Joseph explicitly disclaims Christian affiliation.

    What GB is doing here is the smear tactic of trying to imply that design theory and the design movement are nothing more than a stalking horse for Biblical Young Earth [based on the examples chosen] Creationism.

    Since this has been repeatedly corrected in easily accessible fora, including the resources tab top of this and every UD page, this is an irresponsible, willful misrepresentation continued in the teeth of correction.

    It is therefore time to bring to bear a little point from Wikipedia (which that online encyclopedia itself needs to heed on this subject):

    Those who indulge in the more stubbornly correction-resistant forms of such selective hyperskepticism should therefore reflect soberly, slowly and seriously on this Wikipedia summary definition of lying (acc: Jul 23, 2011):

    To lie is to state something with disregard to the truth with the intention that people will accept the statement as truth . . . . even a true statement can be used to deceive. In this situation, it is the intent of being overall untruthful rather than the truthfulness of any individual statement that is considered the lie . . . . One can state part of the truth out of context, knowing that without complete information, it gives a false impression. Likewise, one can actually state accurate facts, yet deceive with them . . . . One lies by omission when omitting an important fact, deliberately leaving another person with a misconception. Lying by omission includes failures to correct pre-existing misconceptions. Also known as a continuing misrepresentation . . . . A misleading statement is one where there is no outright lie, but still retains the purpose of getting someone to believe in an untruth . . .

    GB et al know, or should know, that design theory is quite different from Creationism in focus, methods and view of empirical, scientific investigations. However, having successfully smeared Creationists decades ago, it is ever so easy to resort to smearing design thinkers that they are just creationists hiding in cheap tuxedos. Moreover, by promoting that misrepresentation, they are resorting to bigotry and bias, in the hope of poisoning and polarising an atmosphere to their advantage.

    This all too common disregard for duties of care to truth and fairness, we should take due note of in further dealings with such, as well as the underlying issue that the evolutionary materialism that so often drives such, is inherently amoral and tends to view moral sensibilities as little more than handy levers of emotional manipulation.

    Most recently we saw — kindly, cf OP, discussion and onward links here [including Dr Torley's 10 questions post and the linked videos . . . ] before assuming I do not know what I am talking about — that in the case of professor Dawkins, on record that he cannot ground moral objections to either infanticide or Hitler’s holocaust etc, and yet who wants to smear another person — in the teeth of easily accessible facts to the contrary — for allegedly supporting genocide; full well knowing that this false accusation will also spread a blanket of poisonous suspicion against Christians in general.

    So, we can add up a few things:

    a: falsely smearing design theorists and the design movement as a fraud carried out by creationists +

    b: falsely smearing Creationists and others who have questions regarding the evolutionary materialist paradigm and worldview as ignorant, stupid, insane or wicked +

    c: falsely accusing those who object to the imposition of evolutionary materialism unto even the definition of science and/or the carrying out of morally questionable scientific investigations as being anti-science (in an era where science is the closest thing to a consensus good for the community) +

    d: too often using the term “fundamentalist” or the like and invidious comparisons to IslamIST terrorists or the like to smear Bible believing Christians as would-be violent theocratic terrorists and tyrants +

    e: now trying to spread a blanket of poisonous suspicion that Christians support genocide
    ___________________________

    = f: Bigotry-driven willful disrespect, abuse, belittling, willful misrepresentation and demonisation — in some cases amounting to blood libel calculated to stir up hostility or even hate against the new cultural scapegoats; those dangerous fundy dummy Bible-thumping Christians, including those hiding behind lab coats and science, medicine, math, engineering or philosophy graduate degrees

    Such a pattern is very, very, very dangerous.

    And yet, it is playing out before our eyes.

    Something is very wrong here, and GB et al need to clean up their act.

    Before it is bloodily too late.

    GEM of TKI

  319. Elizabeth:

    Well, I think we stay almost on common ground on the fundamental points. Maybe some clarifications are still needed, however:

    polint b) About the symbolic character of DNA information, what I mean is only that the codons “represent” aminoacids. That is symbolic, IMO, because the codons in themselves are not related to the AAs except for a symbolic association. But is the word causes problems, it’s fine for me to define that simply a “mapping”. The important point is that the particular mapping is not determined by biochemical laws (more on thet after).

    point c) I am not sure what you mean here:

    “yes, I accept that, as long as we are only talking about mRNA after editing. At that point, the mapping is one-to-one-or-more, and all units are triplets.”

    As far as I can see, the mapping is many-to-one both in DNA and in mRNA. mRNA splicing takes away the non coding parts. But for the coding parts, the mapping is always many-to-on (many codons map to one and only one aminoacid, or a stop signal).

    point d) Here there is perhaps a significant difference. When I say that there is no biochemical law that connects the codons to the AAs, I mean just that: the laws of biochemistry do not connect the codons to the AAs, and the mapping is arbitrary, biochemically.

    Your discussion about the “selection of the set” is not pertinent here. We are just dealing with the necessity laws of biochemicstry here, the laws that explain why some molecules react with others and how.

    Moreover, you insist in attributing the decoding of the code to tRNAs. That is wrong. The decoding is effected by the tRNA aminoacyl synthetases, as clearly stated in my post. The tRNAs in themselves have no information about the code.

    point f) “Independently” means that we have two different objects that are “built” around the code: the gene codes for a specific protein according to the code; and the 20 tRNA aminoacyl synthetases are built so that they can couple the right aminoacid (according nto the code) to the right tRNA with the right anticodon.

    Now, protein coding genes and AARS are different objects. That’s why I say that they are “independently” connected to the code. Whatever the explanation for the origin of the code, it must explain both how information is coded in the genes and how the 20 proteins that translate the code emerged.

    You say:

    The set of 20 tRNA molecules will give you the mapping, but you couldn’t derive the mapping without access to that set. An alien, given only the genome, would be hard pressed to derive the mapping, unless they could figure out where in the genome the tRNA molecule templates would be found.

    First of all, again, it’s not the tRNA templates that give access to the code. It’s the 20 AARS.

    And your statement is wrong: the code can be decoded by the knowledge of the protein genes and of their corresponding proteins, without any knowledge of the translation process. Or, as it was really done, if you have a cell free system that can synthesize proteins you can just go by trial and error and decode the code, even if you have no idea of how the system you are using works. The point is: the results of the system are a clear key to the code used in the system, even if the implementation of the process is not known.

    More in next post

  320. The causal features that best explain a “digital” pattern would be those phenomena that have been observed to produce at least part of the pattern.

    One does not have to observe an entire orbit of Pluto to infer that an orbit is the best explanation of its current position.

    Nor does one have to observe the entire history of life to infer that known and observable processes can produce the changes that make one vertebrate different from another. Particularly, since those changes do not require new protein domains (the sticking point of Behe’s Edge).

  321. Well, I think we stay almost on common ground on the fundamental points. Maybe some clarifications are still needed, however:

    polint b) About the symbolic character of DNA information, what I mean is only that the codons “represent” aminoacids. That is symbolic, IMO, because the codons in themselves are not related to the AAs except for a symbolic association. But is the word causes problems, it’s fine for me to define that simply a “mapping”. The important point is that the particular mapping is not determined by biochemical laws (more on thet after).

    This looks circular to me, gpuccio. You are saying that the relationship of codon to amino acid is “symbolic” because they are only related via a “symbolic association”.

    So let’s call it a “mapping” which has slightly less semiotic baggage, and deal with the “biochemical laws” later :)

    point c) I am not sure what you mean here:

    “yes, I accept that, as long as we are only talking about mRNA after editing. At that point, the mapping is one-to-one-or-more, and all units are triplets.”

    As far as I can see, the mapping is many-to-one both in DNA and in mRNA. mRNA splicing takes away the non coding parts. But for the coding parts, the mapping is always many-to-on (many codons map to one and only one aminoacid, or a stop signal).

    Well, tryptophan is only mapped to UGG, and methionine only to AUG. But apart from that niggle, sure, we agree on this – the important thing is that each possible codon is only mapped to not more than one amino acid.

    point d) Here there is perhaps a significant difference. When I say that there is no biochemical law that connects the codons to the AAs, I mean just that: the laws of biochemistry do not connect the codons to the AAs, and the mapping is arbitrary, biochemically.

    Yes, but that doesn’t mean there isn’t perfectly good chain of causality.

    Your discussion about the “selection of the set” is not pertinent here. We are just dealing with the necessity laws of biochemicstry here, the laws that explain why some molecules react with others and how.

    In my view it is highly pertinent. A set that maps each possible codon to no more than one amino acid is going to result in far closer mapping of genotype to phenotype than a set in which each possible codon may map to more than one amino acid. This means that the fewer amino acids mapped to each codon the higher better the reproductive prospects for the offspring of a parent with useful protein. This means that a set with this characteristic is evolvable.

    Moreover, you insist in attributing the decoding of the code to tRNAs. That is wrong. The decoding is effected by the tRNA aminoacyl synthetases, as clearly stated in my post. The tRNAs in themselves have no information about the code.

    I agree that it was an over-simplification. However I disagree that “the tRNAs in themselves have no information about the code”. For a start I think we need to be very careful with that word “information”: who or what is being “informed” here? What is the information transfer process in question? The process by which a specific amino acid is “called” by an RNA triplet involves the unique tRNA molecule that binds specifically to that triplet, and the tRNA synthetase that effects the binding of the a unique (normally – not always) amino acid to that tRNA molecule. It seems to me you can’t really say that the “information” about the mapping resides in one place rather than the other. If the tRNA set were not one per codon, there could be no mapping, and if the tRNA synthetase did not effect the binding of a unique amino acid to each tRNA molecule, the mapping wouldn’t be accomplished. Both are necessary.

    point f) “Independently” means that we have two different objects that are “built” around the code: the gene codes for a specific protein according to the code; and the 20 tRNA aminoacyl synthetases are built so that they can couple the right aminoacid (according nto the code) to the right tRNA with the right anticodon.

    But what is “independent” about these three sets of objects (codon, tRNA molecule, tRNA synthetase)? It seems to me that they are extremely tightly coupled, not “independent” at all.

    Now, protein coding genes and AARS are different objects. That’s why I say that they are “independently” connected to the code. Whatever the explanation for the origin of the code, it must explain both how information is coded in the genes and how the 20 proteins that translate the code emerged.

    OK, maybe I see what you are getting at. I agree it is a multipart system. I do not see the parts as “independent” however, and now you use the word “emerged” we are right back at my point that you earlier dismissed as irrelevant – selection.

    Now, I’m perfectly willing (how could I be otherwise?) to concede that we do not yet know how the “genetic code” emerged. However, I do reject the idea that there is anything inherently mysterious or baffling about its origins, and I think the idea that there is (“therefore ID”) possibly arises from this idea that the parts are “independent” in some way. Meyer makes a similar point in The Signature in the Cell, and it’s essentially an Irreducible Complexity argument – that you need to have all the components of the coding process in place before any of it will work, and until any of it works, Darwinian processes can’t begin.

    I don’t think this is a safe assumption – I don’t see any reason why coding systems can’t evolve from very simple beginnings, as reproductive fidelity itself will tend to have reproductive advantages, as will phenotypic fidelity to the genotype.

    You say:

    The set of 20 tRNA molecules will give you the mapping, but you couldn’t derive the mapping without access to that set. An alien, given only the genome, would be hard pressed to derive the mapping, unless they could figure out where in the genome the tRNA molecule templates would be found.

    First of all, again, it’s not the tRNA templates that give access to the code. It’s the 20 AARS.

    And your statement is wrong: the code can be decoded by the knowledge of the protein genes and of their corresponding proteins, without any knowledge of the translation process.

    We are misunderstanding each other. Obviously if you know the “protein genes and … their corresponsding proteins” you can decode the code, because you’ve just been handed the code! But see above, also.

    Or, as it was really done, if you have a cell free system that can synthesize proteins you can just go by trial and error and decode the code, even if you have no idea of how the system you are using works.

    I agree entirely, but first you need the “cell free system that can synthesise proteins”. That system (derived from cells) contains the information you want to retrieve.

    The point is: the results of the system are a clear key to the code used in the system, even if the implementation of the process is not known.

    I agree.

    Good place to pause :)

  322. Then I’ve misunderstood. I thought the idea was that over time reptiles had evolved into mammals and birds, and so on.

    Actually no. Or not exactly. It’s really important IMO to distinguish between longitudinal differentiation and lateral diversification.

    The first is how about things change along one lineage, which is always incremental. That’s what we call adaptation. The second is about differences between different lineages at any one time, where there will be (by definition, in fact) discontinuities. That’s what we call speciation.

    But the nomenclature is confusing, not least because down some lineages there will be fairly little adaptive evolution (modern reptiles resemble there reptilia ancestors quite closely) whereas down others there will be much more (birds and mammals resemble neither modern reptiles nor each other very closely, but and bear much less resemblance than modern reptiles do to their common reptilia ancestor).

    So all adaptation is longitudinally stepwise (as in finch beaks et al), but speciation is the name we give to the divergence, laterally, between lineages, and results in lateral discontinuities (so birds can’t mate with mammal, nor even chimps with orangutans, although perhaps lions with tigers at a pinch).

    If you’re not claiming that evolution is the primary cause of such biological diversification, but rather tinkers with finch beaks and lizard heads and makes cichlid fish change colors, then we are in agreement, and we can leave it there.

    And so evolution is indeed the “primary cause” of biological diversification, but diversification occurs when different lineages adapt in the usual way, incrementally, but independently (because the populations stop interbreeding, and cease to share the same gene pool).

  323. GinoB:

    Joseph, please tell us more about your evidence for Noah’s Flood, baraminology, and Adam & Eve.

    1- The evidence for baraminology comes from SCIENCE

    2- The evidence for a global flood also comes from science

    3- And I am unaware of any evidence for Adam and Eve

    But please, we are all waiting, tell us about this alleged evidence for your position?

  324. kairosfocus

    What GB is doing here is the smear tactic of trying to imply that design theory and the design movement are nothing more than a stalking horse for Biblical Young Earth [based on the examples chosen] Creationism.

    KF, it was Joseph who first brought up Noah’s Flood and baraminology and claimed there was scientific evidence for them, not me. ScottAndrew2 has also admitted to being a Biblical Creationist. So don’t go blustering that no one is using ID to support their religious position.

    In a parallel thread, Joseph explicitly disclaims Christian affiliation.

    Joseph at various times over the last few years has claimed to be a Christian, and an atheist, and a Muslim. He’s also at times claimed to be an Iraqi war hero, and a practicing scientist, and an airline pilot, and an Olympic class athlete, and an expert in genetic algorithms. You take what he says with a bucketful of salt.

  325. 325

    Elizabeth,

    (In response to “Then I’ve misunderstood. I thought the idea was that over time reptiles had evolved into mammals and birds, and so on.”

    Actually no. Or not exactly. It’s really important IMO to distinguish between longitudinal differentiation and lateral diversification.

    You mean well, but it wasn’t my intention to give a complete summary of evolutionary theory, and it was unnecessary for you to reply with one. It was just a sentence that was part of a thought I was forming.

    Unless it is not the case that, according to evolution, reptiles evolved into birds and mammals, then there’s really no need to nitpick. It would really be a burden if I couldn’t just make a statement like that without having to spell out the theory in detail.

  326. 326

    GinoB,

    ScottAndrew2 has also admitted to being a Biblical Creationist. So don’t go blustering that no one is using ID to support their religious position.

    You don’t know anything about my religious position other than that I believe God created things. The only time I have mentioned my religious belief in the context of this ID discussion is when you repeatedly demanded it. I am not interested in discussing my religion in this context.

    First you demand that I identify my religious beliefs. Now you see exactly why I did not. Because now you seize upon it and suggest that I’m pushing those beliefs – the very ones I declined to bring up. When I don’t express them, you call me a hypocrite. Then, when after repeated demands I do express them, you accuse me of pushing them on you and others.

    My religious beliefs extend far beyond who created what and when. I cannot use ID to support them because ID does not support them.

    I’ve been reasonably civil. Unlike you, I do not resort to childish name-calling (liar, hypocrite, gutter-dweller, moron, slimy, butt-hurt girl. [???]) I guess you have to use whatever tools are in your box.

    But you are a troll. That is an established term which refers to a known behavior, that of entering an internet discussion for the sole purpose of harassing and mocking others or disrupting the discussion.

    You’ve been shown a surprising amount of patience and tolerance. I hope they run out soon, as I’m sure many others do.

  327. No, I know that wasn’t your intention, Scott, but I think it is quite an important point all the same :)

    The “nitpicks” are actually rather important details!

    So let me ask you: what kind transition do you have in mind that is critically more than the kind of evolution of, say, beak sizes in response to changes in seed sizes?

    Because my point was that “reptiles” didn’t “evolve into birds and mammals”. Amniotes diverged into saurapsids and synapsids; mammals evolved from the synapsid branch, while the saurapsids (sometimes called “reptilia” but not “reptiles”) diverged into various lineages, including turtles down one route, lizards down another, and birds down another.

  328. ScottAndrews2

    GinoB: “ScottAndrew2 has also admitted to being a Biblical Creationist. So don’t go blustering that no one is using ID to support their religious position.”

    You don’t know anything about my religious position other than that I believe God created things.

    Then you’re a Biblical Creationist, exactly as I said. Nothing wrong with that per se, except you seem to be ashamed of it for some reason.

    My religious beliefs extend far beyond who created what and when. I cannot use ID to support them because ID does not support them.

    Then I’ll ask again – why are you posting on a supposedly scientific ID website? There are lots of sites online for Christian Apologetics.

    But you are a troll. That is an established term which refers to a known behavior, that of entering an internet discussion for the sole purpose of harassing and mocking others or disrupting the discussion.

    Which describes your behavior to a T. Projecting your actions and calling others who point out your scientific ineptitude a troll is another time-honored Creationist tactic.

    I do agree that we rub each other the wrong way, and I for one am willing to call a truce. I’m also still willing to civilly discuss the details of those scientific papers. Want to give me your explanation, ID or otherwise, for the evidence in the treehopper helmet evolution one? Ignoring the evidence won’t make it go away.

  329. 17.1.1.1.3

    How many times more do we need to point out to evolutionists that “unfit parameter combos” are not low places but areas where where fitness is not defined?!

    Search is not physically possible across islands of functionality. Gene duplication, recombination and other tricks won’t take us far enough, e.g. from a cell to a human.

    Evo story telling again and again. Maybe it is time to remind that the number of times alone these fairy tales are repeated with the air of knowledge but without evidence will not make them come true.

  330. 330

    GinoB,

    Put it in your own words. I’ll no longer afford you the respect of wasting my time reading whatever you dig up. Why should I think that this is any different from anything you’ve posted on this board, or on the other where you troll under the name Thorton?

    Enough of you.

  331. ScottAndrews2

    Put it in your own words. I’ll no longer afford you the respect of wasting my time reading whatever you dig up.

    How can you stop doing something you never did in the first place?

    Why should I think that this is any different from anything you’ve posted on this board, or on the other where you troll under the name Thorton?

    Enough of you

    Fine by me. I offered a truce and a chance for civil discussion. I’m not surprised you refused, since you know your scientific incompetence would be brutally exposed.

    I do hope those brown stains wash out of your shorts.

  332. How many times more do we need to point out to evolutionists that “unfit parameter combos” are not low places but areas where where fitness is not defined?!

    I hope one less time than the number of times evolutionists need to “point out” that this is nonsense!

    Search is not physically possible across islands of functionality. Gene duplication, recombination and other tricks won’t take us far enough, e.g. from a cell to a human.

    No, it isn’t. That’s what we are saying. Darwinian processes (which include, but are not restricted to, the generation of genotypic variance by “duplication, recombination and other tricks”) won’t carry populations across very wide plains or very deep gulfs in fitness space. So we should observe, as we do, the exploration of fitness space that is connected by moderately wide plains or upward slopes, and only obstructed by narrow ravines of limited depth. Fortunately, in a high dimensioned fitness landscape, there will be a rich network of such connections, and we know that biological populations inhabit a high dimensioned fitness landscape.

    Evo story telling again and again. Maybe it is time to remind that the number of times alone these fairy tales are repeated with the air of knowledge but without evidence will not make them come true.

    What I am seeing here is ID story-telling about evolutionary straw men! Perhaps the problem is the metaphor. Let’s try without.

  333. Dr Liddle:

    Kindly cf here with here (and context!), noting the very recent Chaitin paper. (Do not omit the original post by Dr Torley, please.)

    Pardon fair comment but I think some rethinking will be in order on your part.

    GEM of TKI

  334. Elizabeth:

    Darwinian processes (which include, but are not restricted to, the generation of genotypic variance by “duplication, recombination and other tricks”)

    As far as you know duplications and recombinations are design mechanisms.

    IOW once again you are begging the question.

  335. All you need to do is demonstrate that cells originated in one step.

    Were you there?

  336. 336

    Petrushka,

    Why assume that design must occur in one step? I put together an entertainment center. It took 15, for me, more if you count preparing and packing the materials and printing instructions.

    That’s beside the point. No one has observed anything. Until Szostak, etc. successfully demonstrate the deliberate design of a living organism, extrapolation and inference are the tools in our box.

    That’s heavier burden for the materialist because there is nothing from which to extrapolate or infer, and the only research in progress attempts to emulate intelligent design.

  337. 337

    Elizabeth,

    Fortunately, in a high dimensioned fitness landscape, there will be a rich network of such connections, and we know that biological populations inhabit a high dimensioned fitness landscape.

    We can’t help but be suspicious of “evidence” that is always expressed as abstractions such as fitness landscapes, but never through specific examples. Without such, how can you know that your abstractions hold water?

  338. ScottAndrews2

    Why assume that design must occur in one step? I put together an entertainment center. It took 15, for me, more if you count preparing and packing the materials and printing instructions.

    That’s the assembly part, not the design part.

    Human designed products usually go through multiple separate stages – design, collection of raw materials, manufacturing of the parts, assembly of the parts.

    All you keep asserting is the design part. What about the raw materials, manufacture, and assembly of your claimed ‘designed’ biological life? When were they done, and where, and how?

    That’s heavier burden for the materialist because there is nothing from which to extrapolate or infer, and the only research in progress attempts to emulate intelligent design.

    LOL! “THAR AIN’T NO DARN EVIDENCE!!”

    That gets funnier every time you claim it.

  339. GinoB:

    What about the raw materials, manufacture, and assembly of your claimed ‘designed’ biological life? When were they done, and where, and how?

    That is what science is for- if we knew all the answers we wouldn’t need science.

    And if your position had some positive evidence to support it you wouldn’t need to attack ID with your ignorant spewage.

  340. We can’t help but be suspicious of “evidence” that is always expressed as abstractions such as fitness landscapes, but never through specific examples. Without such, how can you know that your abstractions hold water?

    I think that’s a fair point, Scott, which is why I keep suggesting we drop the metaphor! But if questions are posed in terms of “search” then “fitness landscape” is the relevant abstract level.

    But I’d much rather talk about basic processes, which is why, rather than “natural selection” I tend to talk about “differential reproductive success” which is all it is, and instead of “RM+NS”, of “self-replication with heritable variance in reproductive success”. I think it’s terribly important to be aware of what we are talking about at any given time, and unfortunately we have no lost DrBot, who has a great deal of relevant knowledge in this domain (for absolutely no good reason, I have to say – kf accused him of saying something he simply did not say, and then I gather he was banned for quite understandably responding to a “libel” charge with a wink-smiley’d libel comment of his own! Anyway just thought I’d throw that in there, as it’s one of a number of reasons I’m trying to abstract myself from these conversations!)

    To understand the “fitness landscape” metaphor, it’s really important to distinguish between phenotype (the entity that reproduces) and genotype (the component of the phenotype that ensures a high degree of reproductive fidelity), and also between “individual” and “population” and I think this is not always clear in these discussions (it certainly hasn’t been in this one).

    So if people make claims about “search” and “islands of functionality” then those have to be understood in terms of “fitness function”.

    But much better to drop those terms IMO, and figure out what they are metaphors for.

  341. 341

    GinoB,

    Try assembling a piece of furniture from pieces that were not deliberately collected to carry out a previous design and see how far you get. That you even have pieces which can be assembled to form a finished product indicates intelligence and planning.

    Or, if you have all of the correct pieces, try assembling them without instructions (input from the designer) and without using any intelligence (biting my tongue here.) You will quickly find that intelligence of some sort is required for the final assembly.

    Notice that these simple truths can be observed through countless examples in the reality we inhabit. To observe that regularity and explain the consistency is scientific. To insist that a far more advanced assembly is the exception to the rest of observed reality, which would make it consistent with nothing at all, is ignorance.

  342. ScottAndrews2

    Try assembling a piece of furniture from pieces that were not deliberately collected to carry out a previous design and see how far you get. That you even have pieces which can be assembled to form a finished product indicates intelligence and planning.

    Or, if you have all of the correct pieces, try assembling them without instructions (input from the designer) and without using any intelligence (biting my tongue here.) You will quickly find that intelligence of some sort is required for the final assembly.

    I’ll ask the same question again.

    NH3 + HCl –> NH4Cl

    Where is intelligence required to assemble the ammonium chloride?

  343. The great scientist Max Planck said the following during his Nobel Prize acceptance speech:

    “All matter originates and exists only by virtue of a force which brings the particles of an atom to vibration and holds this minute solar system of the atom together . . . . We must assume behind this force the existence of a conscious and intelligent mind.”

  344. 344

    GinoB,

    Last week you demanded that KF prove that a volcano wasn’t designed. Now you want me to argue that a simple chemical reaction does require intelligence.

    Trolling.

  345. ScottAndrews2

    Last week you demanded that KF prove that a volcano wasn’t designed.

    No I didn’t. I asked him to validate his claimed process for detecting design with a real world example, and he couldn’t do it. Please stop lying about what was said. It’s not Christian.

    Now you want me to argue that a simple chemical reaction does require intelligence. Trolling

    No, just pointing out the flaws in your claims.

    You say everything that gets assembled needs intelligence. I showed you how something was assembled with no intelligence required.

    Looks like your claim is busted.

  346. “Explain why the origins of biological fsci cannot be inferred from the origins of non-biological fsci.”

    Because that:

    1) Lacks an observation-the inference of design is based on an the probability of large amounts biological fsci arising at once, beyond the universal probability bound. No observation, no point to the inference (especially when smaller incremental increases in biological fsci are observed).

    2) Lacks a reasonable metric-no one can actually calculate fsci for any meaningful biological object.

    3) Using an unlimited inference is an abuse of logic. Present human designs that are non-biological fcsi explain biological fsci in the past? If I intentionally drop a ball, are all falling objects past and present intentionally dropped? In 1850, the only mechanical transport was steam-engine based. Human design. By inference, would a ID advocate of the time one conclude mechanical transport in nature use must the same mechanism?

    =======================

    By the way, KF, I saw how you referred to non-believers as gangrenous, and then closed the comments to that thread. How very kind of you. Ironic how much anger and ‘turnabout’ you spewed forth on a thread dedicated to showing how only your opposition has those faults.

    But let us keep is substantive. Can you provide me an empirical example of biological fsci arising at once, and exceeding the universal probability bound? Provide the calculation.

Leave a Reply